SNP (Single Nucleotide Polymorphism) site for identifying wheat stem rot resistant gene and application thereof

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) site for identifying a wheat stem rot resistant gene and application thereof. The invention aims to solve the problem of how to quickly and accurately identify or assist in identifying the basal stem rot resistance character of wheat. According to the application, a substance for detecting the polymorphism or genotype of an SNP site in a wheat genome is applied to identification or auxiliary identification of grain traits, the SNP site is located in a wheat 3AL chromosome, a KASP marker closely linked with the SNP site is Kasp3ALFCR, and the nucleotide type is A or G and is the 51st nucleotide of a sequence 1 in a sequence table. The gene type of the marker Kasp3ALFCR closely linked with the QTL in an amplification product can be identified, the marker can be used for predicting the basal stem rot resistance character of wheat, early screening of wheat can be carried out, and the marker can also be used for wheat molecular marker-assisted breeding.

Description

Technical Field

[0001] The invention belongs to the field of gene biotechnology, and in particular relates to SNP sites for identifying wheat stem base rot resistance genes and applications thereof. Background Art

[0002] Wheat crown rot (Fusarium crown rot, FCR) is caused by various Fusarium species ( Fusarium spp. ) is a typical soil-borne disease widely distributed around the world, and is spreading and worsening. In my country, wheat stem rot is mainly caused by Pseudomonas graminearum ( Fusarium pseudograminearum ). When wheat seedlings are infected by Fusarium, the leaf sheaths and stems at the base of the stem turn brown, and in severe cases, the seedlings turn yellow and wilt; the disease may cause the ear to dry up during the grain filling period. The occurrence of stem base rot not only causes serious yield and economic losses to wheat, but also produces biotoxins and secondary metabolites such as DON during the development of the disease, which also has serious negative impacts on food and feed products.

[0003] Stem rot is one of the most important diseases in major wheat producing countries in the world, including my country, in recent years. Due to weather changes and frequent droughts in recent years, the occurrence of stem rot is severe, the infection range is wide, and the degree of damage is great, which has attracted the attention of wheat researchers around the world. However, the current research on wheat stem rot is mainly focused on the collection of pathogens, the identification of resistance of different wheat varieties, and the preliminary positioning of disease-resistant genes. The discovery and utilization of wheat stem rot resistance genes and the regulatory pathways involved in disease-resistant genes are still in the initial stage.

[0004] In recent years, domestic and foreign scholars have conducted a series of studies on disease resistance gene discovery and germplasm resource identification. However, the main problems facing disease resistance breeding are still the small number of major disease resistance genes discovered, the lack of molecular markers, and the lack of resistance sources that can be used for breeding. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to quickly and accurately identify wheat stem base rot resistance genes.

[0006] In order to solve the above problems, the present invention first provides an application of a substance for detecting the polymorphism or genotype of a SNP site in a wheat genome, wherein the SNP site is a site in the wheat genome, the nucleotide type of which is A or G, and is the 51st nucleotide of sequence 1 in the sequence table; the application is any of the following: A1) Use of the substance in identifying or assisting in identifying wheat resistance to stem rot, A2) Application of the substance in wheat breeding, A3) Use of the substance in the preparation of a product for identifying or assisting in identifying wheat resistance to stem rot, A4) Use of the substance in preparing wheat breeding products.

[0007] The above substances are as follows: B1), B2) or B3): B1) the substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP site, B2) The substance is a PCR reagent containing the primer combination described in B1), B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

[0008] In the above applications, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Markers include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The marker can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, weight measurement, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The marker can include a nucleic acid sequence or a protein sequence or a combination thereof, as long as the sequence containing the marker is detectable. In some embodiments, the nucleic acid is directly detected (e.g., directly reading the sequence) without a marker.

[0009] The above primer composition may consist of primer A, primer B and / or primer C; The primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 41st position of sequence 1 in the sequence list, The primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 41st position of sequence 2 in the sequence list, The primer C is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence list.

[0010] The present invention also provides a method for identifying or assisting in identifying wheat resistance to stem rot, the method comprising detecting the genotype of a SNP site in the wheat genome to be tested, and identifying or assisting in identifying the wheat resistance to stem rot according to the genotype, wherein the SNP site is the above-mentioned SNP site.

[0011] In the above method, the genotype of the SNP site is AA, AG or GG, wherein AA is the homozygous type of the SNP site being A, GG is the homozygous type of the SNP site being G, and AG is the heterozygous type of the SNP site being A and G.

[0012] In the above method, the wheat may be an inbred line or a pure line.

[0013] In the above method, according to the genotype identification or auxiliary identification of wheat grain traits, the resistance to stem rot of the wheat to be tested with the genotype of AA can be higher than that of the wheat to be tested with the genotype of GG.

[0014] The application of the above method in wheat breeding also falls within the protection scope of the present invention.

[0015] The present invention also provides a method for wheat breeding, the method comprising detecting the genotype of the above-mentioned SNP site in the wheat genome, selecting wheat with the genotype of the SNP site being AA as a parent for wheat stem base rot resistance breeding; the site can also be used for wheat stem base rot resistance level screening, the AA is the homozygous type of the SNP site being A. The breeding goal of the breeding includes wheat stem base rot resistance. The purpose of the breeding includes cultivating wheat with excellent stem base rot resistance traits (stem base rot resistance traits are higher than the parent).

[0016] As an implementation method, the method for wheat breeding may include the following steps: (1) Using the genomic DNA of the wheat to be tested as a template, KASP was performed using the above primer set; (2) After completing step (1), performing fluorescence detection to determine the genotype of the SNP site of the wheat to be tested; (3) Select AA genotype wheat for breeding.

[0017] The present invention also provides a product for detecting the polymorphism or genotype of a SNP site in a wheat genome, wherein the SNP site is the above-mentioned SNP site, the product contains the above-mentioned substance, and the product is any one of the following: C1) Products for detecting or assisting in detecting single nucleotide polymorphisms or genotypes related to wheat stem rot resistance traits, C2) Products that identify or assist in identifying wheat resistance to stem rot. C3) Products for wheat breeding, C4) Products of screening or breeding wheat plants, strains, lines or varieties that are resistant to stem rot.

[0018] Optionally, the product may be any of the following: D1) The product is a primer combination for amplifying a wheat genomic DNA fragment including the SNP site, D2) The product is a PCR reagent containing the primer combination described in D1), D3) The product is a kit containing the primer combination described in D1) or the PCR reagent described in D2).

[0019] The above primer composition may consist of primer A, primer B and / or primer C; The primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 41st positions of sequence 2 in the sequence list, The primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 41st position of sequence 3 in the sequence list, The primer C is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence list.

[0020] The present invention also provides a DNA molecule, the nucleotide sequence of the DNA molecule is sequence 1 in the sequence list.

[0021] The specific sequence of the sequence 1 is: 5'-GTTAGTTGAGTCTGTAATAGGGCGGCTCCTGCTATCATGCGATCGGCGGA[AG]CATGTCGTCGTAGGTGCTTGGTATGTTGAAGCTCCGGATTTCATCCGAGC-3'.

[0022] The application of the above DNA molecules is also within the scope of protection of the present invention, and the application is any of the following: E1) Use of the DNA molecule in identifying or assisting in identifying wheat stem rot resistance traits, E2) Application of the DNA molecule in wheat breeding, E3) Use of the DNA molecule in the preparation of a product for identifying or assisting in identifying wheat stem rot resistance traits, E4) Use of the DNA molecule in preparing wheat breeding products, E5) Use of the DNA molecule in screening or breeding wheat plants, strains, lines or varieties with excellent resistance to stem rot, E6) Use of the DNA molecule in assisting the screening or breeding of wheat plants, strains, lines or varieties with excellent resistance to stem rot.

[0023] The product may be a kit.

[0024] The kit comprises a primer composition for amplifying a wheat genomic DNA fragment including the SNP site.

[0025] The above primer combination was used for PCR amplification, and the reaction was carried out according to the following system: the total volume of the amplification reaction was 4 μl, 0.048 μl Primer Mix, 2.0 μl Master Mix, 1.952 μl Template DNA (50 ng / μl), Master Mix was purchased from LGC, and the ratio of Primer Mix was: 12% HEX primer, 12% FAM primer, 30% Common primer, and the primer was synthesized by Shanghai Shenggong Company. Amplification was performed using a 384-well PCR instrument (BIO-RAD, S1000TM Thermal Cycler), and the program was as follows: 94°C for 15 min; 94°C for 20 s, 6355°C for 1 min (1°C decrease for each cycle), 10 cycles; 94°C for 20 s, 55°C for 60 s, 32 cycles. The PCR amplification products were placed in an automatic focusing fluorescence multifunctional microplate reader (PHERAstarplus SNP, BMGLABTECH) to read the final fluorescence data, and then the data were imported into Klustercaller v3.4 software (LGC, Hoddesdon, UK) for genotyping.

[0026] The above-mentioned method for detecting amplification products is to place the amplification products in an automatic focusing fluorescence multifunctional microplate reader (PHERAstarplus SNP, BMG LABTECH) to read the final fluorescence data, and then import the data into Klustercaller v3.4 software (LGC, Hoddesdon, UK) for genotyping.

[0027] The present invention can be used for rapid and accurate identification or auxiliary identification of wheat stem base rot resistance traits, can be used for early screening of wheat materials, and can be used for wheat molecular marker-assisted breeding. The substance of the present invention is applied to molecular marker-assisted selection of wheat stem base rot resistance traits, and wheat varieties (germplasms) with excellent wheat stem base rot resistance traits can be quickly screened out, thereby accelerating the process of breeding new disease-resistant wheat varieties, and has important theoretical significance and economic value in the research of exploring wheat germplasm resources and breeding wheat varieties with high stem base rot resistance traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is located in the Gaocheng 8901×Zhoumai 16 RIL population QFCR.caas-3AL Graph. DETAILED DESCRIPTION

[0029] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0030] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0031] Zhoumai 16 is a wheat variety bred by the Agricultural Science Research Institute of Zhoukou City, Henan Province. It is a hybrid of Zhou 8425B (male parent) and Zhou 9 (female parent). It is suitable for early wheat fields with high water and fertilizer in the central and northern Henan, northern Anhui, northern Jiangsu, and Guanzhong areas of Shaanxi in the southern part of the Huanghuai winter wheat region. Gaocheng 8901 is a high-yield, high-quality wheat variety bred by the Agricultural Science Research Institute of Gaocheng District, Shijiazhuang City.

[0032] The wheat material Gaocheng 8901 in the following embodiments has been disclosed in the reference: Li, F., Wen, W., He, Z., Liu, J., Jin, H., Cao, S., ...&Xia, X. (2018). Genome-wide linkage mapping of yield-related traits in three Chinese bread wheat populations using high-density SNP markers. Theoretical and Applied Genetics, 131, 1903-1924.

[0033] The article to be cited in the Nature group is: Li, F., Wen, W., Liu, J., Zhang, Y., Cao, S., He, Z., ...& Xia, X. (2019). Genetic architecture of grain yield in bread wheat based on genome-wide association studies. BMC plant biology, 19, 1-19.

[0034] Common wheat varieties are all preserved as grains, which the public can obtain from the National Germplasm Bank of the Chinese Academy of Agricultural Sciences or by contacting the corresponding author of the article.

[0035] Example 1, detection of wheat stem rot using Kasp marker 1.1 Discovery of SNP markers for wheat stem rot resistance genes The parents of Gaocheng 8901 / Zhoumai 16 RIL population and their 176 progeny lines used for QTL mapping were planted in Dezhou, Shandong and Jinan, Shandong in mid-October in 2020-2021 and 2021-2022. A completely randomized block design was adopted, with 3 replications, 6 rows, 1.5 m row length, 0.2 m row spacing, and 50 seeds / row. Before sowing, the pathogen inoculum expanded in wheat culture medium was thoroughly mixed with the soil and spread on the surface, 40 g of the pathogen inoculum of Fusarium graminearum / row. The Fusarium graminearum was provided by Qi Junshan, a researcher at the Institute of Plant Protection, Shandong Academy of Agricultural Sciences (Wang Heng, Ma Liguo, Zhang Bo, Zhang Yueli, Qi Kai, Li Changsong, Qi Junshan. (2017). Identification of the pathogen of wheat stem rot in Shandong Province. Green ecological sustainable development and plant protection-the 12th National Member Congress and Academic Annual Meeting of the Chinese Society of Plant Protection). The preparation process of pathogen inoculum is as follows: the wheat grains are cooked, drained, and packaged, and sterilized by high temperature and heat sterilization for 30 min. After cooling, the pre-prepared bacterial cake of the dominant pathogen-Farberella pseudograminearum is placed in a plastic bag and cultured at a constant temperature of 25 ℃ for about 10 days, turning from time to time to ensure that the pathogen is evenly distributed on the surface of the wheat grains until the wheat grains are covered with hyphae, and then taken out for use. 202 local varieties mainly from the Huanghuai wheat region used for KASP marker identification and QTL positioning were planted at the Jiyang Experimental Base of Shandong Academy of Agricultural Sciences from 2020 to 2022.

[0036] The disease index of stem base rot was investigated at the waxy stage of wheat. Fifteen single stems were randomly selected in each row, and the severity of the disease of each single stem was investigated according to the 0-5 grade grading standard in Table 1, and the disease index was calculated.

[0037] The disease index calculation formula is: FCR (Fusarium crown rot) disease index (FCR index) = (Σ (number of diseased plants at each level × representative value)) / (total number of plants surveyed × 5) × 100. The genomic DNA of young leaves of wheat plants was extracted, and the DNA concentration was determined using a NanoDrop2000c spectrophotometer. The DNA sample was adjusted to a standard concentration of 50 ng / ul, and then the DNA quality was tested using 0.8% agarose gel. The qualified DNA was subjected to SNP typing. SNP analysis was performed using a 90K SNP chip.

[0038] Table 1 Grading of disease severity of stem base rot during the grain filling period

[0039] 1.2 Converting SNP markers to KASP markers and designing primer sets for detecting the markers After removing the markers with heterozygous and missing rates greater than 10% between parents from the 90K SNP chip, 11,819 markers with differences between parents were selected. 3,242 backbone markers were selected and a genetic linkage map was constructed using IciMapping 4.1 and Joinmap, including 31 linkage groups, with a linkage map size of 3,161.1 cM and a density of 3.74 markers / cM.

[0040] The IciMapping 4.1 ICIM-ADD method was used for QTL analysis, and the LOD value was selected as 3.0. A stable QTL was located on chromosome 3ABL and named QFCR.caas-3AL ( Figure 1 ). The flanking BS00076772_51 and BS00023222_51 , with a physical range of 711.2-714.6 Mb. Under different environmental conditions, it can explain 6.0-6.9% of the phenotypic variation ( Figure 1 ). Its flanking marker BS00023222_51 was transformed into Kasp_3AL_FCR . Kasp_3AL_FCR It is sequence 1 (SEQ NO.1, 101 bp) in the sequence list, and the details are as follows: 5`-GTTAGTTGAGTCTGTAATAGGGCGGCTCCTGCTATCATGCGATCGGCGGA[AG]CATGTCGTCGTAGGTGCTTGGTATGTTGAAGCTCCGGATTTCATCCGAGC-3`.

[0041] The 51st nucleotide R (R is A or G) of sequence 1 in the sequence list is a SNP site, and the SNP site is named SNP-Kasp_3AL_FCR, which is a polymorphism of A or G. The genotype of the SNP site is as follows: AA, AG or GG. The AA is the homozygous type of the SNP site A, the GG is the homozygous type of the SNP site G, and the AG is the heterozygous type of the SNP site A and G.

[0042] A primer set based on KASP technology for detecting KASP markers was designed, referred to as KASP primer set. The KASP primer set consists of two upstream primers (primer A and primer B) and one downstream primer (primer C).

[0043] Preparation of KASP marker primer working solution: KASP primers were designed according to SNP-Kasp_3AL_FCR. The polymorphism of the SNP site was an A / G base difference. The primer sequences were shown in Table 3. The 22nd to 41st positions in primer A were sequence 2 (SEQ NO. 2) in the sequence list, the 22nd to 41st positions in primer B were sequence 3 (SEQ NO. 3) in the sequence list, and primer C was sequence 4 (SEQ NO. 4) in the sequence list.

[0044] Table 2 QTLs for detecting wheat stem rot resistance genes Kasp_3AL_FCR Primer sequences

[0045] The target sequence SNP is: 5'- GTTAGTTGAGTCTGTAATAGGGCGGCTCCTGCTATCATGCGATCGGCGGA[A / G]CATGTCGTCGTAGGTGCTTGGTATGTTGAAGCTCCGGATTTCATCCGAGC-3'.

[0046] Primer A is a primer with a FAM fluorescent tag sequence (underlined bases) at the 5' end. It can be used with primer C to amplify the fragment of SNP-Kasp_3AL_FCR A. The fluorescent signal (blue) of the FAM group can be read by an ELISA reader or a fluorescence quantitative PCR instrument. Primer B is a primer with a HEX fluorescent tag sequence (underlined bases) at the 5' end. It amplifies the fragment of SNP-Kasp_3AL_FCR G with primer C. The fluorescent signal (red) of the HEX group can be read by an ELISA reader or a fluorescent quantitative PCR instrument; the heterozygous AG is pink fluorescence.

[0047] Primer C is a universal primer.

[0048] 1.3 Use of primer pairs The experimental materials were 202 wheat varieties. 202 representative natural varieties from home and abroad were planted in Jinan, Shandong and Dezhou, Shandong in 2019-2020 and 2020-2021. A completely randomized block design was used with three replicates, 6 rows, 3 m long, 0.2 m wide, and 50 seeds were evenly sown in each row. The inoculation of stem base rot pathogens was consistent with the 1.1 method. The disease index was then investigated at the waxy stage.

[0049] use Kasp_3AL_FCR All experimental materials were marked and tested. The specific methods are as follows; (1) PCR amplification system and procedure. Wheat leaf genomic DNA was extracted and dissolved in 200ul TE. DNA quality was tested using 1% agarose gel electrophoresis. The extracted DNA was required to be free of obvious impurities, with clear bands and no degradation. After the DNA concentration was measured, it was uniformly diluted to 28.3ng / μl, and PCR amplification was performed using the diluted wheat genomic DNA as a template.

[0050] Take 12 μl of upstream primer A (100 μM), 12 μl of upstream primer B (100 μM) and 30 μl of downstream primer C (100 μM), add sterile ultrapure water to 100 μl as KASP-labeled primer working solution, and store at 4°C for later use.

[0051] The PCR amplification system was as follows: 1.5 μl of template DNA, 0.0417 μl of primer working solution, 0.75 μl of 2×KASP Master Mix (LGC, product number: KBS-1050-112), and the reaction system was supplemented to 3 μl with sterile ultrapure water.

[0052] The PCR reaction program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing at 94°C for 20 s (the first annealing temperature was 61°C, and the temperature was lowered by 0.6°C each cycle) for a total of 10 cycles; denaturation at 94°C for 20 s, annealing at 55°C for 1 min for a total of 26 cycles; extension at 72°C for 3 min, and storage at 4°C.

[0053] (2) Genotyping. After the PCR reaction was completed, the fluorescence signal was converted into an analyzable value using a fluorescence signal reader (Omega, BMGLABTECH, Germany) and a fluorescence detection system (Araya) to read the fluorescence data of the reaction product. The fluorescence scanning results were graphically displayed using the R software ggplot package. The C base type had FAM fluorescence and was distributed near the x-axis; the T base type had HEX fluorescence and was distributed near the y-axis; and samples with no detected signal were distributed near the origin.

[0054] Fluorescence plate reading was performed on an ABI7500 fluorescence quantitative PCR instrument at 35°C for 30 seconds, and terminal fluorescence reading was used for genotyping.

[0055] The excitation wavelength of FAM is 485nm, and the emission wavelength is 520nm. The excitation wavelength of HEX is 535nm, and the emission wavelength is 556nm. The excitation wavelength of the system reference fluorescence ROX is 575nm, and the emission wavelength is 610nm.

[0056] If a blue fluorescent signal is displayed, the QFCR.caas-3AL genotype of the wheat to be tested is AA (i.e., QFCR.caas-3AL is homozygous for A in the wheat genome); if a red fluorescent signal is displayed, the QFCR.caas-3AL genotype of the wheat to be tested is GG (i.e., QFCR.caas-3AL is homozygous for G in the wheat genome); if a pink fluorescent signal is displayed, the QFCR.caas-3AL genotype of the wheat to be tested is AG (i.e., QFCR.caas-3AL is a heterozygous for A and G in the wheat genome). The results are shown in Table 3. Among the 202 wheat varieties, 118 varieties showed the Gaocheng 8901 genotype (AA, blue), with an FCR disease index of 29.4%; 70 varieties showed the Zhoumai 16 genotype (GG, red), with an FCR disease index of 32.9%; T-test statistical test showed that the genetic effect of QFCR.caas-3AL reached a significant difference (P<0.05), that is, the resistance of wheat with AA genotype to stem base rot was significantly higher than that of wheat with GG genotype.

[0057] Table 3 Genotype detection results and maximum severity content of 202 wheat varieties

[0058]

[0059]

[0060]

[0061]

[0062]

[0063] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Application of a substance for detecting polymorphism or genotype of a SNP site in a wheat genome, characterized in that: The SNP site is a site in the wheat genome, the nucleotide type of which is A or G, and is the 51st nucleotide of sequence 1 in the sequence list; the application is any of the following: A1) Use of the substance in identifying or assisting in identifying wheat resistance to stem rot, A2) Application of the substance in wheat breeding, A3) Use of the substance in the preparation of a product for identifying or assisting in identifying wheat resistance to stem rot, A4) Use of the substance in preparing wheat breeding products.

2. The use according to claim 1, characterized in that: The substance is as follows (B1), B2) or B3): B1) the substance is a primer composition for amplifying a wheat genomic DNA fragment including the SNP site, B2) The substance is a PCR reagent containing the primer combination described in B1), B3) The substance is a kit containing the primer composition described in B1) or the PCR reagent described in B2).

3. A method for identifying or assisting in identifying wheat stem rot resistance traits, characterized in that: The method comprises detecting the genotype of the SNP site in the wheat genome to be tested, and identifying or assisting in identifying the wheat stem base rot resistance trait according to the genotype, wherein the SNP site is the SNP site described in claim 1.

4. Application of the method according to claim 3 in wheat breeding.

5. A method for wheat breeding, characterized in that: The method comprises detecting the genotype of the SNP site in claim 1 in the wheat genome, and selecting wheat with the genotype of the SNP site being AA as a parent for breeding, wherein AA is the homozygous type of the SNP site being A.

6. A product for detecting polymorphism or genotype of SNP sites in wheat genome, characterized in that: The SNP site is the SNP site described in claim 1, the product contains the substance described in claim 1, and the product is any one of the following: C1) Products for detecting or assisting in detecting single nucleotide polymorphisms or genotypes related to wheat stem rot resistance traits, C2) Products that identify or assist in identifying wheat resistance to stem rot. C3) Products for wheat breeding, C4) Products of screening or breeding wheat plants, strains, lines or varieties that are resistant to stem rot.

7. The product according to claim 6, characterized in that: The product is as follows (D1), D2) or D3): D1) The product is a primer combination for amplifying a wheat genomic DNA fragment including the SNP site, D2) The product is a PCR reagent containing the primer combination described in D1), D3) The product is a kit containing the primer combination described in D1) or the PCR reagent described in D2).

8. The use according to claim 2 or the product according to claim 7, characterized in that: The primer composition consists of primer A, primer B and / or primer C; The primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 41st position of sequence 1 in the sequence list, The primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list or a single-stranded DNA whose nucleotide sequence is the 22nd to 41st position of sequence 2 in the sequence list, The primer C is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence list.

9. A DNA molecule, characterized in that: The nucleotide sequence of the DNA molecule is sequence 1 in the sequence list.

10. The use of the DNA molecule according to claim 9, wherein the use is any of the following: E1) Use of the DNA molecule in identifying or assisting in identifying wheat stem rot resistance traits, E2) Application of the DNA molecule in wheat breeding, E3) Use of the DNA molecule in the preparation of a product for identifying or assisting in identifying wheat resistance to stem rot, E4) Use of the DNA molecule in preparing wheat breeding products, E5) Use of the DNA molecule in screening or breeding wheat plants, strains, lines or varieties with excellent resistance to stem rot, E6) Use of the DNA molecule in assisting the screening or breeding of wheat plants, strains, lines or varieties with excellent resistance to stem rot.

Images