Recombinant trichoderma reesei strain for producing brazitame protein as well as construction method and application of recombinant trichoderma reesei strain

Abstract

The invention relates to a recombinant trichoderma reesei strain for producing brazitame protein as well as a construction method and application of the recombinant trichoderma reesei strain, and belongs to the technical field of biology. The recombinant trichoderma reesei strain is named as Trichoderma reesei DF230919, and is preserved in the China General Microbiological Culture Collection Center on August 9, 2024, and the preservation number of the recombinant trichoderma reesei strain is CGMCC (China General Microbiological Culture Collection Center) NO. 41488. According to the invention, a homologous recombination technology is utilized, QM6a [delta] pyr4 is taken as a host, a cellobiohydrolase gene cbh1 in trichoderma reesei is replaced with a Brazinein gene, and heterologous expression of Brazinein is realized in a recombinant trichoderma reesei strain; as the genome of the Trichoderma reesei is completely sequenced and widely researched, the construction and recombination of the Trichoderma reesei strain can be accurately controlled and regulated, the expression quantity and product purity of the Brazilian sweet protein can be effectively improved, and the Trichoderma reesei can grow under the condition of large-scale culture, so that the Trichoderma reesei strain can be widely applied to the field of culture of the Brazilian sweet protein. The Brazilian sweet protein is expressed in Trichoderma reesei through genetic engineering, so that the Brazilian sweet protein can be widely applied to industrial production of Brazilian sweet.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a recombinant Trichoderma reesei strain for producing brasiliensis protein, and a construction method and application thereof. Background Art

[0002] The filamentous fungus Trichoderma reesei is a mesophilic saprophytic filamentous fungus and the main industrial production strain of cellulase and hemicellulase. Trichoderma reesei is a food-safe industrial production strain certified by the US FDA. It is widely used because of its ability to naturally secrete a large amount of endogenous proteins into the extracellular space. Its endogenous cellulase yield is as high as 100g / L after fermentation, and it has a glycosylation system similar to that of higher mammals. Therefore, Trichoderma reesei has become an ideal recombinant protein expression host for expressing homologous and heterologous proteins due to its diverse post-translational modifications. It has been highly valued by internationally renowned enzyme preparation companies (such as Genencor, Novozymes, etc.) and has been successfully used in the expression and production of a variety of drugs, chemical reagents and enzyme reagents.

[0003] The cellulases and hemicellulases produced by Trichoderma reesei are widely used in various industries, such as cbh1, cbh2, egl1, egl2, xyn1, xyn2 and xyn3. The promoters of cellulases and hemicellulases have the characteristics of induction and high expression. Some promoters, such as cbh1 and cbh2 promoters, have been successfully used to express heterologous proteins. At the same time, the fermentation process of Trichoderma reesei is mature and the fermentation cost is low, which lays a good foundation for its industrial production. In recent years, with the rapid development of Trichoderma reesei genomics and the continuous improvement of its genetic operating system, the use of Trichoderma reesei to express heterologous proteins has also received more and more attention.

[0004] Brazzein (sometimes translated as Brazzein in Chinese) is a sweet protein isolated and purified from the fruit of a wild plant in West Africa by Ding et al. in 1994. Compared with traditional carbohydrate sugars or chemically synthesized sweeteners, these natural sweet proteins generally have the advantages of high sweetness, low calories, good taste, safety and non-toxicity. At the same time, they also have the characteristics of improving food flavor, being degradable into various amino acids required by the human body, and not causing blood sugar rise and tooth decay. They are considered to be food additives with great development prospects. Studies have found that Brazzein is a single-chain polypeptide composed of 54 amino acid residues, containing 8 cysteines, forming 4 pairs of intramolecular disulfide bonds. The relative molecular mass of Brazzein is 6500, and its sweetness is 2000 times that of sucrose of the same mass. Compared with other sweet proteins, Brazzein has the smallest molecular weight and the best water solubility. Its aqueous solution still maintains sweetness after 4h of heat treatment at 80℃, has good thermal stability and pH stability, and has a synergistic effect and flavor improvement when used with sugar sweeteners.

[0005] Brazzein has good application prospects in food processing, feed, medicine and other fields, and shows high commercial value. The technology for producing brazzein that has been reported so far is mainly a natural high-sweetness protein extracted from the fruit of the wild plant Pentadiplandrabrazzeana Baillon in western Africa, which has good food application potential. However, the traditional extraction process of brazzein has the problems of low yield and relatively low secretion expression, which makes it difficult to scale up production and cannot meet the requirements of industrial production, thus leading to the bottleneck of the industrialization of brazzein. Summary of the invention

[0006] In order to solve the above problems, the present invention provides a recombinant Trichoderma reesei strain for producing brazzein, and a construction method and application thereof, wherein QM6aΔpyr4 is used as a host, the cellobiohydrolase gene (cbh1) in Trichoderma reesei is replaced with the brazzein gene (Brazzein), and brazzein is heterologously expressed in the recombinant Trichoderma reesei strain through genetic engineering.

[0007] The technical solution of the present invention is as follows:

[0008] To achieve the above-mentioned purpose, the present invention provides a recombinant Trichoderma reesei strain for producing brasiliensis protein, the recombinant Trichoderma reesei strain is named Trichoderma reesei DF230919, which has been deposited on August 9, 2024, with the deposit number: CGMCC NO.41488, and the deposit address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, General Microbiology Center of China Microbiological Culture Collection Administration, Postal Code 100101.

[0009] Furthermore, the recombinant Trichoderma reesei strain uses homologous recombination technology to replace the cellobiohydrolase gene cbh1 in Trichoderma reesei with the Brazzein gene, and heterologous expression of the Brazzein protein is performed in the recombinant Trichoderma reesei strain.

[0010] The second object of the present invention is to provide a recombinant expression plasmid for producing brazilian tamarind protein, wherein the recombinant expression plasmid pPcbh1-Bra comprises a promoter sequence of a cellulase gene, a signal peptide sequence, a gene sequence encoding brazilian tamarind protein, and a terminator sequence of a cellulase gene in sequence.

[0011] Furthermore, the construction method includes firstly connecting the Brazzein gene fragment with the backbone fragment of the recombinant expression plasmid vector pPcbh1-Bra by Gibson connection; then transforming the connection product into competent Escherichia coli T1, coating a solid plate and culturing overnight to grow a single colony; finally, designing primers Vpcbh1-F and VBra-R to perform colony PCR to identify transformants, and extracting plasmids from transformants with correct connection verified by colony PCR to send for sequencing. After sequencing is correct, the recombinant expression vector pPcbh1-Bra is obtained; wherein,

[0012] Vpcbh1-F:gtgtggtaggatcgaacac

[0013] VBra-R: gcagtcgtagttgcactgg.

[0014] Furthermore, the brazzein gene fragment is synthesized from the nucleotide sequence of the brazzein gene with accession number KF013250.1 in Genebank.

[0015] Furthermore, the fragment of the recombinant expression plasmid vector pPcbh1-Bra is as follows:

[0016] (1) Design primers Gcbh1-UF and Gcbh1-UR to amplify the Pcbh1 sequence using the genome of the wild-type strain QM6a of Trichoderma reesei as a template; wherein,

[0017] Gcbh1-UF: ctatagggagaccggcagcggccgcaaatctacacgtgggcccctttcg

[0018] Gcbh1-UR:cacttttttgcatttgtcagcacgagctgtggccaag

[0019] (2) Design primers pyr4-F and pyr4-R, and amplify the Trichoderma reesei orotidine-5′-phosphate decarboxylase gene pyr4 using the genome of the wild-type Trichoderma reesei strain QM6a as a template; wherein,

[0020] pyr4-F:ccccaaagtcgcaatatcgggtatcg

[0021] pyr4-R:caactgcatccaaaccatcc

[0022] (3) Design primers Gcbh1-DF and Gcbh1-DR to amplify the Tcbh1 sequence using the genome of the wild-type strain QM6a of Trichoderma reesei as a template; wherein,

[0023] Gcbh1-DF: gactactgcgaatactaaagctccgtggcgaaagcctg

[0024] Gcbh1-DR: gaaaattggagcactgcgaggggccgtttcgtgcggctgaatccattc

[0025] (4) Design primers GBra-F and GBra-R to amplify the brasiliensis gene sequence using the gene synthesis plasmid as a template; wherein,

[0026] GBra-F:cttggccacagctcgtgctgacaaatgcaaaaaagtg

[0027] GBra-R: caggctttcgccacggagctttagtattcgcagtagtc

[0028] (5) Design primers Gbackbone-F and Gbackbone-R, and use pBluescript II SK(+) vector as template to amplify the vector backbone fragment containing the Amp selection marker; wherein,

[0029] Gbackbone-F: gaatggattcagccgcacgaaacggcccctcgcagtgctccaattttc

[0030] Gbackbone-R: cgaaaggggcccacgtgtagatttgcggccgctgccggtctccctatag.

[0031] Furthermore, after the fragments of the recombinant expression plasmid vector pPcbh1-Bra were amplified, they were subjected to 1% agarose gel electrophoresis and gel recovery, and the recovered DNA fragments were dissolved in 20 μL of deionized water and stored at -20°C.

[0032] Further, the culture was spread on LB+Amp solid plates and cultured at 37°C.

[0033] The third object of the present invention is to provide a method for constructing a recombinant Trichoderma reesei strain that produces brazilian thauma protein. First, a recombinant expression plasmid pPcbh1-Bra of the Trichoderma reesei strain is constructed, and then the recombinant expression plasmid is transformed into Trichoderma reesei to screen and obtain a strain expressing brazilian thauma protein.

[0034] Furthermore, the construction method includes the following steps:

[0035] S1. Amplify the promoter and signal peptide sequence of the cellobiohydrolase gene cbh1 as shown in SEQ ID NO.1 and the terminator sequence of the cellobiohydrolase gene cbh1 as shown in SEQ ID NO.2 from Trichoderma reesei QM6a; synthesize the Brazzein gene fragment as shown in SEQ ID NO.3, connect and transform the Brazzein gene fragment with other fragments of the recombinant expression plasmid vector pPcbh1-Bra by Gibson connection, and construct the recombinant expression plasmid pPcbh1-Bra; amplify the screening marker pyr4 expression cassette as shown in SEQ ID NO.4 from Trichoderma reesei QM6a;

[0036] S2, amplifying the expression cassette containing the cellulase promoter and signal peptide, the brazilian sweet gene, the cellulase terminator and the selection marker pyr4 expression cassette from the recombinant expression plasmid pPcbh1-Bra and transforming it into Trichoderma reesei QM6aΔpyr4 through electroporation;

[0037] S3. Screen and obtain a recombinant Trichoderma reesei strain that heterologously expresses brasiliensis protein.

[0038] A fourth object of the present invention is to provide a use of a recombinant Trichoderma reesei strain producing brasiliensis protein in the preparation of products containing brasiliensis protein.

[0039] Compared with the prior art, the beneficial effects of the present invention are:

[0040] The invention discloses a recombinant Trichoderma reesei strain for producing brazzein. The homologous recombination technology is used, QM6aΔpyr4 is used as a host, a cellobiohydrolase gene cbh1 in Trichoderma reesei is replaced with a brazzein gene Brazzein, heterologous expression of brazzein is achieved in the recombinant Trichoderma reesei strain, and the expression amount and product purity of brazzein are effectively improved.

[0041] Since the genome of Trichoderma reesei has been completely sequenced and widely studied, the method for constructing a recombinant Trichoderma reesei strain described in the present invention can accurately control and regulate the construction and recombination of the Trichoderma reesei strain, and Trichoderma reesei can grow under large-scale culture conditions. Through genetic engineering, efficient expression of the target protein brazilian sweet protein is achieved in Trichoderma reesei, which makes up for the single production path of extracting brazilian sweet from African arrowroot in the prior art, and has fewer extraction steps, reducing the difficulty and cost of extracting brazilian sweet, which helps to achieve large-scale production of brazilian sweet and meet the requirements of industrialization. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 A schematic diagram of the recombinant expression plasmid pPcbh1-Bra of the Trichoderma reesei strain constructed in the present invention;

[0043] Figure 2 This is a fermentation verification diagram of the Brazilian melamine protein of the recombinant Trichoderma reesei strain in the performance test of the present invention;

[0044] Figure 3 This is a 10L tank fermentation verification diagram of the recombinant Trichoderma reesei strain Brazilian sweet protein in the performance test of the present invention. DETAILED DESCRIPTION

[0045] The present invention will be further described below in conjunction with the accompanying drawings and preferred embodiments. The given embodiments are only for illustrating the present invention, rather than for limiting the scope of the present invention.

[0046] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources;

[0047] The quantitative tests in the following examples were repeated three times, and the results were averaged.

[0048] The experimental methods in the following embodiments are conventional methods unless otherwise specified.

[0049] In order to better understand the content of the present invention, the filamentous fungus Trichoderma reesei QM6aΔpyr4 is taken as the starting strain for further description of specific examples.

[0050] Medium preparation

[0051] LB liquid culture medium: 10 g / L NaCl, 10 g / L tryptone, 5 g / L yeast extract powder, sterilized at 121°C for 20 min, and stored at room temperature.

[0052] LB+Amp solid culture medium: LB liquid culture medium plus 20g / L agar, sterilize at 121℃ for 20min in an autoclave, then cool to about 45℃, add the prepared Amp solution to make the final concentration of 100mg / L.

[0053] PDA solid culture medium: 200g peeled potatoes, boiled in tap water until muddy, filtered, took the supernatant and added 20g glucose, 20g agar, dilute to 1L with tap water, natural pH, sterilized at 121℃ for 20min.

[0054] PDA+U solid culture medium: 200 g of peeled potatoes were boiled in tap water until muddy, filtered, and the supernatant was added with 20 g of glucose, 20 g of agar, and 2.442 g of Uridine. The volume was adjusted to 1 L with tap water, and the natural pH was set. Sterilized at 121°C for 20 min.

[0055] MM+G liquid culture medium: 1 mL each of 60 g / L CaCl2·2H2O, 60 g / L MgSO4·7H2O, 100 μL each of 3.7 g / L CoCl2·6H2O, 5 g / L FeSO4·7H2O, 1.4 g / L ZnSO4·7H2O, and 1.6 g / L MnSO4·H2O, 1.5 g of KH2PO4, 0.5 g of (NH4)2SO4, and 2 g of Glucose. Make up to 100 mL and sterilize at 121°C for 20 min.

[0056] MM+G solid culture medium: 1 mL each of 60 g / L CaCl2·2H2O, 60 g / L MgSO4·7H2O, 100 μL each of 3.7 g / L CoCl2·6H2O, 5 g / L FeSO4·7H2O, 1.4 g / L ZnSO4·7H2O, and 1.6 g / L MnSO4·H2O, 1.5 g KH2PO4, 0.5 g (NH4)2SO4, 2 g Glucose, and 2 g agar powder. Make up to 100 mL and sterilize at 121°C for 20 min.

[0057] MM+G+T solid culture medium: 1 mL each of 60 g / L CaCl2·2H2O, 60 g / L MgSO4·7H2O, 100 μL each of 3.7 g / L CoCl2·6H2O, 5 g / L FeSO4·7H2O, 1.4 g / L ZnSO4·7H2O, and 1.6 g / L MnSO4·H2O, 1.5 g KH2PO4, 0.5 g (NH4)2SO4, 2 g Glucose, 2 g agar powder, 100 μL Triton X-100, make up to 100 mL, and sterilize at 121°C for 20 min.

[0058] MM+ sugarcane bagasse liquid culture medium: 1 mL each of 60 g / L CaCl2·2H2O, 60 g / L MgSO4·7H2O, 100 μL each of 3.7 g / L CoCl2·6H2O, 5 g / L FeSO4·7H2O, 1.4 g / L ZnSO4·7H2O, and 1.6 g / L MnSO4·H2O, 1.5 g KH2PO4, 0.5 g (NH4)2SO4, 2 g Sugarcane Bagasse, make up to 100 mL, and sterilize at 121°C for 20 min.

[0059] MM+ bagasse fermentation medium: 1 mL each of 60 g / L CaCl2·2H2O, 60 g / L MgSO4·7H2O, 20 μL each of 3.7 g / L CoCl2·6H2O, 5 g / L FeSO4·7H2O, 1.4 g / L ZnSO4·7H2O, and 1.6 g / L MnSO4·H2O, 1.5 g KH2PO4, 0.5 g (NH4)2SO4, 1 g Glucose, 2 g Sugarcane Bagasse, 1 mL of 50 mL / L defoaming agent, adjust the pH to 5 with KOH, make up to 100 mL, and sterilize at 121°C for 20 min.

[0060] Fermentation feed medium: 50g / L CaCl2, 100g / L MgSO4·7H2O 1mL, 3.7g / LCoCl2·6H2O, 5g / L FeSO4·7H2O, 1.4g / L ZnSO4·7H2O, 1.6g / LMnSO4·H2O 20μL each, KH2PO4 0.42g, (NH4)2SO4 0.8g, make up to 100mL, sterilize at 121℃ for 20min.

[0061] 1M Sorbitol: Dissolve 91.085 g of sorbitol in distilled water, make up to 500 mL, sterilize at 121°C for 20 min, and store at 4°C.

[0062] YPD liquid culture medium: 20 g / L tryptone, 10 g / L yeast extract powder, 10 g / L glucose, sterilized at 121°C for 20 min, and stored at room temperature.

[0063] Water agar solid culture medium: dissolve agar in single distilled water to a final agar concentration of 20 g / L, sterilize at 121°C for 20 min, and store at room temperature.

[0064] The Trichoderma reesei QM6a (ATCC 13631) and Trichoderma reesei QM6aΔpyr4 used in the examples of the present invention were both kindly provided by Professor N. Louise Glass of the University of California, Berkeley.

[0065] Plasmid extraction kits and gel recovery kits were purchased from OMEGA, and similar products from other companies can also be used instead.

[0066] Example 1

[0067] This embodiment provides a recombinant expression plasmid for producing brasilin, and the construction method thereof is as follows:

[0068] S1. The nucleotide sequence of the brazzein gene registered in Genebank (accession number KF013250.1) was sent to Beijing Qingke Biotechnology Co., Ltd. for synthesis.

[0069] S2. Amplify the recombinant expression plasmid vector pPcbh1-Bra fragment, as follows:

[0070] (1) Primers Gcbh1-UF and Gcbh1-UR were designed to amplify the Pcbh1 sequence using the genome of the wild-type strain QM6a of Trichoderma reesei as a template.

[0071] Gcbh1-UF: ctatagggagaccggcagcggccgcaaatctacacgtgggcccctttcg

[0072] Gcbh1-UR:cacttttttgcatttgtcagcacgagctgtggccaag

[0073] (2) Primers pyr4-F and pyr4-R were designed and the genome of the wild-type Trichoderma reesei strain QM6a was used as a template to amplify the Trichoderma reesei orotidine-5′-phosphate decarboxylase gene pyr4.

[0074] pyr4-F:ccccaaagtcgcaatatcgggtatcg

[0075] pyr4-R:caactgcatccaaaccatcc

[0076] (3) Primers Gcbh1-DF and Gcbh1-DR were designed to amplify the Tcbh1 sequence using the genome of the wild-type strain QM6a of Trichoderma reesei as a template.

[0077] Gcbh1-DF: gactactgcgaatactaaagctccgtggcgaaagcctg

[0078] Gcbh1-DR: gaaaattggagcactgcgaggggccgtttcgtgcggctgaatccattc

[0079] (4) Primers GBra-F and GBra-R were designed and the Brazilian sweet potato gene sequence was amplified using the gene synthesis plasmid as a template.

[0080] GBra-F:cttggccacagctcgtgctgacaaatgcaaaaaagtg

[0081] GBra-R: caggctttcgccacggagctttagtattcgcagtagtc

[0082] (5) Design primers Gbackbone-F and Gbackbone-R, and use pBluescript II SK(+) vector as template to amplify the vector backbone fragment containing the Amp selection marker.

[0083] Gbackbone-F: gaatggattcagccgcacgaaacggcccctcgcagtgctccaattttc

[0084] Gbackbone-R: cgaaaggggcccacgtgtagatttgcggccgctgccggtctccctatag

[0085] Then, the DNA fragments were recovered after 1% agarose gel electrophoresis and dissolved in 20 μL deionized water and stored at -20°C.

[0086] S3. First, the Brazzein gene fragment was connected to the recombinant expression plasmid vector pPcbh1-Bra fragment by Gibson connection. The schematic diagram of the plasmid vector is shown in Figure 1 shown.

[0087] S4. Use the ligated vector product to transform Escherichia coli T1 competent cells, spread on LB+Amp solid plates, grow single colonies after culturing at 37°C overnight, design primers Vpcbh1-F and VBra-R for colony PCR, and identify transformants. Colony PCR verifies that the transformants with correct ligation are extracted and sent for sequencing. After sequencing is correct, the recombinant expression vector pPcbh1-Bra containing the brazilian sweet gene is obtained.

[0088] Vpcbh1-F:gtgtggtaggatcgaacac

[0089] VBra-R:gcagtcgtagttgcactgg

[0090] Example 2

[0091] This embodiment provides a method for constructing a recombinant Trichoderma reesei strain that produces brasiliensis, and the specific steps are as follows:

[0092] S1. Electroporation of Trichoderma reesei QM6aΔpyr4

[0093] 1) Inoculate the Trichoderma reesei QM6aΔpyr4 strain onto a PDA+U solid plate and culture at 28° C. for 5 to 7 days to allow the strain to grow and produce spores;

[0094] 2) Pre-cool a 50 mL centrifuge tube on ice, wash the spores of Trichoderma reesei QM6aΔpyr4 strain with ice-cold 1 M Sorbitol, filter the mycelium with a magic filter cloth, and then collect the spore suspension in a pre-cooled centrifuge tube;

[0095] 3) Centrifuge the collected spore suspension at 4°C, 3400 rpm for 5 min, discard the supernatant, add 35 mL of ice-cold 1 M Sorbitol, and resuspend the spore suspension;

[0096] 4) Repeat step 3) three times and count the spores by dilution;

[0097] 5) Pipette 100 μL of spore suspension into a 1.5 mL EP tube, ensuring that each 100 μL of spore suspension contains 10 8 spores;

[0098] 6) adding 2 μg of the DNA fragment containing the brazilian sweet gene and the selection marker to the spore suspension of step 5), respectively, and mixing by pipetting;

[0099] 7) Sterilize and blow dry the 1 mm electroporation cup under a UV clean bench and pre-cool it on ice. Mix the spore suspension and the recombinant expression vector pPcbh1-Bra evenly and add them to the pre-cooled electroporation cup. Perform electric shock at a voltage of 1.6 kV, a capacitance of 25 μF, and a resistance of 600 Ω.

[0100] 8) After the electroporation is completed, quickly add 900 μL of ice-cold 1M orbitol to the electroporation cup, blow and mix the spore suspension in the electroporation cup, and pipette the spore suspension into a 1.5 mL EP tube;

[0101] 9) Transfer the electroporated spore suspension to a 15 mL centrifuge tube, add 8 mL of YPD liquid medium, and culture at 28°C and 80 rpm for 12 h;

[0102] 10) Centrifuge the spore suspension at 3400 rpm for 5 min at room temperature and discard the supernatant. Add 8 mL of MM+G liquid medium and centrifuge at 3400 rpm for 5 min at room temperature, discard the supernatant, and wash the remaining YPD medium;

[0103] 11) Melt the MM+G solid medium and pour it onto the bottom plate. After the bottom plate solidifies, cool the MM+G solid medium to about 50°C, add 12mL of MM+G solid medium and spore suspension into a 15mL centrifuge tube, mix well and pour it onto the cooled MM+G solid plate, gently shake to spread the upper medium evenly, and after the upper medium solidifies, place the plate in a 28°C incubator for 2 to 3 days.

[0104] S2. Screening of recombinant expression strains

[0105] 1) After the electroporation plate containing the spore suspension is cultured at 28°C for 2-3 days, the transformants grown on the plate are picked onto a PDA solid plate and cultured at 28°C for 5-7 days. After the strain grows and produces spores, genomic DNA is extracted for verification;

[0106] 2) The heterokaryotic transformants with correct genome verification are inoculated onto water agar solid plates, so that Trichoderma reesei is more likely to produce monokaryotic spores under nutrient-deficient conditions, which is conducive to the subsequent acquisition of homokaryotic strains;

[0107] 3) After culturing at 28°C for 5-7 days, wash the spores on the water agar solid plate with sterile water, count them, and then dilute and plate them on the MM+G+T solid plate, and culture them at 28°C for 3-6 days;

[0108] 4) Pick the single colony grown on the MM+G+T solid plate onto the PDA solid plate and culture at 28°C for 5-7 days. After the strain grows and produces spores, extract the genomic DNA for verification. Using genomic DNA as a template, design primers Vpcbh1-UF and VBra-R as external primers, Vcbh1-F and Vcbh1-R as internal primers, and select the strain with bands for the external primers and no bands for the internal primers after 1% agarose gel electrophoresis, which is the recombinant Trichoderma reesei positive homokaryon strain.

[0109] Vpcbh1-UF: caatcagtgagtcatggcac

[0110] VBra-R:gcagtcgtagttgcactgg

[0111] Vcbh1-F:ctatgtcctgacaacgagac

[0112] Vcbh1-R:gtgacgccattctggacatag

[0113] Performance Testing

[0114] 1. Fermentation validation test of recombinant Trichoderma reesei engineered strain

[0115] S1. Inoculate the recombinant Trichoderma reesei positive homokaryon strain and the control strain (wild type QM6a) on a PDA solid plate, culture at 28° C. for 7 days, and ferment after the strain grows and produces spores;

[0116] S2. Wash the transformants and control strain spores with sterile water, filter the mycelium with a magic filter cloth, collect the spore suspension in a 15 mL centrifuge tube and count;

[0117] S3. Inoculate the transformant and the control strain into 50 mL MM + bagasse liquid medium in a 250 mL Erlenmeyer flask at an inoculum size of 10 6 spores / mL medium, fermented at 28°C, 220 rpm for 6 days;

[0118] S4. After the fermentation, the fermentation broth was centrifuged at 13000 rpm for 10 min, and the supernatant was taken for sample preparation and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) verification.

[0119] The electrophoresis results are as follows Figure 2 As shown, Figure 2 The results showed that the constructed recombinant Trichoderma reesei engineered strain successfully heterologously expressed brasiliensis protein with a protein size of 6.5 kDa.

[0120] The recombinant Trichoderma reesei engineered strain that successfully heterologously expressed Brazilian sweet protein was named Trichodermareesei DF230919, and the strain was preserved. It was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on August 9, 2024, with the deposit number CGMCC NO.41488.

[0121] 2. Adjustment and testing of the 10L tank fermentation process of the recombinant Trichoderma reesei engineered strain

[0122] S1. Inoculate the recombinant Trichoderma reesei positive homokaryon strain DF230919 and the control strain (wild type QM6a) on a PDA solid plate, culture at 28° C. for 7 days, and ferment after the strain grows and produces spores;

[0123] S2. Wash the conidia from the PDA plate with sterile water in a clean bench, filter the mycelium with a magic filter cloth, and then count the spore suspension using a hemocytometer.

[0124] S3, inoculated with 1×10 6 spores were placed in a 500 mL pyramidal seed bottle filled with 100 mL MM+G liquid medium. After 48 h of culture, the bacteria in the seed bottle were transferred to a 10 L fermenter. The volume of the medium in the fermenter was 7 L, and the feed was continuously added at a rate of 1000 mL / 48 h. The culture conditions were as follows: temperature 28 ° C, 300 rpm, aeration ratio of about 0.8 vvm, and pH maintained at about 5.

[0125] S4. From the start of inoculation, the fermentation was cultured for 6 days. Samples were taken every 24 hours during the culture process, the supernatant of the fermentation liquid was collected, centrifuged at 13000 rpm for 10 min, and the supernatant was stored at 4°C.

[0126] S5. After the fermentation is completed, the fermentation broth is centrifuged at 13000 rpm for 10 min, and the supernatant is used for sample preparation and sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) verification.

[0127] The electrophoresis results are as follows Figure 3 As shown, Figure 3 It shows that after the fermentation process was adjusted and optimized, the constructed recombinant Trichoderma reesei engineered strain DF230919 could reach 3.88g / L after fermentation in a 10L fermenter. It should be noted that the test data obtained in this operation step are confirmed data obtained after multiple tests.

[0128] According to the above experiments, it can be concluded that the construction method of the present invention can produce a good expression level, and the generated bands are very single, which is conducive to better development of downstream purification processes.

[0129] 3. Sweetness test of Brazilian sweet protein heterologously expressed by recombinant Trichoderma reesei engineered strain

[0130] The sweetness of sweet protein was identified by blind test. In the blind test, the control group used 10% sucrose aqueous solution and fermentation broth of wild-type Trichoderma reesei, and the experimental group used the test sample fermented by recombinant Trichoderma reesei strains expressing Brazilian sweet protein. A 10-person evaluation team tasted the samples.

[0131] The members of the evaluation panel could all taste that the 10% sucrose aqueous solution and the sweet protein samples to be tested had obvious sweetness, while the fermentation liquid after the wild-type strain fermentation treatment had no sweetness.

[0132] It should be noted that (1) the promoter and signal peptide sequence of the cellobiohydrolase gene cbh1 with the nucleotide sequence shown in SEQ ID NO.1 amplified from Trichoderma reesei QM6a are as follows:

[0133]

[0134] (2) The terminator sequence of the cellobiohydrolase gene cbh1 with the nucleotide sequence shown in SEQ ID NO.2 is as follows:

[0135] Agctccgtggcgaaagcctgacgcaccggtagattcttggtgagcccgtatcatgacggcggcgggag

[0136] ctacatggccccgggtgatttattttttttgtatctacttctgacccttttcaaatatacggtcaactcatctttcactgga

[0137] gatgcggcctgcttggtattgcgatgttgtcagcttggcaaattgtggctttcgaaaacacaaaacgattccttagta

[0138] gccatgcattttaagataacggaatagaagaaagaggaaattaaaaaaaaaaaaaaaacaaacatcccgttcata

[0139] acccgtagaatcgccgctcttcgtgtatcccagtaccacggcaaaggtatttcatgatcgttcaatgttgatattgttc

[0140] ccgccagtatggctccacccccatctccgcgaatctcctcttctcgaacgcggtagtggcgcgccaattggtaatg

[0141] acccatagggagacaaacagcataatagcaacagtggaaattagtggcgcaataattgagaacacagtgagac

[0142] catagctggcggcctggaaagcactgttggagaccaacttgtccgttgcgaggccaacttgcattgctgtcaaga

[0143] cgatgacaacgtagccgaggaccgtcacaagggacgcaaagttgtcgcggatgaggtctccgtagatggcata

[0144] gccggcaatccgagagtagcctctcaacaggtggccttttcgaaaccggtaaaccttgttcagacgtcctagccg

[0145] cagctcaccgtaccagtatcgaggattgacggcagaatagcagtggctctccaggatttgactggacaaaatctt

[0146] ccagtattcccaggtcacagtgtctggcagaagtcccttctcgcgtgcgagtcgaaagtcgctatagtgcgcaatg

[0147] agagcacagtaggagaataggaacccgcgagcacattgttcaatctccacatgaattggatgactgctgggcag

[0148] aatgtgctgcctccaaaatcctgcgtccaacagatactctggcaggggcttcagatgaatgcctctgggccccca

[0149] gataagatgcagctctggattctcggttacgatgatatcgcgagagagcacgagttggtgatggaggggacgag

[0150] gaggcataggtcggccgcaggcccataaccagtcttgcacagcattgatcttcctcacgaggagctcctgatgca

[0151] gaaactcctccatgttgctgattgggttgagaatttcatcgctcctggatcgtatggttgctggcaagaccctgctta

[0152] accgtgccgtgtcatggtcatctctggtggcttcgtcgctggcctgtctttgcaattcgacagcaaatggtggagat

[0153] ctctctatcgtgacagtcatggtagcgatagctaggtgtcgttgcacgcacataggccgaaatgcgaagtggaaa

[0154] gaatttcccggcgcggaatgaagtctcgtcattttgtactcgtactcgacacctccaccgaagtgttaagaatggat

[0155] ccacgatgccaaaaagcttgttcatttcggctagcccgtgatcctggcgcttctagggctgaaactgtgttgttaatg

[0156] tattattggctgtgtaactgacttgaatggggaatgaggagcgcgatggattcgcttgcatgtcccctggccaaga

[0157] cgagccgctttggcggtttgtgattcgaaggtgtgtcagcggaggcgccagggcaacacgcactgagccagcc

[0158] aacatgcattgctgccgacatgaatagacacgcgccgagcagacataggagacgtgttgactgtaaaaattctac

[0159] tgaatattagcacgcatggtctcaataagagcaataggaatgcttgccaatcataagtacgtatgtgctttttcctgc

[0160] aaatggtacgtacggacagttcatgttgtctgtcatcccccactcaggctctcatgatcattttatgggactggggttt

[0161] tgctgactgaatggattcagccgcacgaaac

[0162] (3) The nucleotide sequence of the synthesized gene is the brazzein gene fragment of Brazilian sweet as shown in SEQ ID NO.3, and the sequence of the recombinant expression plasmid pPcbh1-Bra is as follows:

[0163] Gacaaatgcaaaaaagtgtacgaaaactacccggtgtccaaatgccagctggcgaaccagtgcaacta

[0164] cgactgcaaactggacaaacacgcgcgctccggcgaatgcttctacgacgaaaaacgcaacctgcagtgcatc

[0165] tgcgactactgcgaatactaa

[0166] (3) The screening marker pyr4 expression cassette sequence with the nucleotide sequence shown in SEQ ID NO.4 was amplified from Trichoderma reesei QM6a as follows:

[0167] Ccccaaagtcgcaatatcgggtatcgccgccggcattgaatcgccttctccgctagcatcgactactgct

[0168] gctctgctctcgttgccagcgctgctccctagaattttgaccaggggacgagcccgacattaaagcaactccctcg

[0169] cctcgagacgactcggatcgcacgaaattctcccaatcgccgacagttcctactcctcttcctcccgcacggctgt

[0170] cgcgcttccaacgtcattcgcacagcagaattgtgccatctctctcttttttttccccccctctaaaccgccacaacg

[0171] gcaccctaagggttaaactatccaaccagccgcagcctcagcctctctcagcctcatcagccatggcaccacac

[0172] ccgacgctcaaggccaccttcgcggccaggagcgagacggcgacgcacccgctgacggcttacctgttcaag

[0173] ctcatggacctcaaggcgtccaacctgtgcctgagcgccgacgtgccgacagcgcgcgagctgctgtacctgg

[0174] ccgacaagattggcccgtcgattgtcgtgctcaagacgcactacgacatggtctcgggctgggacttccacccg

[0175] gagacgggcacgggagcccagctggcgtcgctggcgcgcaagcacggcttcctcatcttcgaggaccgcaag

[0176] tttggcgacattggccacaccgtcgagctgcagtacacgggcgggtcggcgcgcatcatcgactgggcgcaca

[0177] ttgtcaacgtcaacatggtgcccggcaaggcgtcggtggcctcgctggcccagggcgccaagcgctggctcga

[0178] gcgctacccctgcgaggtcaagacgtccgtcaccgtcggcacgcccaccatggactcgtttgacgacgacgcc

[0179] gactccagggacgccgagcccgccggcgccgtcaacggcatgggctccattggcgtcctggacaagcccatc

[0180] tactcgaaccggtccggcgacggccgcaagggcagcatcgtctccatcaccaccgtcacccagcagtacgagt

[0181] ccgtctcctcgccccggttaacaaaggccatcgccgagggcgacgagtcgctcttcccgggcatcgaggaggc

[0182] gccgctgagccgcggcctcctgatcctcgcccaaatgtccagccagggcaacttcatgaacaaggagtacacg

[0183] caggcctgcgtcgaggccgcccgggagcacaaggactttgtcatgggcttcatctcgcaggagacgctcaaca

[0184] ccgagcccgacgatgcctttatccacatgacgcccggctgccagctgccccccgaagacgaggaccagcaga

[0185] ccaacggatcggtcggtggagacggccagggccagcagtacaacacgccgcacaagctgattggcatcgcc

[0186] ggcagcgacattgccattgtgggccggggcatcctcaaggcctcagaccccgtagaggaggcagagcggtac

[0187] cgatcagcagcgtggaaagcctacaccgagaggctgctgcgataggggagggaagggaagaaagaagtaaa

[0188] gaaaggcatttagcaagaagggggaaaagggagggaggacaaacggagctgagaaagagctcttgtccaaa

[0189] gcccggcatcatagaatgcagctgtatttaggcgacctctttttccatcttgtcgatttttgttatgacgtaccagttgg

[0190] gatgatggatgattgtaccccagctgcgattgatgtgtatctttgcatgcaacaacacgcgatggcggaggcgaa

[0191] ctgcacattggaaggttcatatatggtcctgacatatctggtggatctggaagcatggaattgtatttttgatttggcat

[0192] ttgcttttgcgcgtggagggaacatatcaccctcgggcatttttcatttggtaggatggtttggatgcagttg

[0193] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. A recombinant Trichoderma reesei strain producing brasiliensis, It is characterized in that The recombinant Trichoderma reesei strain was named Trichoderma reesei DF230919 and was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on August 9, 2024, with the deposit number CGMCC NO.41488.

2. A recombinant Trichoderma reesei strain producing brasiliensis according to claim 1, It is characterized in that The recombinant Trichoderma reesei strain uses homologous recombination technology to replace the cellobiohydrolase gene cbh1 in Trichoderma reesei with the Brazzein gene, and heterologous expression of the Brazzein protein is performed in the recombinant Trichoderma reesei strain.

3. A recombinant expression plasmid for producing brasilienin, It is characterized in that The recombinant expression plasmid pPcbh1-Bra sequentially comprises a promoter sequence of a cellulase gene, a signal peptide sequence, a gene sequence encoded by brazilian tamarind, and a terminator sequence of a cellulase gene.

4. A recombinant expression plasmid for producing brasilin as claimed in claim 3, It is characterized in that The construction method comprises the following steps: firstly, the Brazzein gene fragment is connected to the backbone fragment of the recombinant expression plasmid vector pPcbh1-Bra by Gibson connection; then, the connection product is transformed into competent Escherichia coli T1, and a single colony is grown after being coated on a solid plate and cultured overnight; finally, primers Vpcbh1-F and VBra-R are designed to perform colony PCR to identify transformants, and the transformants with correct connection are verified by colony PCR, and plasmids are extracted and sent for sequencing. After sequencing is correct, the recombinant expression vector pPcbh1-Bra is obtained; Vpcbh1-F:gtgtggtaggatcgaacac VBra-R: gcagtcgtagttgcactgg.

5. A recombinant expression plasmid for producing brasilin as claimed in claim 4, It is characterized in that The brazzein gene fragment is synthesized from the nucleotide sequence of the brazzein gene with accession number KF013250.1 in Genebank.

6. A recombinant expression plasmid for producing brasilin as claimed in claim 4, It is characterized in that The fragment of the recombinant expression plasmid vector pPcbh1-Bra is as follows: (1) Design primers Gcbh1-UF and Gcbh1-UR to amplify the Pcbh1 sequence using the genome of the wild-type strain QM6a of Trichoderma reesei as a template; Gcbh1-UF: ctatagggagaccggcagcggccgcaaatctacacgtgggcccctttcg Gcbh1-UR:cacttttttgcatttgtcagcacgagctgtggccaag (2) Design primers pyr4-F and pyr4-R to amplify the Trichoderma reesei orotidine-5′-phosphate decarboxylase gene pyr4 using the genome of the wild-type Trichoderma reesei strain QM6a as a template; pyr4-F:ccccaaagtcgcaatatcgggtatcg pyr4-R:caactgcatccaaaccatcc (3) Design primers Gcbh1-DF and Gcbh1-DR to amplify the Tcbh1 sequence using the genome of the wild-type strain QM6a of Trichoderma reesei as a template; Gcbh1-DF: gactactgcgaatactaaagctccgtggcgaaagcctg Gcbh1-DR: gaaaattggagcactgcgaggggccgtttcgtgcggctgaatccattc (4) Design primers GBra-F and GBra-R to amplify the brasiliensis gene sequence using the gene synthesis plasmid as a template; GBra-F:cttggccacagctcgtgctgacaaatgcaaaaaagtg GBra-R: caggctttcgccacggagctttagtattcgcagtagtc (5) Design primers Gbackbone-F and Gbackbone-R, and use pBluescript II SK(+) vector as template to amplify the vector backbone fragment containing the Amp selection marker; Gbackbone-F: gaatggattcagccgcacgaaacggcccctcgcagtgctccaattttc Gbackbone-R: cgaaaggggcccacgtgtagatttgcggccgctgccggtctccctatag.

7. A recombinant expression plasmid for producing brasilin as claimed in claim 6, It is characterized in that After the fragments of the recombinant expression plasmid vector pPcbh1-Bra were amplified, they were subjected to 1% agarose gel electrophoresis and gel recovery was performed respectively. The recovered DNA fragments were dissolved in 20 μL of deionized water and stored at -20°C.

8. A method for constructing a recombinant Trichoderma reesei strain producing brasiliensis according to claim 1 or 2, It is characterized in that Firstly, a recombinant expression plasmid pPcbh1-Bra of the Trichoderma reesei strain was constructed, and then the recombinant expression plasmid was transformed into Trichoderma reesei, and a strain expressing brazilian tamarind protein was obtained by screening.

9. The method for constructing a recombinant Trichoderma reesei strain for producing brasilin according to claim 8, It is characterized in that The following steps are involved: S1. Amplify the promoter and signal peptide sequence of the cellobiohydrolase gene cbh1 as shown in SEQ ID NO.1 and the terminator sequence of the cellobiohydrolase gene cbh1 as shown in SEQ ID NO.2 from Trichoderma reesei QM6a; synthesize the Brazzein gene fragment as shown in SEQ ID NO.3, connect and transform the Brazzein gene fragment with other fragments of the recombinant expression plasmid vector pPcbh1-Bra by Gibson connection, and construct the recombinant expression plasmid pPcbh1-Bra; amplify the screening marker pyr4 expression cassette as shown in SEQ ID NO.4 from Trichoderma reesei QM6a; S2, amplifying the expression cassette containing the cellulase promoter and signal peptide, the brazilian sweet gene, the cellulase terminator and the selection marker pyr4 expression cassette from the recombinant expression plasmid pPcbh1-Bra and transforming it into Trichoderma reesei QM6aΔpyr4 through electroporation; S3. Screen and obtain a recombinant Trichoderma reesei strain that heterologously expresses brasiliensis protein.

10. Use of a recombinant Trichoderma reesei strain producing brasiliensis constructed according to the method of claim 8 or 9 in preparing a product containing brasiliensis.

Images