Molecular marker and primer group for identifying male and female sea-buckthorn plants and application of molecular marker and primer group

Abstract

The invention provides a molecular marker and a primer group for identifying male and female sea-buckthorn plants and application of the molecular marker and the primer group, and relates to the technical field of molecular markers. The molecular marker is located in a specific interval of a second chromosome of male sea-buckthorn, and the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1. The nucleotide sequences of a primer group designed aiming at the molecular marker are as shown in SEQ ID NO.2 and SEQ ID NO.3. The invention further discloses a kit for detecting the molecular marker. The primer group provided by the invention is used for amplifying the DNA of the hippophae rhamnoides genome under a given PCR (Polymerase Chain Reaction) condition, a specific 341bp band can be obtained from a male hippophae rhamnoides plant, and a female hippophae rhamnoides does not generate the specific band. Therefore, the molecular marker is stable in amplification and can be used for sex judgment of sea-buckthorn plants.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and specifically relates to a molecular marker, a primer set and application thereof for identifying male and female seabuckthorn plants in Jiangzi. Background Art

[0002] Jiangzi seabuckthorn has good resistance to barrenness, drought and cold. In addition, it has the characteristics of fast growth, strong reproduction and nitrogen fixation ability. It is an excellent native tree species for windbreak and sand fixation and afforestation in Tibet. Male and female Jiangzi seabuckthorn plants have different values. Females are mostly used to produce seeds to ensure genetic diversity, while males have higher photosynthesis, transpiration and water use efficiency, so they can play a greater role in windbreak and sand fixation. In the process of ecological restoration of Jiangzi seabuckthorn, a suitable ratio of male and female plants can not only improve the ecological effect but also meet the economic benefits of the local people. However, it is difficult to identify the gender of Jiangzi seabuckthorn in the early stage of individual development, which hinders the breeding and production development of Jiangzi seabuckthorn.

[0003] Molecular marker primers are specific primers used in PCR (polymerase chain reaction), which can be used to detect specific DNA fragments in the genome. Molecular markers are a type of genetic marker, which is essentially a DNA sequence that exists stably in different subpopulations of a biological population and is inherited in linkage with characteristic traits. Molecular marker technology is mainly used in the following areas: construction of genetic linkage maps; gene / QTL positioning; molecular marker-assisted selection breeding; plant genetic diversity analysis; variety and quality purity identification and determination of genetic purity; disease detection. Molecular marker technology can quickly, accurately and efficiently identify individuals with potential special traits.

[0004] With the development of molecular biology, some methods for identifying the sex of dioecious seabuckthorn have been developed at the molecular level. However, the existing molecular markers for identifying the sex of other seabuckthorns were designed using technologies from many years ago and have not been widely used. Therefore, it is of great significance to screen out sex-linked molecular markers that can be stably used to identify the sex of Jiangzi seabuckthorn. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide a molecular marker, a primer set and its application for identifying the male and female plants of Gyantse seabuckthorn, which can identify the gender of Gyantse seabuckthorn in the seedling stage, improve the directionality and accuracy of seedling cultivation, and significantly shorten the seedling cultivation cycle.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides a molecular marker for identifying male and female plants of Gyangze seabuckthorn. The nucleotide sequence of the molecular marker is shown as SEQ ID NO.1.

[0008] The present invention also provides a primer set for identifying male and female plants of Gyangze seabuckthorn. The primer set is designed with upstream primers and downstream primers according to the molecular markers; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0009] The present invention also provides a kit for identifying male and female plants of Gyangze seabuckthorn, and the kit comprises the primer set.

[0010] The present invention also provides an application of the molecular marker, the primer set or the kit in identifying male and female plants of Gyangze seabuckthorn.

[0011] The present invention also provides a method for identifying male and female plants of Gyangze seabuckthorn, comprising the following steps:

[0012] Extracting genomic DNA from the sample to be tested;

[0013] Using the genomic DNA of the sample as a template, performing PCR amplification using the primer set or the kit, and performing electrophoresis detection on the PCR amplification product;

[0014] The male and female plants of Hippophae rhamnoides L. in Gyangze are identified according to the electrophoresis band results.

[0015] Preferably, the identification standard is as follows: if the PCR amplification product shows a characteristic band of 341 bp in length, the Gyantse seabuckthorn is male; if the PCR amplification product does not show a characteristic band of 341 bp, the Gyantse seabuckthorn is female.

[0016] Preferably, the reaction system of the PCR amplification is calculated as follows in 20 μL: 1 μL of DNA template, 0.8 μL of upstream primer, 0.8 μL of downstream primer, 10 μL of 2×TaqMasterMix, and 7.4 μL of ddH2O.

[0017] Preferably, the reaction procedure of the PCR amplification is as follows: the first stage, 95°C, 5 min; the second stage, 95°C, 30 s, 60°C, 30 s, 72°C, 1 min, a total of 35 cycles; the third stage, 72°C, 10 min; and storage at 12°C.

[0018] Preferably, the sample to be tested is leaves of Hippophae rhamnoides L. from Gyantse.

[0019] More preferably, the leaves are seedling leaves.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] Compared with the existing method of determining the sex of Jiangzi seabuckthorn, which requires waiting for the flowering and fruiting stage of the plant to accurately identify the sex, the primers provided by the present invention only need to use a few milligrams of leaves to extract DNA for use as a template for PCR reaction. It can be detected in various tissues and developmental periods of the plant body, without being restricted by seasons and environment, and without waiting for the seedlings to grow and bloom. The primer set of the present invention can obtain a specific 341bp band in the male plants of Jiangzi seabuckthorn by PCR amplification, and the corresponding band cannot be obtained in the female plants of Jiangzi seabuckthorn. It shows that the molecular marker amplification of the present invention is stable, the primer set has high specificity and sensitivity, and can be used for the sex identification of Jiangzi seabuckthorn plants. The molecular marker of the present invention is applied to the screening of Jiangzi seabuckthorn seedlings, which can improve the directionality and accuracy of seedling cultivation, greatly shorten the seedling cultivation cycle, and lay the foundation for the large-scale use of Jiangzi seabuckthorn for ecological restoration. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is the agarose gel electrophoresis result of the present invention. DETAILED DESCRIPTION

[0023] The present invention provides a molecular marker for identifying male and female plants of Jiangzi seabuckthorn, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. In the present invention, the molecular marker is located in the specific interval Chr02:34465460-34465800 of the second chromosome of male Jiangzi seabuckthorn, and the interval contains a conservative male-specific gene named Hgym02g1365. The male-specific gene is specifically present in the male plants of Jiangzi seabuckthorn, and the specific gene fragment is not present in the female plants of Jiangzi seabuckthorn. The male-specific gene is the molecular marker of the present invention, and its nucleotide sequence is:

[0024] TCGATCGCCACATACTGCTCGGATGCGGAAAATACCATAGGAGAAATCACC

[0025] ATCCTTCGGTAAATCAAATTTATCTACTTTTTCTGCTCTAGAATATTCATATC

[0026] AACATTCATATATTTGTTCCTTTTACGTTATTGCCTTTCTGATATCATCGTCTT

[0027] TAAGCATGATGATTGATTATTTCGCATGTTTGTAGCCTCCAGCCTACTGTCA

[0028] ACTATGTCAGAGTGATCAGTCATGCTCACCTGCTGAAGGGAAGTAGCTTTA

[0029] GGTAAATTTCTGAAATTTCCAATTTGATTGAAGTTGAACACTTGTCTTTTTTTCACTCCGATCCCCTCTTTGCCATGCAA (SEQ ID NO. 1).

[0030] The present invention also provides a primer set for identifying male and female plants of Gyangze seabuckthorn, wherein the primer set is designed with an upstream primer and a downstream primer according to the molecular marker Hgym02g1365; the nucleotide sequence of the upstream primer is preferably 5'-TCGATCGCCACATACTGCTC-3' (SEQ ID NO.2); the nucleotide sequence of the downstream primer is preferably 5'-TTGCATGGCAAAGAGGGGAT-3' (SEQ ID NO.3). The amplification product of the primer set designed by the present invention is 341 bp, and the amplification sequence is as shown in SEQ ID NO.1.

[0031] The present invention also provides a kit for identifying male and female plants of Gyangze seabuckthorn, and the kit comprises the primer set.

[0032] The present invention also provides an application of the molecular marker, the primer set or the kit in identifying male and female plants of Gyantse seabuckthorn.

[0033] The present invention also provides a method for identifying male and female plants of Gyangze seabuckthorn, comprising the following steps:

[0034] Extracting genomic DNA from the sample to be tested;

[0035] Using the genomic DNA of the sample as a template, performing PCR amplification using the primer set or the kit, and performing electrophoresis detection on the PCR amplification product;

[0036] The male and female plants of Hippophae rhamnoides L. were identified according to the electrophoresis band results.

[0037] In the present invention, the method for extracting genomic DNA of the sample to be tested can be conventionally selected according to needs. In the present invention, the CTAB method is preferably used to extract the genomic DNA of the Hippophae rhamnoides L. plant in Gyantse.

[0038] In the present invention, the identification criteria are preferably as follows: if the PCR amplification product shows a characteristic band of 341 bp in length, the Gyantse seabuckthorn is male; if the PCR amplification product does not show a characteristic band of 341 bp, the Gyantse seabuckthorn is female.

[0039] In the present invention, the reaction system of the PCR amplification is preferably calculated as follows: 1 μL of DNA template, 0.8 μL of upstream primer, 0.8 μL of downstream primer, 10 μL of 2×TaqMasterMix, and 7.4 μL of ddH2O.

[0040] In the present invention, the reaction procedure of the PCR amplification is preferably as follows: the first stage, 95°C, 5 min; the second stage, 95°C, 30 s, 60°C, 30 s, 72°C, 1 min, a total of 35 cycles; the third stage, 72°C, 10 min; and storage at 12°C.

[0041] In the present invention, the sample to be tested is preferably a leaf of Hippophae rhamnoides L. from Gyantse.

[0042] In the present invention, the leaves are preferably leaves at the seedling stage.

[0043] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0044] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0045] Example 1 Screening of molecular markers for identifying male and female plants of Gyangze seabuckthorn

[0046] The CTAB method was used to extract the genomic DNA of 10 female and 10 male Gyantse seabuckthorn individuals collected in Gyantse County, Tibet. The collection information of Gyantse seabuckthorn resources is shown in Table 1:

[0047] Table 120 Gyantse Seabuckthorn Resource Collection Information

[0048] serial number 1 2 3 4 5 6 7 8 9 10 gender female female female female female female female female female female Collection location Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse serial number 11 12 13 14 15 16 17 18 19 20 gender male male male male male male male male male male Collection location Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse Shigatse

[0049] The whole genome of the above 20 strains of Hippophae rhamnoides L. were resequenced using the MGI second-generation sequencing platform.

[0050] The whole genome of male and female sea buckthorn plants in Gyantse was sequenced using the Oxford Nanopore Technology third-generation sequencing platform, and the third-generation sequencing data was used as the input file of the NextDenovo software to assemble the genome de novo to obtain a preliminary assembled genome; then the third-generation sequencing data and the second-generation sequencing data were used as input files of the NextPolish software to correct the errors of the preliminary assembled genome; then the sequencing data of the chromosome conformation capture technology (Hi-C) and the preliminary assembled genome after error correction were used as input files of the juicer / 3D-DNA process for chromosome construction, and finally the chromosome-level genome sequences of male and female sea buckthorn plants in Gyantse were obtained.

[0051] The chromosome-level genome sequences of male and female Hippophae rhamnoides L. in Gyantse were used as reference genomes, and the population resequencing data were aligned to the reference genome using Bowtie2 to obtain an alignment file. The alignment file was then used as input for the IGV software to visualize and search for specific intervals.

[0052] A 5.75MB male-specific interval was found in the male genome of Hippophae rhamnoides L. in Gyantse. This interval was extracted and the female resequencing data was aligned with the above interval again to find completely unaligned regions. Based on the visualization results, a conservative male-specific gene was identified in this interval and named Hgym02g1365. The male-specific gene was used as a molecular marker to distinguish between male and female plants of Hippophae rhamnoides L. in Gyantse. Its nucleotide sequence is shown in SEQ ID NO.1.

[0053] Example 2 Primer set for identifying male and female plants of Gyangze seabuckthorn

[0054] A primer set is designed according to the molecular markers screened and obtained in Example 1, including an upstream primer and a downstream primer.

[0055] Hgym02g1365-F (upstream primer): 5′-TCGATCGCCACATACTGCTC-3′ (SEQ ID NO. 2);

[0056] Hgym02g1365-R (downstream primer): 5′-TTGCATGGCAAAGAGGGGAT-3′ (SEQ ID NO. 3).

[0057] Example 3 Kit for identifying male and female plants of Gyangze Hippophae rhamnoides

[0058] A kit for identifying male and female seabuckthorn plants in Jiangzi, comprising the primer set described in Example 2, 2×TaqMaster Mix (novoprotein) and ddH2O.

[0059] Example 4

[0060] In this example, DNA of Gyangze Hippophae rhamnoides plants of known gender collected in Shigatse, Gyangze County, Tibet, including 10 male plants and 10 female plants, was used as a template, and the primer set of Example 2 was used to perform PCR reaction.

[0061] 20μL PCR reaction system configuration:

[0062] Using 100 ng of Hippophae rhamnoides L. DNA as a template, a PCR reaction system was prepared in a PCR tube according to the formula in Table 2.

[0063] Table 2 PCR reaction system

[0064]

[0065]

[0066] PCR reaction conditions are shown in Table 3:

[0067] Table 3 PCR reaction conditions

[0068]

[0069] Use 1.5% agarose gel electrophoresis at 135 V for 20 min and observe under ultraviolet light.

[0070] according to Figure 1 The results of electrophoresis showed that the DNA of 10 female Hippophae rhamnoides L. produced no PCR products, while the DNA of 10 male Hippophae rhamnoides L. produced a PCR product of 341 bp.

[0071] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A molecular marker for identifying male and female plants of Hippophae rhamnoides L. in Jiangzi, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1.

2. A primer set for identifying male and female plants of Hippophae rhamnoides L. in Gyangze, characterized in that: The primer set is designed with an upstream primer and a downstream primer according to the molecular marker according to claim 1; the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

3. A kit for identifying male and female plants of Hippophae rhamnoides L. in Jiangzi, characterized in that: The kit comprises the primer set according to claim 2.

4. Use of the molecular marker according to claim 1, the primer set according to claim 2, or the kit according to claim 3 in distinguishing male and female plants of Hippophae rhamnoides L. in Gyangze.

5. A method for identifying male and female plants of Gyangze seabuckthorn, characterized in that: The steps include: Extracting genomic DNA from the sample to be tested; Using the genomic DNA of the sample as a template, performing PCR amplification using the primer set of claim 2 or the kit of claim 3, and performing electrophoresis detection on the PCR amplification product; The male and female plants of Hippophae rhamnoides L. in Gyangze are identified according to the electrophoresis band results.

6. The identification method according to claim 5, characterized in that: The identification criteria are as follows: if the PCR amplification product shows a characteristic band of 341 bp in length, the Jiangzi seabuckthorn is male; if the PCR amplification product does not show a characteristic band of 341 bp, the Jiangzi seabuckthorn is female.

7. The identification method according to claim 5, characterized in that: The reaction system of the PCR amplification is calculated as 20 μL: 1 μL of DNA template, 0.8 μL of upstream primer, 0.8 μL of downstream primer, 10 μL of 2×Taq Master Mix, and 7.4 μL of ddH2O.

8. The identification method according to claim 5, characterized in that: The reaction procedure of the PCR amplification is as follows: the first stage, 95°C, 5 min; the second stage, 95°C, 30 s, 60°C, 30 s, 72°C, 1 min, a total of 35 cycles; the third stage, 72°C, 10 min; and storage at 12°C.

9. The identification method according to claim 5, characterized in that: The sample to be tested is leaves of Hippophae rhamnoides L. from Gyantse.

10. The identification method according to claim 9, characterized in that: The leaves are leaves at the seedling stage.

Images