Highly polymorphic microsatellite markers and their application in Litopenaeus vannamei

Abstract

The present invention provides a highly polymorphic microsatellite molecular marker of Penaeus vannamei and an application thereof, belonging to the technical field of molecular markers. The present invention is based on 10 microsatellite sequences screened from the genome of Penaeus vannamei, which are numbered Lv‑449, Lv‑460, Lv‑499, Lv‑511, Lv‑442, Lv‑451, Lv‑496, Lv‑491, Lv‑439 and Lv‑482, respectively, and their sequences are shown in SEQ ID No.1 to SEQ ID No.10. The present invention designs microsatellite marker primers for the 10 microsatellite sequences respectively, and the microsatellite marker primers have strong specificity, stable amplification and high polymorphism, and can be used for the genetic diversity and genetic structure analysis of Penaeus vannamei populations and the identification of germplasm resources, providing a powerful tool for the genetic breeding of Penaeus vannamei.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to high-polymorphic microsatellite molecular markers of Litopenaeus vannamei and applications thereof. Background Art

[0002] Litopenaeus vannamei Litopenaeus vannamei ), also known as the South American white shrimp and Pacific white shrimp, has the advantages of delicious meat, high meat content, rich nutrition, strong stress resistance, fast growth, and low breeding cost. The market demand is increasing, and the annual output accounts for about 70% of the global shrimp farming output. It is the world's largest farmed shrimp variety. In recent years, due to the long-term inbreeding and the confusion of the seed shrimp strains, the germplasm has degenerated, mixed and low genetic diversity, which has seriously affected the sustainable development of the vannamei shrimp farming industry. The establishment of highly polymorphic microsatellite markers and effective methods for analyzing the genetic diversity of vannamei shrimp populations and identifying the genetic resource background are conducive to guiding the construction of a basic population of vannamei shrimp with rich genetic variation, and screening out high-quality seed shrimp individuals with low inbreeding coefficients for breeding and breeding, and promoting the healthy and sustainable development of the shrimp farming industry.

[0003] Microsatellite sequences, also known as simple sequence repeats (SSR) or short tandem repeats (STR), are composed of 1~6 bp simple sequence repeats arranged in series. According to the number of bases in the core repeat sequence, they can be divided into mononucleotides, dinucleotides, trinucleotides, tetranucleotides, etc. Microsatellite markers follow Mendel's co-dominant inheritance law, can identify pure and heterozygotes, provide complete genetic information, and are not affected by factors such as season, developmental stage and environment. They have the advantages of large quantity, high polymorphism, simple technology, rapidity and easy automation. They are powerful tools for genetic structure analysis, germplasm resource identification, genetic diversity detection and genetic breeding. Therefore, screening out stable and highly polymorphic microsatellite markers is of great significance for the protection of vannamei germplasm resources, population genetic structure analysis, germplasm resource identification, etc., and can provide a powerful tool for its genetic breeding. Summary of the invention

[0004] The invention provides a highly polymorphic microsatellite molecular marker for Penaeus vannamei and an application thereof. The marker has stable amplification and good polymorphism, and can be applied to the genetic diversity and genetic structure analysis of Penaeus vannamei populations and the identification of germplasm resources.

[0005] The present invention provides a group of microsatellite sequences based on the genome of Penaeus vannamei, including microsatellite sequences numbered Lv-449, Lv-460, Lv-499, Lv-511, Lv-442, Lv-451, Lv-496, Lv-491, Lv-439 and Lv-482, wherein the nucleotide sequences of the microsatellite sequences are shown in SEQ ID No.1 to SEQ ID No.10, respectively.

[0006] The invention provides a pair of microsatellite marker primers for detecting the diversity of Litopenaeus vannamei population, which are designed respectively for the above microsatellite sequences.

[0007] Preferably, the sequences of primer pairs designed for the microsatellite sequences numbered Lv-449, Lv-460, Lv-499, Lv-511, Lv-442, Lv-451, Lv-496, Lv-491, Lv-439 and Lv-482 are shown in SEQ ID No.11 to SEQ ID No.30, respectively.

[0008] Preferably, the upstream primers in the primer pair are both labeled with fluorescent groups.

[0009] Preferably, the 5' end of the upstream primer is labeled with a fluorescent group, and the fluorescent group is selected from any one of the following: HEX, FAM, ROX and NED.

[0010] The present invention also provides the use of the microsatellite sequence or the microsatellite marker primer pair in genetic analysis of Litopenaeus vannamei population and / or identification of germplasm resources.

[0011] The present invention also provides a method for detecting microsatellite polymorphism of Penaeus vannamei, comprising the following steps: using the genomic DNA of Penaeus vannamei as a template, establishing a multiplex PCR amplification system using primer pairs designed for the microsatellite sequences or the microsatellite marker primer pairs, performing PCR amplification, performing genotyping on the amplified products, and performing population genetic analysis and / or germplasm resource identification according to the typing results.

[0012] Preferably, the template comprises genomic DNA from muscle tissue of Penaeus vannamei.

[0013] Preferably, the PCR amplification system, based on 25 μL, includes: 1-2 μL template, 0.5 μL upstream primer, 0.5 μL downstream primer, 0.5 μL dNTP, 2.5 μL 10×PCR Buffer, 0.2 μL Taq Plus DNA polymerase and the remainder sterile deionized water.

[0014] Preferably, the PCR amplification program includes: pre-denaturation at 95°C for 5 min; denaturation at 94°C for 30 s, annealing at 52-60°C for 30 s, extension at 72°C for 30 s, and 10 cycles; denaturation at 94°C for 30 s, annealing at 50-55°C for 30 s, extension at 72°C for 30 s, and 30 cycles; and extension at 72°C for another 5-10 min.

[0015] Beneficial effects: The present invention is based on 10 microsatellite sequences screened from the genome of Penaeus vannamei, which are numbered Lv-449, Lv-460, Lv-499, Lv-511, Lv-442, Lv-451, Lv-496, Lv-491, Lv-439 and Lv-482, respectively, and their sequences are shown in SEQ ID No. 1 to SEQ ID No. 10. The present invention designs microsatellite marker primers for the 10 microsatellite sequences, respectively, and the microsatellite marker primers have strong specificity, stable amplification and high polymorphism, and can be used for the genetic diversity and genetic structure analysis of Penaeus vannamei populations and the identification of germplasm resources, providing a powerful tool for the genetic breeding of Penaeus vannamei. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is the STR detection peak diagram of the Lv-449 locus of the L53-M vannamei shrimp sample;

[0017] Figure 2 This is the STR detection peak diagram of the Lv-460 locus of the L53-M vannamei shrimp sample;

[0018] Figure 3 This is the STR detection peak diagram of the Lv-499 locus of the L53-M vannamei shrimp sample;

[0019] Figure 4 This is the STR detection peak diagram of the Lv-511 locus of the L53-M vannamei shrimp sample;

[0020] Figure 5 This is the STR detection peak diagram of the Lv-442 locus of the L53-M vannamei shrimp sample;

[0021] Figure 6 This is the STR detection peak diagram of the Lv-451 locus of the L53-M vannamei shrimp sample;

[0022] Figure 7 This is the STR detection peak diagram of the Lv-496 locus of the L53-M vannamei shrimp sample;

[0023] Figure 8 This is the STR detection peak diagram of the Lv-491 locus of the L53-M vannamei shrimp sample;

[0024] Fig. 9 This is the STR detection peak diagram of the Lv-439 locus of the L53-M vannamei shrimp sample;

[0025] Fig.10 This is the STR detection peak diagram of the Lv-482 locus of the L53-M vannamei shrimp sample;

[0026] Fig.11 This is a phylogenetic map of 50 species of Penaeus vannamei;

[0027] Fig.12 This is the agarose gel electrophoresis diagram of 10 microsatellite sequences of Penaeus vannamei. DETAILED DESCRIPTION

[0028] The present invention provides a group of microsatellite sequences based on the genome of Penaeus vannamei, including microsatellite sequences numbered Lv-449, Lv-460, Lv-499, Lv-511, Lv-442, Lv-451, Lv-496, Lv-491, Lv-439 and Lv-482, wherein the nucleotide sequences of the microsatellite sequences are shown in SEQ ID No.1 to SEQ ID No.10, respectively.

[0029] The present invention screens microsatellite markers in the genome of Penaeus vannamei, and the screening criteria of the microsatellite marker sequence are preferably that the number of 2-base repeats is greater than or equal to 9 times, and the number of 3-base repeats is greater than or equal to 9 times.

[0030] The nucleotide sequence of the microsatellite locus Lv-449 of the present invention is preferably as shown in SEQ ID No. 1:

[0031] tgcccaccgtgtccaattactccggcctcaagaagctcatggaagtggtaagtgatggtagtatgaatggcaatagaaaggatcatgaggcacataattgatagtctagtcgtaatgcttaatgtgtatgtgagagagagagagagagaaatgaaagcacggaattggcctgtg;

[0032] The nucleotide sequence of the microsatellite locus Lv-460 is preferably as shown in SEQ ID No.2:

[0033] ataggagtaactgatgcggccattaaataataataataataataataataataatcctggacccggatcaccaccataattcgatggcatctaagttaggct;

[0034] The nucleotide sequence of the microsatellite locus Lv-499 is preferably as shown in SEQ ID No.3:

[0035] ggtcactgtccggcttcatccgatttcttgctctccgatgttctttcataaatatgtcgcggaatatactccatttctttcaatatatatatatatatatttttatctgttacgaatt ttgtaatgcgtttatcctagctgactggaatatttgtatctcaaacagatggggaaaattgtaagggaaantttactcgagaatttttncacttttcggacgcgttcgttcaggaagc.

[0036] The nucleotide sequence of the microsatellite locus Lv-511 is preferably as shown in SEQ ID No.4:

[0037] cggcatgtcatcagtcgctacacttattaatttctttgtgtcgggcacaatgcacggtgggattcaattatttgtttcaatgtgtctgtttgctgtgtgaccttgggttga cctttagggcgtagtggtgttgcattgggagagcaatggatgttttcagtgatttacaatggagttgtgtgtgtgtgtgtgtgtgtgtgtgtgacacgaccagctagccaa;

[0038] The nucleotide sequence of the microsatellite locus Lv-442 is preferably as shown in SEQ ID No.5:

[0039] gagtgactctaaagtgcggatattagtgtttttgttgttgttgttgttgttgttgttgttgttttcataaagacagagaacaggaagggtcaagagattagccactttgtgcatgtttcccc;

[0040] The nucleotide sequence of the microsatellite locus Lv-451 is preferably as shown in SEQ ID No.6:

[0041] gctggccgtagatactgaccctaagttggttatcattttatggaaaatgatgctaattatgcgctaaatagaatgagggtagtctaattccttacgtttgtattacaatatatatatatatatatatatt acattttactagtatttggttttaattagcgtcatactttaacaaaacttaattaagacaagcagtgtttttattcctgagtaataatcacctaagcagatacaatcacgtgacatgcaattcatca;

[0042] The nucleotide sequence of the microsatellite locus Lv-496 is preferably as shown in SEQ ID No.7:

[0043] gctgagggtgtccgtgacgtcacacatgtaaacaatggtcgagcacgtaggttcgactcctgactcttacctaggctacataaatacacaacacacacacacacacacacacactagcaccttccctggcttagccctcccattctcactaacctcacaatactctcggttcaagcgcaaggt;

[0044] The nucleotide sequence of the microsatellite locus Lv-491 is preferably as shown in SEQ ID No.8:

[0045] agcgacaaagctctcccgctctttgatagatactctcctccctttctctccacaaatcatcaagcacttctatcactttatttctttcggcctttttctctacctctgtctgaggattccgagcgc aaagattttagcatgtcattacaacaaggatattttagctgaatgtaggcttccctcacccctctctctctctctctctcttcgctcgtctttggcgtctgtagggcatgcctcgcacaaag;

[0046] The nucleotide sequence of the microsatellite locus Lv-439 is preferably as shown in SEQ ID No.9:

[0047] tgcctggcaactgagcaattgtggggccatctgtgtacaacaacaacaacaacaacaacaacaacaacaacaacaacagtcacaattgaatcttgtctcaagcctgtgcaatatctaacctggttgacctcactgg;

[0048] The nucleotide sequence of the microsatellite locus Lv-482 is preferably as shown in SEQ ID No.10:

[0049] aggcatgaccgtgcagtcttcagagtaccaagggatttcgtcctacattctccagcgtgcgagactgcgagactgcgaggctgattcgctgttcttctttccctctctctctctctctctccttacgtaattcctgagcagcgaggtcaggcggagctcagctgactggtcgctgtcatggc.

[0050] The invention provides a pair of microsatellite marker primers for detecting the diversity of Litopenaeus vannamei population, which are designed respectively for the above microsatellite sequences.

[0051] The present invention designs primer pairs according to the sequence of the microsatellite marker, and the criteria for selecting primers include: (1) primer length is 15-30 bp; (2) GC content is 40%-70%; (3) annealing temperature is 50-65° C.; and (4) expected PCR product length is 100-350 bp.

[0052] In the embodiment of the present invention, the sequences of the primer pairs designed for the markers numbered Lv-449, Lv-460, Lv-499, Lv-511, Lv-442, Lv-451, Lv-496, Lv-491, Lv-439 and Lv-482 are preferably shown in SEQ ID No. 11 to SEQ ID No. 30. The upstream primers in the primer pairs of the present invention are preferably labeled with fluorescent groups, and more preferably, the 5' end of the upstream primers is labeled with fluorescent groups, and the fluorescent groups are selected from any one of the following: HEX, FAM, ROX and NED.

[0053] Table 1 Microsatellite core sequence and marker primer sequence information of the present invention

[0054]

[0055] The present invention also provides the use of the microsatellite sequence or the microsatellite marker primer pair in genetic analysis of Litopenaeus vannamei population and / or identification of germplasm resources.

[0056] The microsatellite marker amplification of the present invention is stable and has good polymorphism. According to statistics, 141 alleles were detected in 50 shrimps using the 10 microsatellite primer pairs shown in Table 1. The number of alleles ranged from 6 to 22, and there were 14.1 alleles per site on average. The frequency of invalid alleles (FNull) was 0.049 to 0.281, with an average value of 0.108. The observed heterozygosity ( H o) ranged from 0.360 to 0.940, with an average of 0.694. H e) was 0.635~0.935, with an average of 0.849. The polymorphic information content (PIC) was 0.591~0.920, with an average of 0.822. Population analysis of Litopenaeus vannamei showed that the average H o and H e were all greater than 0.5, indicating that the technical strategy adopted in the breeding of this population maintained genetic diversity well. The polymorphic information content (PIC) of the 10 markers was greater than 0.5, indicating that they were highly polymorphic markers. In addition, the 10 microsatellite markers clustered the population into 5 independent branches, which was consistent with the use of 5 different introduced populations when constructing the basic population ( Fig.11 ). It can be seen that the 10 microsatellite markers of the present invention have significant value in genetic analysis and germplasm identification, and provide a powerful tool for genetic diversity, population structure analysis and kinship identification of Penaeus vannamei.

[0057] The present invention also provides a method for detecting the diversity of Penaeus vannamei population, comprising the following steps: using the genomic DNA of Penaeus vannamei as a template, establishing a multiplex PCR amplification system using primer pairs designed for the above microsatellite sequences or the above microsatellite marker primer pairs, performing PCR amplification, performing genotyping on the amplified products, and performing genetic analysis and / or germplasm resource identification according to the typing results.

[0058] The template of the present invention preferably includes genomic DNA from muscle tissue of Penaeus vannamei. There is no particular limitation on the method for extracting the genomic DNA, and the genomic DNA can be extracted using conventional methods in the art.

[0059] The PCR amplification system of the present invention preferably includes 25 μL of template, 0.5 μL of upstream primer (10 mM), 0.5 μL of downstream primer (10 mM), 0.5 μL of dNTP (10 mM), 2.5 μL of 10×PCR Buffer (containing Mg 2 +), 0.2 μL Taq Plus DNA polymerase (5U / μL) and the rest sterile deionized water. In the present invention, when preparing the PCR amplification system, it is preferred that each pair of primers prepare a reaction system, and then PCR amplification is performed, and the PCR amplification program preferably includes: 95°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 52-60°C annealing for 30 s, 72°C extension for 30 s, 10 cycles; 94°C denaturation for 30 s, 50-55°C annealing for 30 s, 72°C extension for 30 s, 30 cycles; 72°C extension for 5-10 min.

[0060] The present invention preferably performs fluorescent labeling of different colors on microsatellite primers with similar amplified fragment sizes to avoid misreading of genotypes and improve detection efficiency, as shown in Table 1.

[0061] In the present invention, after the PCR amplification is completed, the amplified product is detected by ABI 3730XL sequencer to obtain the genotype information of each SSR locus; the SSR raw data file is analyzed by Genemapper software, and the number of alleles (Na), the null allele frequency (Fnull), the observed heterozygosity ( H o), expected heterozygosity ( H e) and polymorphism information content (PIC).

[0062] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0063] Example 1

[0064] 1. Extraction of genomic DNA from Penaeus vannamei

[0065] The 50 samples of genomic DNA from Penaeus vannamei used in the experiment were extracted using the Tiangen Marine Animal Tissue Genome Extraction Kit (TIANGEN, Tiangen Biochemical Technology Co., Ltd.). The quality of the extracted genomic DNA was tested using 2% agarose gel. After the concentration was determined, the DNA was diluted to 50 ng / μL and stored at -20°C for later use.

[0066] 2. Screening and design of microsatellite loci and primers

[0067] The software TBtools (Version: 2.070) was used to screen and design microsatellite loci and primers. The SSRminer plug-in retrieved microsatellite fragments of Penaeus vannamei, the Batch Target Region Primer Design plug-in batch designed primers, and the Primer Check plug-in tested primer specificity. Using the primers designed in Table 1, the sequences of the above microsatellite loci (Lv-449, Lv-460, Lv-499, Lv-511) can be stably amplified ( Fig.12 ), microsatellite primers with similar amplified fragment sizes are fluorescently labeled with different colors to avoid misreading of genotypes and improve detection efficiency.

[0068] 3. Microsatellite marker amplification detection and data analysis

[0069] The genomic DNA of Penaeus vannamei was amplified using microsatellite primers (Lv-449, Lv-460, Lv-499, and Lv-511) labeled with HEX, FAM, ROX, and NED fluorescein in sequence. The PCR amplification system was 25 μL, including 1 μL template DNA, 0.5 μL forward primer, 0.5 μL reverse primer, 0.5 μL dNTP (10 mM), 2.5 μL 10× PCR Buffer (containing Mg 2+ ), 0.2 μL Taq Plus DNA polymerase (5 U / μL), 19.8 μL sterile deionized water; PCR amplification program included: 95℃ pre-denaturation for 5min; 94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s, 10 cycles; 94℃ denaturation for 30 s, 53℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for another 10 min. After PCR amplification, the amplified products were detected by ABI 3730XL sequencer to obtain the genotype information of each SSR locus of 50 vannamei shrimp.

[0070] Genemapper software was used to analyze the SSR raw data files. The number of alleles (Na), the frequency of null alleles (Fnull), the observed heterozygosity ( H o), expected heterozygosity ( H e) and polymorphism information content (PIC) were calculated using Cervus (version: v3.0.7) (Table 2).

[0071] Example 2

[0072] 1. Extraction of genomic DNA from Penaeus vannamei

[0073] The 50 samples of genomic DNA from Penaeus vannamei used in the experiment were extracted using the Tiangen Marine Animal Tissue Genome Extraction Kit (TIANGEN, Tiangen Biochemical Technology Co., Ltd.). The quality of the extracted genomic DNA was tested using 2% agarose gel. After the concentration was determined, the DNA was diluted to 50 ng / μL and stored at -20°C for later use.

[0074] 2. Screening and design of microsatellite loci and primers

[0075] The software TBtools (Version: 2.070) was used to screen and design microsatellite loci and primers. The SSRminer plug-in retrieved microsatellite fragments of Penaeus vannamei, the Batch Target Region Primer Design plug-in batch designed primers, and the Primer Check plug-in tested primer specificity. Using the primers shown in Table 1, the sequences of the above microsatellite loci (Lv-496, Lv-491, Lv-442, Lv-451) can be stably amplified ( Fig.12 ), microsatellite primers with similar amplified fragment sizes are fluorescently labeled with different colors to avoid misreading of genotypes and improve detection efficiency.

[0076] 3. Microsatellite marker amplification detection and data analysis

[0077] The genomic DNA of Penaeus vannamei was amplified using microsatellite primers (Lv-496, Lv-491, Lv-442, and Lv-451) labeled with HEX, FAM, ROX, and NED fluorescein. The PCR amplification system was 25 μL, including 1 μL template DNA, 0.5 μL forward primer, 0.5 μL reverse primer, 0.5 μL dNTP (10 mM), 2.5 μL 10× PCR Buffer (containing Mg 2+ ), 0.2 μL Taq Plus DNA polymerase (5 U / μL), 19.8 μL sterile deionized water; PCR amplification program included: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 10 cycles; 94℃ denaturation for 30 s, 50℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for another 10 min. After PCR amplification, the amplified products were detected by ABI 3730XL sequencer to obtain the genotype information of each SSR locus of 50 vannamei shrimp.

[0078] Genemapper software was used to analyze the SSR raw data files. The number of alleles (Na), the frequency of null alleles (Fnull), the observed heterozygosity ( H o), expected heterozygosity (H e) and polymorphism information content (PIC) were calculated using Cervus (version: v3.0.7) (Table 2).

[0079] Example 3

[0080] 1. Extraction of genomic DNA from Penaeus vannamei

[0081] The 50 samples of genomic DNA from Penaeus vannamei used in the experiment were extracted using the Tiangen Marine Animal Tissue Genome Extraction Kit (TIANGEN, Tiangen Biochemical Technology Co., Ltd.). The extracted genomic DNA was tested for DNA quality using 2% agarose gel. After the concentration was determined, the DNA was diluted to 50 ng / μL and stored at -20°C for later use.

[0082] 2. Screening and design of microsatellite loci and primers

[0083] The software TBtools (Version: 2.070) was used to screen and design microsatellite loci and primers. The SSRminer plug-in retrieved microsatellite fragments of Penaeus vannamei, the Batch Target Region Primer Design plug-in batch designed primers, and the Primer Check plug-in tested primer specificity. The primers shown in Table 1 were used to stably amplify the sequences of the above microsatellite loci Lv-439 and Lv-482 ( Fig.12 ), microsatellite primers with similar amplified fragment sizes are fluorescently labeled with different colors to avoid misreading of genotypes and improve detection efficiency.

[0084] 3. Microsatellite marker amplification detection and data analysis

[0085] The genomic DNA of Penaeus vannamei was amplified using microsatellite primers (Lv-439 and Lv-482) labeled with FAM and HEX fluorescein. The PCR amplification system was 25 μL, including 2 μL template DNA, 0.5 μL forward primer, 0.5 μL reverse primer, 0.5 μL dNTP (10 mM), 2.5 μL 10× PCR Buffer (containing Mg 2+ ), 0.2 μL Taq Plus DNA polymerase (5 U / μL), 18.8 μL sterile deionized water; PCR amplification program included: 95℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 10 cycles; 94℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for another 10 min. After PCR amplification, the amplified products were detected by ABI 3730XL sequencer to obtain the genotype information of each SSR locus of 50 vannamei shrimp.

[0086] Genemapper software was used to analyze the SSR raw data files. The number of alleles (Na), the frequency of null alleles (Fnull), the observed heterozygosity ( H o), expected heterozygosity ( H e) and polymorphism information content (PIC) were calculated using Cervus (version: v3.0.7) (Table 2).

[0087] Table 2 Genetic diversity parameters of 10 microsatellite loci in the population of Penaeus vannamei

[0088]

[0089] (Locus: site, Na: number of alleles, N: number of samples, Fnull: invalid allele frequency, H o: observed heterozygosity, H e: expected heterozygosity, PIC: polymorphic information content)

[0090] Based on Examples 1 to 3, a total of 141 alleles were detected at the above 10 microsatellite loci, with the number of loci ranging from 6 to 22, and an average of 14.1 alleles per locus. The null allele frequency (FNull) was 0.049 to 0.281, with an average of 0.108. The observed heterozygosity ( H o) ranged from 0.360 to 0.940, with an average of 0.694. H e) was 0.635~0.935, with an average of 0.849. Polymorphic information content (PIC) was 0.591~0.920, with an average of 0.822. Observed heterozygosity ( H o) and expected heterozygosity ( H e) is an important indicator for determining the level of genetic diversity of a population. Population analysis of Penaeus vannamei showed that the average H o and H e were all greater than 0.5, indicating that the technical strategy adopted in this population breeding has well maintained the genetic diversity of the breeding population. The polymorphic information content (PIC) of the 10 markers was greater than 0.5, indicating that they were highly polymorphic markers. It can be seen that the 10 microsatellite markers of the present invention have significant genetic analysis value and provide a powerful tool for the analysis of genetic diversity and population structure of Penaeus vannamei.

Claims

1. A microsatellite marker primer pair for detecting the diversity of Penaeus vannamei populations, characterized in that: Including respectively designing for microsatellite sequences, the microsatellite sequences are numbered Lv-449, Lv-460, Lv-499, Lv-511, Lv-442, Lv-451, Lv-496, Lv-491, Lv-439 and Lv-482, and the nucleotide sequences of each microsatellite sequence are shown in SEQ ID No.1 to SEQ ID No.10; The sequences of primer pairs designed for microsatellite sequences numbered Lv-449, Lv-460, Lv-499, Lv-511, Lv-442, Lv-451, Lv-496, Lv-491, Lv-439 and Lv-482 are shown in SEQ ID No.11 to SEQ ID No.30, and the upstream primers in the primer pairs are all labeled with fluorescent groups.

2. The microsatellite marker primer pair according to claim 1, characterized in that: The 5' end of the upstream primer is labeled with a fluorescent group, and the fluorescent group is selected from any one of the following: HEX, FAM, ROX and NED.

3. Use of the microsatellite marker primer pair according to claim 1 or 2 in population genetic analysis and / or germplasm resource identification of Penaeus vannamei.

4. A method for detecting microsatellite polymorphism in Penaeus vannamei, characterized in that: The following steps are involved: Using the genomic DNA of Penaeus vannamei as a template, a multiplex PCR amplification system is established using the microsatellite marker primer pair described in claim 1 or 2, PCR amplification is performed, genotyping is performed on the amplified products, and population genetic analysis and / or germplasm resource identification is performed based on the typing results.

5. The method according to claim 4, characterized in that: The template includes genomic DNA from muscle tissue of Litopenaeus vannamei.

6. The method according to claim 4, characterized in that: The PCR amplification system is based on 25 μL, including: 1~2 μL template, 0.5 μL upstream primer, 0.5 μL downstream primer, 0.5 μL dNTP, 2.5 μL 10×PCR Buffer, 0.2 μL Taq Plus DNA polymerase and the remaining amount of sterile deionized water.

7. The method according to claim 4 or 6, characterized in that: The PCR amplification procedure includes: pre-denaturation at 95°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 52-60°C for 30 seconds, and extension at 72°C for 30 seconds, for 10 cycles; denaturation at 94°C for 30 seconds, annealing at 50-55°C for 30 seconds, and extension at 72°C for 30 seconds, for 30 cycles; and extension at 72°C for another 5-10 minutes.

Images