Recombinant virus PEDV [delta] N trVLP as well as preparation method and application thereof

Abstract

The invention discloses a recombinant virus PEDV [delta] N trVLP as well as a preparation method and application thereof, and belongs to the technical field of biology, the preparation method comprises the following steps: cutting and replacing an N gene of a plasmid pBAC-PEDV-DR13S into a reporter gene sequence, then transfecting to a cell for ectopic expression of PEDVN protein, and rescuing the recombinant virus PEDV [delta] N trVLP. The invention also discloses an application of the recombinant virus PEDV [delta] N trVLP in preparation of a medicine for preventing or treating the porcine epidemic diarrhea virus. The virus without the PEDVN gene has transcription and replication capabilities, can realize a complete virus life cycle, is completely limited in cells for ectopic expression of PEDVN protein, has higher safety compared with a traditional vaccine, and can provide an important thought for research and development of vaccines in the future.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a recombinant virus PEDVΔN trVLP and a preparation method and application thereof. Background Art

[0002] Porcine epidemic diarrhea (PED) caused by porcine epidemic diarrhea virus (PEDV) is an intestinal infectious disease usually accompanied by symptoms such as diarrhea, dehydration, loss of appetite and fever. It causes a mortality rate of nearly 100% in suckling piglets and has become one of the main pathogens causing diarrhea in pig herds, causing huge economic losses to the pig farming industry.

[0003] The PEDV virus itself is highly mutable, which leads to the continuous emergence of various mutant strains. Before 2010, the vaccine prepared with the CV777 strain could produce a good immune effect on the original epidemic strains, so PED was sporadic in my country and did not cause serious harm. However, since 2010, a new PEDV mutant (G2 subtype) has appeared, which has become one of the main pathogens causing diarrhea in pigs, causing huge economic losses to the pig farming industry. However, the pathogenic mechanism of the disease is still unclear, and the original inactivated vaccine can no longer provide effective immune protection. Although the attenuated live vaccine has good immunogenicity, it also has the risk of reversion; therefore, it is urgent to develop a safe, effective and immunogenic vaccine.

[0004] By analyzing the structure of the PEDV genome, it can be found that the total length of the PEDV genome is about 28kb. Similar to other coronaviruses, PEDV includes a 5' non-coding region, 7 open reading frames (ORF1a, 1b, 2-6) and a 3' non-coding region. The genome encodes four structural proteins, including S protein, E protein, M protein and N protein. The nucleocapsid (N) protein encoded by the coronavirus genome plays multiple functions in the viral replication cycle. However, the deletion of the PEDV N gene directly affects the replication of the virus, and the complete life cycle of the virus cannot be reproduced, which is not conducive to the study of related pathogenic mechanisms. Therefore, the present invention prepares and produces PEDV recombinant viruses (PEDVΔN trVLP) that lack the N gene and still have the ability to transcribe and replicate. Summary of the invention

[0005] The purpose of the present invention is to provide a recombinant virus PEDVΔN trVLP and a preparation method and application thereof to solve the problems existing in the above-mentioned prior art. The recombinant virus PEDVΔN trVLP can stably proliferate in the Vero-N cell line, proving that it has the potential to be used as a gene-deficient vaccine and provides important ideas for the development of future vaccines.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a method for preparing a recombinant virus PEDVΔN trVLP, comprising the following steps:

[0008] The N gene of the plasmid pBAC-PEDV-DR13S was cut and replaced with a reporter gene sequence, and then transfected into cells ectopically expressing the PEDV N protein to rescue the recombinant virus PEDVΔN trVLP;

[0009] The plasmid pBAC-PEDV-DR13S is constructed by inserting the genome sequence of the YN200 virus into the BAC vector, and then replacing the Spike segment of the YN200 virus with the Spike segment of the DR13 virus;

[0010] The accession number of the complete genome sequence of the YN200 virus in NCBI is KT021233;

[0011] The sequence of the Spike fragment of the YN200 virus is located at 20634-24785bp of the whole genome sequence with NCBI accession number KT021233; the sequence of the Spike fragment of the DR13 virus is located at 20610-24758bp of the whole genome sequence with NCBI accession number JQ023162.1.

[0012] Furthermore, the N gene of the plasmid pBAC-PEDV-DR13S was cut using the sgRNA having a nucleotide sequence as shown in SEQ ID NO.1-2.

[0013] Furthermore, transfection was performed using a lentiviral three-plasmid packaging system.

[0014] Furthermore, the cells include Vero cells; and the reporter gene includes EGFP gene.

[0015] The present invention also provides the recombinant virus PEDVΔN trVLP obtained by the preparation method.

[0016] The present invention also provides the use of the recombinant virus PEDVΔN trVLP in preparing a drug for preventing or treating porcine epidemic diarrhea virus.

[0017] Furthermore, the porcine epidemic diarrhea virus drug includes a porcine epidemic diarrhea virus vaccine.

[0018] Furthermore, the porcine epidemic diarrhea virus vaccine includes a whole virus inactivated vaccine, a live attenuated vaccine or a genetically engineered vaccine.

[0019] The present invention discloses the following technical effects:

[0020] The present invention utilizes ectopic expression in packaging cells to trans-complement viral N protein, thereby producing recombinant virus PEDVΔN trVLP. Through rescue, passage identification and transmission electron microscopy observation of the recombinant virus, it is confirmed that PEDVΔN trVLP can stably proliferate in the Vero-N cell line, proving that the PEDVΔN trVLP strain has the potential to be used as a gene-deficient vaccine. This method enables the virus lacking the PEDV N gene to have the ability to transcribe and replicate, can realize the complete viral life cycle, and is completely confined to cells that ectopically express the PEDV N protein. Compared with traditional vaccines, it has higher safety and can provide important ideas for the development of future vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 The diagram is a construction strategy diagram of the recombinant plasmid pBAC-PEDV-DR13S-EGFP / ΔN;

[0023] Figure 2 The figure shows the construction of the recombinant plasmid pBAC-PEDV-DR13S-EGFP / ΔN; A is the electrophoresis diagram of the sgRNA in vitro transcription of the PEDV N gene; B is the result of the restriction digestion of pBAC-PEDV-DR13S using sgRNA; C is the result of the amplification of the EGFP fragment; D is the colony PCR identification diagram after homologous recombination between the EGFP fragment and the vector after sgRNA cutting;

[0024] Figure 3 The figure shows the construction of the Vero cell line stably expressing PEDV-N; A shows the result of amplification of the PEDV N gene; B shows the result of PCR identification of the stable cell line; C shows the result of Western blot identification of the stable cell line; D shows the result of IFA identification of the stable cell line;

[0025] Figure 4 The rescue and passage identification of the recombinant strain PEDV EGFP / ΔN trVLP; A is the result of IFA identification of the recombinant strain; B is the result of PCR identification of the P1-P3 generation recombinant strains;

[0026] Figure 5The morphology of PEDV EGFP / ΔN trVLP under transmission electron microscopy; A: control group transfected with pBAC-PEDV-DR13S; B: recombinant virus PEDV EGFP / ΔN trVLP. DETAILED DESCRIPTION

[0027] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0028] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0029] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0030] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0031] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0032] In the following examples, the plasmid pBAC-PEDV-DR13S is first constructed by constructing the genome of porcine epidemic diarrhea virus YN200 into a BAC vector to obtain a pBAC-PEDV plasmid containing the whole genome of YN200, and then using CRISPR / Cas9-mediated homologous recombination technology to replace the Spike (S) gene fragment of YN200 with the Spike gene fragment of DR13 virus, and finally constructing the pBAC-PEDV-DR13S plasmid. The whole genome sequence of YN200 virus has an accession number of KT021233 in NCBI; the sequence of its Spike fragment is located at 20634-24785bp of the whole genome sequence with an accession number of KT021233 in NCBI; the whole genome sequence of DR13 virus has an accession number of JQ023162.1 in NCBI, and the sequence of its Spike fragment is located at 20610-24758bp of the whole genome sequence. The relevant construction process refers to Tan Y et al (2021, The trypsin-enhanced infection of porcine epidemic diarrhea virus is determined by the S2 subunit of the spike glycoprotein); Vero cells were purchased from the American Type Culture Collection (ATCC) and then adaptively cultured in the laboratory of Professor Peng Guiqing (cells were cultured in an incubator at 37°C and 5% CO2 unless otherwise specified).

[0033] Example 1: Construction strategy of recombinant plasmid pBAC-PEDV-DR13S-EGFP / ΔN

[0034] The construction strategy of the recombinant plasmid pBAC-PEDV-DR13S-EGFP / ΔN is as follows Figure 1 As shown: specific sgRNAs were designed at both ends of the N gene, and then the N gene region was replaced with the EGFP gene sequence under the action of CRISPR-Cas9 enzyme to obtain a recombinant plasmid.

[0035] 1) Use Sequence Scan for CRISPR (http: / / crispr.dfci.harvard.edu / SSC / ) to design the sgRNA of PEDV N gene online, and fuse the designed forward and reverse sgRNAs, use T7 transcriptase to transcribe in vitro, then CP to recover the product, store at -80℃ for later use ( Figure 2 (A).

[0036] sgRNAF1:GATCACTAATACGACTCACTATAGGCGCAGGACACATTCTTGGGTTTTAGAGCTAGAAA (SEQ ID NO. 1);

[0037] sgRNAR1:GATCACTAATACGACTCACTATAGAAATTAAATAATGTTTGACGTTTTAGAGCTAGAAA (SEQ ID NO. 2).

[0038] 2) Prepare the enzyme digestion system to digest pBAC-PEDV-DR13S for 6 h (Buffer 5 μL; plasmid 5 μg; sgRNA 1 μL each; enzyme 2 μL; water to 50 μL), and then CP recovers the digestion product ( Figure 2 (B).

[0039] 3) The recovered linearized pBAC-PEDV-DR13S vector was PCR-amplified with the EGFP fragment with homology arms using the following two pairs of primers and amplification conditions ( Figure 2 C) Homologous recombination was performed at 37°C for 30 min (Buffer 2 μL; linearized pBAC-PEDV-DR13S vector 100-200 ng; EGFP fragment 100-200 ng; ligase 1 μL; make up to 10 μL).

[0040] EGFP gene primer sequences:

[0041] EGFP-1F: GGTTGTGGCGCAGGACACAT (SEQ ID NO. 3);

[0042] EGFP-1R: CTCGCCCTTGCTCACCATAAAGTTTCTGTTTAGAATAAAT (SEQ ID NO. 4);

[0043] EGFP-2F: ATGGTGAGCAAGGGCGAG (SEQ ID NO.5);

[0044] EGFP-2R:ATAGCCAGGATAAGCCAGTCAAACATTATTCACTTGTACAGTCGTCCAT(SEQ IDNO.6);

[0045] EGFP gene amplification conditions: 95℃3min; 95℃30sec, 60℃30sec, 72℃20sec, 35 cycles; 72℃2min; 12℃2min.

[0046] 4) Add the recombinant product to the DH10B competent medium, ice bath for 30 minutes, heat shock at 42°C for 90 seconds, and ice bath for 3 minutes; then centrifuge at 3000rpm for 5 minutes, spread the competent medium at the bottom of the EP tube on the chloramphenicol-resistant LB solid culture plate, place the plate in an incubator at 37°C and culture it upside down for 16-18 hours, pick a single colony and add it to 3mL of LB liquid culture medium containing chloramphenicol resistance for expansion culture, and extract the recombinant plasmid after 12 hours (see the instructions for the Omega plasmid extraction kit for detailed operation procedures).

[0047] 5) Identification of recombinant plasmid: The recombinant pBAC-PEDV-DR13S-EGFP / ΔN plasmid was used as a template, and EGFP-1F (SEQ ID NO.3) and EGFP-2R (SEQ ID NO.6) were used to amplify the identification fragment according to the following amplification conditions ( Figure 2 The amplified product was then sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing and compared with the original sequence. The results were consistent, indicating that the recombinant plasmid was successfully constructed.

[0048] EGFP fragment amplification conditions: 95℃3min; 95℃30sec, 60℃30sec, 72℃40sec, 35 cycles; 72℃2min; 12℃2min.

[0049] Example 2: Construction of Vero-PEDV N stable cell line

[0050] Construction of Vero-PEDV N stable cell line Figure 3 As shown: The PEDV N gene was first cloned into the lentiviral vector pLVpuro-CMV-N-mcherry (purchased from Addgene #123221), and then transfected using the lentiviral three-plasmid packaging system (i.e., co-transfected with the auxiliary plasmid pMD2.G and the auxiliary plasmid psPAX2), and the recombinant cell line was selected using puromycin.

[0051] 1) The PEDV N gene obtained by PCR amplification was cloned into the lentiviral vector pLVpuro-CMV-N-mcherry using the primers (SEQ ID NO.7 and SEQ ID NO.8) designed according to the following sequences and amplification conditions ( Figure 3 A), and co-transfected with auxiliary plasmid Pmd2.G and auxiliary plasmid psPAX2. The mass ratio of pLVpuro-CMV-N-mcherry-PEDV N, pMD2.G and psPAX2 was 3:2:1, and the total mass of plasmid was 15 μg, forming a three-plasmid packaging system.

[0052] PEDV N gene primer sequences:

[0053] PEDV NF: CTACCGGACTCAGATCTCGAGATGGCTTCTGTCAGTTTTCAGGA (SEQ ID NO. 7);

[0054] PEDV NR:TACCCGGTAGAATTATCTAGATTAATTTCCTGTATCGAAGATCTCGT (SEQ ID NO. 8).

[0055] PEDV N gene amplification conditions: 95°C for 3 min; 95°C for 30 sec, 58°C for 30 sec, 72°C for 45 sec, 35 cycles; 72°C for 2 min; 12°C for 2 min.

[0056] 2) The three plasmids were co-transfected into HEK-293T cells in a 100 mm culture dish using jetPRIME transfection reagent for lentivirus packaging, and the lentivirus was collected 72 h after packaging (the lentivirus packaging used the "JetPRIME" reagent from PolyPlus).

[0057] 3) An appropriate number of Vero cells were inoculated into a 6-well cell plate. When the cell density was 30-50%, 50 μL of lentivirus was added for infection.

[0058] 4) After 48 hours of cell infection, the culture medium was changed to a puromycin selection medium. The obtained recombinant cell line grew stably in the puromycin selection medium, i.e., a cell line stably expressing the N protein.

[0059] 5) Western blot, IFA and PCR detection ( Figure 3 The results showed that the Vero cell line stably expressing PEDV-N was successfully constructed and named Vero-N.

[0060] Example 3: Rescue and identification of recombinant strain PEDV EGFP / ΔN trVLP

[0061] 1) The recombinant plasmid pBAC-PEDV-DR13S-EGFP / ΔN and the control plasmid pBAC-PEDV-DR13S were transfected into Vero-N cells with a density of 80-90% respectively (for detailed transfection steps, see the jetPRIME manual).

[0062] 2) After transfection for more than 48 hours, the transfected cell plate can be frozen and thawed once, centrifuged at 8000r / min for 10 minutes, and the supernatant can be aliquoted and stored at -80℃ for later use.

[0063] 3) After the Vero-N cells grow to an appropriate density (80-90%), the supernatant collected from the transfection is inoculated into the Vero-N cells. After 24 hours, the cytopathic effect is observed daily, and after 48 hours, the S gene expression is detected by IFA. The results are as follows: Figure 4 As shown in A: Both the control plasmid pBAC-PEDV-DR13S and the recombinant plasmid pBAC-PEDV-DR13S-EGFP / ΔN showed fluorescence on Vero-N, indicating that the recombinant virus PEDV EGFP / ΔN trVLP was successfully rescued.

[0064] 4) When the cell pathological rate reaches more than 80%, collect the virus suspension and freeze and thaw it repeatedly for 1 to 3 times, centrifuge it at 8000r / min at 4℃ for 10min, take the supernatant as the first generation virus, and store it at -80℃ for later use.

[0065] 5) The virus was passaged to P3 using the above steps, and the cell culture supernatant was used for PCR detection of S gene expression. The primers and amplification conditions were as follows. The results were as follows: Figure 4 As shown in B, PEDV EGFP / ΔN trVLP can stably proliferate.

[0066] PEDVS gene primer sequences:

[0067] PEDV SF:GTGTTACTGAAGTACCCTAC (SEQ ID NO.9);

[0068] PEDV SR: CCATAACTGTTTGTAACGTT (SEQ ID NO. 10).

[0069] PEDVS gene amplification conditions: 95℃3min; 95℃30sec, 58℃30sec, 72℃20sec, 35 cycles; 72℃2min; 12℃2min.

[0070] 6) Collect the cell samples after P3 inoculated with Vero-N cells, pour out the culture medium without rinsing, and quickly add enough pre-cooled 2.5% glutaraldehyde to fix for 1 hour (the glutaraldehyde completely immerses the cells), then use a cell shovel or cell scraper at a 45° angle to quickly scoop up the cells and transfer them all to a 15-50 ml centrifuge tube, centrifuge at 500-800 rpm for 5 minutes to form a cluster (the size of the cell cluster is preferably about half to a mung bean size), then remove most of the supernatant (leave about 1 ml, do not lose cells), gently blow away the cells in the centrifuge tube and transfer them to a 1.5 ml EP tube, let it stand vertically for natural sedimentation for 1 hour, then gently aspirate the supernatant (do not lose cells), and then slowly add 1 ml of new pre-cooled 2.5% glutaraldehyde along the tube wall, then embed and slice, and observe with a transmission electron microscope. The results are as follows Figure 5As shown, this indicates that the recombinant virus PEDV EGFP / ΔN trVLP was successfully rescued and could stably proliferate.

[0071] In summary, the method of the present invention can produce PEDV recombinant viruses (PEDVΔN trVLP) that lack the N gene and have transcription and replication capabilities. The lack of PEDV virus N protein can be trans-complemented by ectopic expression in packaging cells to produce PEDV△N trVLP. This method can achieve the complete viral life cycle and is completely confined to cells that ectopically express the PEDV N protein. Compared with traditional vaccines, it has higher safety and provides important ideas for the development of porcine epidemic diarrhea vaccines.

[0072] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for preparing a recombinant virus PEDVΔN trVLP, characterized in that: The following steps are involved: The N gene of the plasmid pBAC-PEDV-DR13S was cut and replaced with a reporter gene sequence, and then transfected into cells ectopically expressing the PEDVN protein to rescue the recombinant virus PEDVΔN trVLP; The plasmid pBAC-PEDV-DR13S is constructed by inserting the genome sequence of the YN200 virus into the BAC vector, and then replacing the Spike segment of the YN200 virus with the Spike segment of the DR13 virus; The accession number of the complete genome sequence of the YN200 virus in NCBI is KT021233; The sequence of the Spike fragment of the YN200 virus is located at 20634-24785bp of the whole genome sequence with NCBI accession number KT021233; the sequence of the Spike fragment of the DR13 virus is located at 20610-24758bp of the whole genome sequence with NCBI accession number JQ023162.

1.

2. The preparation method according to claim 1, characterized in that: The N gene of the plasmid pBAC-PEDV-DR13S was cut using the sgRNA with a nucleotide sequence as shown in SEQ ID NO.1-2.

3. The preparation method according to claim 1, characterized in that: Transfection was performed using a lentiviral three-plasmid packaging system.

4. The preparation method according to claim 1, characterized in that: The cells include Vero cells; and the reporter gene includes EGFP gene. 5 . The recombinant virus PEDVΔN trVLP obtained by the preparation method according to any one of claims 1 to 4 . 6 . Use of the recombinant virus PEDVΔN trVLP according to claim 5 in the preparation of a drug for preventing or treating porcine epidemic diarrhea virus.

7. The use according to claim 6, characterized in that The porcine epidemic diarrhea virus medicament includes porcine epidemic diarrhea virus vaccine.

8. The use according to claim 7, characterized in that The porcine epidemic diarrhea virus vaccine includes a whole virus inactivated vaccine, a live attenuated vaccine or a genetically engineered vaccine.

Images