Method and kit for determining target gene sequence and adjacent sequence thereof in cell and application thereof
The method enhances targeted sequencing by fragmenting and circularizing gDNA with adapters, followed by inverse PCR and bioinformatics, to accurately detect exogenous gene integration sites and adjacent sequences, addressing integration safety concerns in recombinant cells.
Patent Information
- Application Number
- CN202411048576.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-01
- Publication Date
- 2024-12-17
AI Technical Summary
Existing targeted sequencing methods for determining exogenous gene integration in host genomes suffer from insufficient sequencing depth, low accuracy, and inability to detect adjacent sequences accurately, posing risks of integration into proto-oncogenes or tumor suppressor genes.
A method involving fragmentation of gDNA, circularization with adapters, inverse PCR, and bioinformatics analysis to enrich and detect target gene sequences and their adjacent sequences, using a transposon enzyme to ensure accurate distinction between real integration sites and artificially introduced breakpoints.
This method achieves high sensitivity, reduces sequencing bias, shortens experimental cycles, and lowers costs while accurately determining target gene and adjacent sequences, enabling safe integration site assessment in recombinant cells.
Smart Images
Figure HDA0004974215800000011 
Figure HDA0004974215800000021 
Figure HDA0004974215800000022
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of gene sequencing and bioinformatics, and specifically relates to a targeted DNA sequencing method for a target sequence and its adjacent sequences on a cell genome, a kit used in the method for determining a target gene sequence and its adjacent sequences in a cell, and the application of the kit. Background Art
[0002] When inserting exogenous genes into the host genome to establish a cell line that stably expresses the exogenous genes, the exogenous genes are integrated into the genome in a random manner. One of the risks of this integration method is that the exogenous genes may be integrated into the host's proto-oncogenes or tumor suppressor genes, bringing about the risk of tumorigenesis. Therefore, it is necessary to conduct an integration safety assessment on cell lines that have integrated exogenous gene sequences. Efficient and accurate targeted sequencing of exogenous genes can help determine the location and integration of exogenous gene insertions, helping researchers evaluate the safety of integration and monitor possible genetic changes.
[0003] With the advancement of high-throughput sequencing methods, targeted sequencing allows for deeper sequencing of samples at a lower sequencing cost, making targeted sequencing an ideal method for detecting exogenous genes in recombinant cells. The choice of a "target enrichment" strategy is the key to determining the results of targeted sequencing, that is, selectively capturing and / or selectively amplifying the target genomic region from a DNA sample. For the detection of sequences adjacent to the target gene, since the insertion of exogenous genes into the cell genome is random, it is impossible to enrich the sequence of the genomic location where the exogenous sequence is located by conventional PCR amplification.
[0004] In previous studies, linear amplification-mediated PCR (LAM-PCR) combined with high-throughput sequencing is usually used to enrich and detect the integration sites of exogenous sequences, but this method relies on linear amplification, has many amplification rounds, and takes a long time to amplify, which is prone to errors. Another type of probe method enriches the target sequence through a nucleic acid probe that is complementary to the target sequence, but the sequence adjacent to the target gene that can be detected by this method is shorter, and the sensitivity of probe capture cannot reach the level of primer amplification sensitivity. Summary of the invention
[0005] In order to solve the problems of insufficient sequencing depth and low accuracy in the prior art of targeted sequencing, the present invention has established a highly sensitive method for determining the target sequence and its adjacent sequences in cells. Compared with other targeted sequencing methods, the method provided by the present invention can not only determine the sequence of the target gene and its adjacent unknown sequences, but also accurately determine the insertion position and integration site of the exogenous target gene on the host genome, and has the characteristics of high sensitivity, small sequencing bias, convenient operation, short experimental cycle and low cost.
[0006] The technical solution adopted by the present invention is: a method for determining a target gene sequence and its adjacent sequences in a cell, comprising the following steps:
[0007] S1. Fragment the gDNA and connect the circular adapters at both ends of the fragment to obtain fragmented gDNA;
[0008] S2. cyclizing the fragmented gDNA obtained in S1 to obtain circularized gDNA;
[0009] S3. performing inverse PCR on the circularized gDNA obtained in S2 to enrich the target gene sequence and its adjacent sequences to obtain enriched DNA fragments;
[0010] S4. constructing a library and sequencing the enriched DNA fragments obtained in S3 to obtain sequencing data;
[0011] S5 performs bioinformatics analysis on the sequencing data obtained in S4 to obtain analysis results; the analysis results include sequence information, position information, integration site of the target gene, and sequence information of the target gene adjacent sequence.
[0012] In the method provided by the present invention, the fragmented gDNA with the circularized adapter is circularized, and then reverse amplification is performed using primers that hybridize with the target gene sequence. In the case of a known target gene sequence of very little (usually only 200-300bp of sequence information is required), the target gene fragment and its adjacent unknown sequence information within a few kb can be enriched and detected. Further, the present invention can be used to distinguish the integration site that is truly located on the genome from the break site that is artificially introduced by introducing the specific nucleotide sequence of the circularized adapter at both ends of the fragmented gDNA as a breakpoint marker, thereby ensuring the authenticity of the data, thereby accurately identifying the integration site of the target gene on the host genome. In particular, experiments have found that the use of a transposon enzyme (Tn5) that embeds the circularized adapter can ensure that the maximum proportion of the fragmented gDNA ends carry the specific sequence of the circularized adapter, thereby ensuring that the real integration site and the artificially introduced breakpoint are efficiently distinguished during the subsequent bioinformatics analysis process. If other methods are used to break the genomic DNA, such as using endonucleases, ultrasound, Cas enzymes, etc., and then connecting circular adapters, the connection efficiency will not meet the experimental requirements, and the real integration site and the artificially introduced break site cannot be accurately distinguished in the subsequent analysis.
[0013] In terms of technical effects, compared with ordinary PCR amplification sequencing, the method provided by the present invention can detect the information of unknown sequences adjacent to the target gene; compared with LAM-PCR, this method greatly reduces the number of amplification rounds and reduces the error rate caused by PCR; compared with probe capture sequencing, this method can increase the detection range to 10kb around the target nucleotide, and can detect the full length of the target gene without the full sequence information of the target gene, reducing the sequencing bias caused by wide-range probe hybridization. Therefore, compared with the existing technology, this method has the characteristics of high sensitivity, small sequencing bias, convenient operation, short experimental cycle and low cost.
[0014] Specifically, step S1 includes: using a transposon enzyme with an embedded circular adapter to break the gDNA and connect the circular adapters at both ends of the fragments to obtain fragmented gDNA, and purifying the fragmented gDNA with magnetic beads. In this step, the transposon enzyme with an embedded circular adapter completes the operation of genomic DNA fragmentation and binding to the circular adapter in one step, saving operation steps and ensuring that the maximum proportion of fragmented gDNA has circular adapters at both ends, which is conducive to the accurate distinction between the target gene integration site and the artificially introduced breakpoint in the subsequent bioinformatics analysis process.
[0015] More specifically, the length of the fragmented gDNA is not less than 1000 bp. It is understood that the ideal shear length of gDNA is generally not less than 1000 bp, and the technician can appropriately extend the shear length according to the desired target sequence length. It is also understood that when the length of the fragmented gDNA is less than 1000 bp, the fragmented gDNA can still be used to perform subsequent steps.
[0016] More specifically, the transposon enzyme for embedding the circularized linker is preferably TTE mix (Vazyme, TD501).
[0017] More specifically, in S1, the interruption reaction system is preferably: gDNA 2 ul, 5×TTBL (Vazyme, TD501) 10 ul, TTE mix (Vazyme, TD501) 2 ul, Nuclease-free water 36 ul. The interruption reaction procedure is preferably: 55°C 10 min, 4°C forever. It is understandable that the technician can adjust part of the time in the interruption reaction procedure according to the actual reaction requirements.
[0018] Specifically, step S2 includes:
[0019] S2-1. Use T4 PNK to terminally phosphorylate the fragmented gDNA obtained in S1, and purify the phosphorylated product by magnetic beads to obtain phosphorylated fragmented gDNA;
[0020] S2-2. Use T4 DNA ligase to cyclize the fragmented gDNA after S2-1 phosphorylation, and purify the cyclized product by magnetic beads to obtain circularized gDNA.
[0021] To further improve the circularization efficiency in S3, in a preferred embodiment, the fragmented gDNA is first terminally phosphorylated and then circularized, thereby effectively improving the circularization efficiency and facilitating the execution of subsequent steps such as reverse PCR.
[0022] Specifically, step S2 further includes: a pretreatment step, wherein the pretreatment step (denoted as S2-0) includes: performing end-filling and / or amplification on the fragmented gDNA obtained in S1;
[0023] In the pretreatment step, if the fragmented gDNA obtained in step S1 has a flat end, the fragmented gDNA with a flat end can be directly used for the execution of step S2; if the fragmented gDNA obtained in step S1 does not have a flat end, the end is filled flat, and the filled fragmented gDNA is used for the execution of step S2. More specifically, in S2-0, the method for filling the ends of the fragmented gDNA obtained in S1 includes: using a DNA polymerase and a primer hybridized with the circularized linker in S1 to fill the ends of the fragmented gDNA obtained in S1, and purifying the filled product with magnetic beads to obtain the filled fragmented gDNA. The obtained fragmented gDNA is sequentially terminally phosphorylated and circularized to obtain a circularized gDNA. Wherein, the DNA polymerase is preferably Phire Hot Start II DNA polymerase. The flattening system is preferably: fragmented gDNA 20ul, 5×phire buffer 10ul, Phire hot start II DNA polymerase 1ul, 10mM dNTP 1ul, Nuclease-free water 18ul. The flattening procedure is preferably: 72°C 5min. The technician can adjust the duration of the flattening procedure appropriately according to the actual reaction requirements. It is understood that in some embodiments, S2-0 can also use klenow enzyme or T4 DNA polymerase and other methods to flatten the fragmented gDNA obtained in S1.
[0024] In the pretreatment step, in order to increase the total amount of fragmented gDNA and enhance the sensitivity of the experiment, the fragmented gDNA obtained in step S1 can also be amplified, and the end can be filled while amplifying. More specifically, in S2-0, the method for amplifying the fragmented gDNA obtained in S1 includes: using a DNA polymerase and a primer that hybridizes with the circularized linker in S1 to amplify the fragmented gDNA obtained in S1, and purifying the amplified product by magnetic beads to obtain the amplified fragmented gDNA. The obtained fragmented gDNA is terminally phosphorylated and circularized in sequence to obtain circularized gDNA. Among them, the DNA polymerase is preferably Phire Hot Start II DNA polymerase; the primer that hybridizes with the circularized linker in S1 is preferably PrimerN617 (Vazyme TD203), Primer N833 (Vazyme TD203). The amplification system is preferably: fragmented gDNA 20ul, 5×phire buffer 10ul, Phire hot start II DNA polymerase 1ul, 10mM dNTP 1ul, PrimerN617 (Vazyme TD203) 9ul, PrimerN833 (Vazyme TD203) 9ul. The amplification program is preferably: 98℃ 1min; 98℃ 10sec, 60℃ 30sec, 72℃ 2min for 8cycles; 72℃ 3min; 4℃ forever. It is understandable that technicians can adjust part of the time or number of cycles in the amplification program according to actual reaction requirements.
[0025] In the pretreatment step, in order to more efficiently perform end-filling on the fragmented gDNA obtained from S1, and at the same time increase the total amount of fragmented gDNA and enhance the experimental sensitivity, the end-filling and amplification of the fragmented gDNA can be completed in one step in one reaction system. More specifically, in S2-0, the method for performing end-filling and amplification on the fragmented gDNA obtained from S1 includes: pre-treating the fragmented gDNA obtained from S1 using a DNA polymerase and a primer that hybridizes with the circularized linker in S1, purifying the pre-treated product with magnetic beads to obtain amplified fragmented gDNA; terminal phosphorylation and circularization of the pre-treated fragmented gDNA obtained from S2-0 are performed in sequence to obtain circularized gDNA. Among them, the DNA polymerase is preferably Phire Hot Start II DNA polymerase; the primer that hybridizes with the circularized linker in S1 is preferably Primer N617 (Vazyme TD203) and Primer N833 (Vazyme TD203). The pretreatment system is preferably: fragmented gDNA 20ul, 5×phirebuffer 10ul, Phire hot start II DNA polymerase 1ul, 10mM dNTP 1ul, Primer N617 (Vazyme TD203) 9ul, PrimerN833 (Vazyme TD203) 9ul. The pretreatment program is preferably: 72℃5min; 98℃ 1min; 98℃ 10sec, 60℃ 30sec, 72℃ 2min for 8cycles; 72℃ 3min; 4℃ forever. In this pretreatment program, the fragmented gDNA is firstly end-filled using the 72℃ 5min program, and then the subsequent program is executed to amplify the fragmented gDNA after the end-filling. It is understandable that the technician can adjust part of the time or number of cycles in the pretreatment program according to the actual reaction requirements.
[0026] Specifically, step S2 also includes: a post-processing step, and the post-processing step (denoted as S2-3) includes: using an exonuclease to degrade the residual linear DNA fragments in the circularized gDNA obtained in S2.
[0027] In the post-processing step S2-3, technicians can selectively use exonucleases, such as Exonuclease V, to degrade the residual linear DNA in the obtained circularized gDNA to obtain purer circularized DNA. More specifically, in S2-3, the degradation reaction system is preferably: 10×NEBuffer 45 ul, 10mMATP 5ul, 1ul ExonucleaseV (NEB) 1ul. The degradation reaction procedure is preferably: 37°C 30min; 70°C 30min. It is understandable that technicians can adjust part of the time in the degradation reaction procedure according to actual reaction requirements.
[0028] Specifically, step S3 includes: using DNA polymerase and primers hybridized with the target gene sequence to perform reverse PCR on the circularized gDNA obtained in S2, and purifying the reverse PCR product with magnetic beads to obtain enriched DNA fragments. The reaction system of the reverse PCR is preferably: circularized gDNA 36ul, 5×phire reaction buffer 10ul, 10mM-dNTP 1ul, polyphire enzyme 1ul, 10uM-primer-F 1ul, 10uM-primer-R 1ul; the reaction program of the reverse PCR is preferably: 98℃45sec; 98℃10sec, 60℃30sec, 72℃2min for 30cycles; 72℃3min. It is understandable that the technician can adjust part of the time or number of cycles in the reverse PCR reaction program according to the actual reaction requirements.
[0029] Specifically, step S5 includes:
[0030] S5-1. Perform quality control on sequencing data to obtain filtered reads;
[0031] S5-2. Align the filtered reads to the host genome and the target gene reference sequence, respectively, to obtain an alignment result; the alignment result includes sequence information, position information, and sequence information of the target gene adjacent to the target gene;
[0032] S5-3. The filtered reads are screened according to the alignment results obtained in S5-2 to obtain break reads; the break reads have a host end sequence aligned to the host genome and a target end sequence aligned to the target gene reference sequence;
[0033] S5-4. Count the break sites of the break reads obtained in S5-3 on the host genome and the target gene reference sequence to obtain the break site information;
[0034] S5-5. Screening the break reads obtained in S5-3 according to the break site information obtained in S5-4, removing the separated reads, and obtaining valid reads; the separated reads also have a circularized linker, and the host end sequence and the target end sequence of the separated reads are separated by the circularized linker;
[0035] S5-6. The break site information of the valid reads obtained in S5-5 is counted to obtain the number of valid reads with the same break site and use it as the support amount for each break site. The break site whose support amount exceeds the set threshold is determined as the integration site of the target gene.
[0036] More specifically, S5-1 includes: using fastp to perform quality control on the sequencing data to obtain filtered reads. The quality control refers to removing sequencing adapters, low-quality reads, reads with N content greater than a set N% threshold, and reads with sequence lengths exceeding a set length threshold in the sequencing data. Low-quality reads are generally determined by the phred quality value of the reads.
[0037] More specifically, S5-2 includes: using Burrows-Wheeler transform, aligning the filtered reads to the host genome and the target gene reference sequence, and obtaining an alignment bam file as an alignment result.
[0038] More specifically, S5-3 includes: using samtools, according to the alignment results obtained in S5-2, filtering the filtered reads to obtain break reads. The filtered reads that are simultaneously aligned to the target gene reference sequence and the host genome are used as break reads. It is understood that the reference Figure 1 The enriched DNA fragments containing the target gene sequence and its adjacent sequences shown in S3 should have both host end sequence and target end sequence. Some of the fragmented reads will also contain circularized adapters, which can be located in the middle of the host end sequence (refer to Figure 1 The first three enriched DNA fragments in S3), or in the middle of the target end sequence, or between the host end sequence and the target end sequence (reference Figure 1 The last enriched DNA fragment in S3).
[0039] More specifically, S5-4 includes: using R software to count the break sites of the break reads obtained in S5-3 on the host genome and the target gene reference sequence, respectively, to obtain break site information; the break sites include: the host end sequence of the break reads is aligned to the breakpoints at both ends of the host genome, and the target end sequence of the break reads is aligned to the breakpoints at both ends of the target gene reference sequence.
[0040] More specifically, S5-5 includes: using R software, screening the break reads obtained in S5-3 according to the break site information obtained in S5-4, removing the separation reads, and obtaining valid reads. The screened break reads where the circularized linker is located between the host end sequence and the target end sequence (reference Figure 1 The last enriched DNA fragment in S3) is used as the separation reads. It can be understood that the separation reads have a host end sequence, a target end sequence and a circularization linker, and the host end sequence and the target end sequence are separated by the circularization linker. Therefore, at least one break site of the separation reads is close to the circularization linker sequence, thereby affecting the subsequent determination of the true integration site. Therefore, in this step, the separation reads are removed from the break reads, and the remaining break reads are used as valid reads for integration site determination in S5-6.
[0041] More specifically, S5-6 includes: counting the break site information of the valid reads obtained in S5-5, obtaining the number of valid reads with the same break site and using it as the support amount for each break site, and determining the break site with a support amount exceeding 100 valid reads as the integration site of the target gene. It can be understood that S5-6 first counts the integration sites supported by the valid reads: in a specific embodiment, if there are 101 valid reads with the same break site, the support amount of the break site is 101 valid reads; then the integration site of the target gene is determined, and the determination condition is: if the support amount of a certain break site exceeds 100 valid reads, the break site is determined as the integration site of the target gene. That is, in this embodiment, the integration site supported by more than 100 valid reads is a high-confidence integration site, and the above-mentioned break site with a support amount of 101 valid reads meets the determination condition and can be determined as the integration site of the target gene. It is also understandable that technicians can set an appropriate threshold for the support amount according to actual conditions, such as the above-mentioned 100 valid reads, or 50 valid reads, or 150 valid reads, or 200 valid reads.
[0042] Specifically, the method further includes: identifying mutation information within the coverage of the target gene according to the analysis results obtained in S5; the mutation information includes any one of SNP, InDel, and SV. Since the analysis results obtained in S5 include the sequence information of the target gene and the sequence information of the adjacent sequence of the target gene, the technician can identify the mutation information within the coverage of the target gene according to the above analysis results.
[0043] Specifically, the method further includes: according to the analysis results obtained in S5, annotating and analyzing the integration site of the target gene; the content of the annotation analysis includes the distribution of the integration site on the genome and whether the integration site is located in the gene element region. The distribution of the integration site on the genome is analyzed to determine whether the integration site is located near the proto-oncogene / tumor suppressor gene, so that the safety of the recombinant cell can be evaluated. Whether the integration site is located in the gene element region is analyzed to determine whether the integration site is located in the key regions such as the promoter, exon, intron, UTR, etc., so that the genetic stability of the recombinant cell can be evaluated.
[0044] The present invention also provides a kit for determining the target gene sequence and its adjacent sequence in a cell, including a shearing reagent group used in the above method for obtaining fragmented gDNA, a cyclization reagent group used for obtaining cyclized gDNA, an inverse PCR reagent group used for obtaining enriched DNA fragments, and a library construction reagent group for library construction; the shearing reagent group has a Tn5 transposon that embeds a cyclization adapter; the cyclization reagent group has a PCR reagent, a terminal phosphorylation reagent, and a cyclization reagent; the PCR reagent includes a DNA polymerase and a primer that hybridizes with a sequencing adapter; the inverse PCR reagent group has a DNA polymerase and a primer that hybridizes with the target gene sequence; the library construction reagent group matches the Illumina sequencing platform. When the kit is used to determine the target gene sequence and its adjacent sequence in a cell, steps S1 to S4 in the above method are performed to construct the obtained library, and the constructed library is sequenced using the Illumina platform; the obtained sequencing data is subjected to bioinformatics analysis to obtain analysis results; the analysis results include sequence information, position information, integration site of the target gene, and sequence information of the adjacent sequence of the target gene.
[0045] The present invention also provides the use of the above-mentioned kit in detecting the genetic stability of the recombinant cell genome, and the detection content includes: the integration site of the exogenous gene, the average copy number quantification, and the integrity of the exogenous gene. When the kit is used to detect the genetic stability of the recombinant cell genome, steps S1 to S4 in the above-mentioned method are performed to construct the obtained library, and the constructed library is sequenced using the Illumina platform; the obtained sequencing data is subjected to bioinformatics analysis to obtain the analysis results; the analysis results include the sequence information, position information, integration site of the target gene, and the sequence information of the target gene adjacent sequence; according to the analysis results, the integration site of the exogenous gene, the average copy number quantification, and the integrity of the exogenous gene are identified.
[0046] The present invention also provides the use of the above-mentioned kit in the safety assessment of the cell line established by random integration, and the content of the assessment includes: exogenous gene integration site, exogenous gene integration site annotation analysis, and exogenous gene integrity. Wherein, the random integration can be, for example, random integration by lentivirus. When the kit is used to conduct a safety assessment of the cell line established by random integration, steps S1 to S4 in the above-mentioned method are performed to construct the obtained library, and the constructed library is sequenced using the Illumina platform; the obtained sequencing data is subjected to bioinformatics analysis to obtain an analysis result; the analysis result includes the sequence information, position information, integration site of the target gene, and sequence information of the adjacent sequence of the target gene; according to the analysis result, the exogenous gene integration site, exogenous gene integration site annotation analysis, and exogenous gene integrity are identified. The exogenous gene integration site annotation analysis can include the distribution of the integration site on the host genome and whether the integration site is located in the gene element region. The distribution of the integration site on the host genome is analyzed to determine whether the integration site is located near the proto-oncogene / tumor suppressor gene, so that the safety of the recombinant cell can be evaluated. By analyzing whether the integration site is located in the gene element region, it can be determined whether the integration site is located in key regions such as promoters, exons, introns, UTRs, etc., so that the genetic stability of the recombinant cells can be evaluated.
[0047] Beneficial effects of the present invention:
[0048] The present invention establishes a highly sensitive detection method for determining the target gene sequence and its adjacent sequences in cells. Compared with other targeted sequencing methods, the method provided by the present invention can not only determine the sequence of the target gene and its adjacent unknown sequences, but also accurately determine the insertion position and integration site of the exogenous target gene on the host genome, and has the characteristics of high sensitivity, small sequencing bias, convenient operation, short experimental cycle and low cost. This method has broad application prospects in detecting the genetic stability of the recombinant cell genome and conducting safety assessments on cell lines established by random integration. BRIEF DESCRIPTION OF THE DRAWINGS
[0049] Figure 1A schematic diagram of steps S1 to S4 in the method provided by the present invention for determining a target gene sequence and its adjacent sequences in a cell; S1-break gDNA and connect circular adapters at both ends of the fragments to obtain fragmented gDNA; S2-circularize the fragmented gDNA obtained in S1 to obtain circularized gDNA; S3-perform reverse PCR on the circularized gDNA obtained in S2 to enrich the target gene sequence and its adjacent sequences to obtain enriched DNA fragments; S4-construct a library and sequence the enriched DNA fragments obtained in S3 to obtain sequencing data; wherein the specific sequence shown in S1 refers to the circularized adapter.
[0050] Figure 2 This is the coverage of the ADV5 adjacent host sequence on the host genome hg19 measured by targeting the ADV5 gene in Example 1 of the present invention.
[0051] Figure 3 This is the coverage of the integration site chr19:43607304 around the host genome in Example 1 of the present invention.
[0052] Figure 4 This is the coverage of ADV5 on the ADV5 reference genome measured by targeting the ADV5 gene in Example 1 of the present invention. DETAILED DESCRIPTION
[0053] The following is an explanation of the embodiments of the present invention by specific specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied by other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, in the absence of conflict, the features in the following embodiments and embodiments can be combined with each other. In the embodiments of the present invention, the methods used are all conventional methods unless otherwise specified, and the reagents used can be obtained from commercial sources.
[0054] Embodiment 1:
[0055] This embodiment provides a method for determining the target gene sequence and its adjacent sequence in cells, specifically determining the 5' partial sequence of the exogenous inserted sequence ADV5:1-4344 in 293T cells and the host nucleic acid sequence adjacent to its 5' sequence. The cells used are 293T cells, a human embryonic kidney adherent cell line. According to existing literature, the sequence is 5' integrated in the host chr19:43697304.
[0056] In this example, the library construction, sequencing and bioinformatics analysis of the 5' partial sequence of the exogenous insertion sequence ADV5: 1-4344 were performed according to the described method.
[0057] S1-1. Fragmentation of 293T genome and ligation of circular adapters
[0058] Using Tn5 transposon (Vazyme) embedded with circularized adapters, 100ng 293T gDNA was incubated at 55℃ for 10 minutes to shear gDNA and connect sequencing adapters. Specific operation method: In a 200ul PCR tube, the following shearing system was configured: DNA 2ul, 5×TTBL (Vazyme, TD501) 10ul, TTE mix (Vazyme, TD501) 2ul, Nuclease-free water 36ul. After mixing evenly, set the following program on the PCR instrument: incubate at 55℃ for 10min, 4℃ forever.
[0059] S1-2. Use AMPure beads to purify the sheared DNA fragments and obtain the amplified fragmented gDNA
[0060] Remove the PCR tube from the PCR instrument, cool to room temperature, add 25ul AMPure XP beads (Beckman), mix well and incubate at room temperature for 5min; put the PCR tube on the magnetic rack and discard the supernatant; add 200ul freshly prepared 80% ethanol, let stand for 30s, and discard the supernatant; add 200ul freshly prepared 80% ethanol again, let stand for 30s, and discard the supernatant; centrifuge the PCR tube briefly on the centrifuge, put it on the magnetic rack again, and discard the clean supernatant; dry at room temperature for 1min; add 21ul nuclease-free water to the PCR tube, mix well and incubate at room temperature for 5min; aspirate the supernatant to a new PCR tube. Aspirate 1ul and use the 4150 fragment analyzer to detect the size of the main peak of DNA. After detection, the main peak size of DNA after this disruption is 1747bp.
[0061] S2-0-1. Fill in and amplify fragmented gDNA
[0062] The fragmented DNA was amplified using Phire Hot Start II DNA polymerase (Thermo Fisher) and the primer TruePrep Index for illumina (Vazyme) that hybridizes to the circularized adapter.
[0063] The PCR system was as follows: fragmented gDNA 20 ul, 5×phire buffer 10 ul, Polyphire enzyme 1 ul, 10 mM dNTP 1 ul, Primer N617 (Vazyme TD203) 9 ul, Primer N833 (Vazyme TD203) 9 ul.
[0064] The PCR reaction program was as follows: 72°C for 5 min; 98°C for 1 min; 98°C for 10 sec, 60°C for 30 sec, 72°C for 2 min for 8 cycles; 72°C for 3 min; 4°C forever.
[0065] S2-0-2. Use AMPure beads to purify the amplified product and obtain the amplified fragmented gDNA
[0066] Add 25ul AMPure XP beads (Beckman) to the solution after PCR reaction, mix well and incubate at room temperature for 5min; put the PCR tube on a magnetic rack and discard the supernatant; add 200ul freshly prepared 80% ethanol, let it stand for 30s, and discard the supernatant; add 200ul freshly prepared 80% ethanol again, let it stand for 30s, and discard the supernatant; centrifuge the PCR tube briefly on a centrifuge, put it on a magnetic rack again, and discard the supernatant; dry at room temperature for 1min; add 40ul nuclease-free water to the PCR tube, mix well and incubate at room temperature for 5min; aspirate the supernatant into a new 1.5mL EP tube.
[0067] S2-1-1. Phosphorylation of fragmented gDNA after amplification using T4 PNK
[0068] 1ug of purified DNA was subjected to terminal phosphorylation reaction. The specific operation method is to prepare the following phosphorylation reaction system in a 200ul PCR tube: 10×T4 DNA ligase buffer 5ul, T4 PNK (NEB) 2ul, DNA 16.7ul, Nuclease-free water 27.3ul. After mixing evenly, set the reaction program on the PCR instrument at 37℃ for 60min.
[0069] S2-1-2. Use AMPure beads to purify the phosphorylated product and obtain phosphorylated fragmented gDNA
[0070] Add 25ul AMPure XP beads (Beckman) to the solution after phosphorylation reaction, mix well and incubate at room temperature for 5min; put the PCR tube on the magnetic rack and discard the supernatant; add 200ul freshly prepared 80% ethanol, let it stand for 30s, and discard the supernatant; add 200ul freshly prepared 80% ethanol again, let it stand for 30s, and discard the supernatant; centrifuge the PCR tube briefly in a centrifuge, put it on the magnetic rack again, and discard the supernatant; dry at room temperature for 1min; add 175ul nuclease-free water to the PCR tube, mix well and incubate at room temperature for 5min; aspirate the supernatant into a new 200ul PCR tube.
[0071] S2-2-1. Circularization of phosphorylated fragmented gDNA using T4 DNAligase
[0072] Prepare 200ul of circularization system as follows: 175ul DNA, 5ul T4 DNAligase, 20ul 10×T4 DNAligation buffer. Place the sample at 16°C for circularization overnight.
[0073] S2-2-2. Purification of cyclized products using AMPure beads
[0074] Add 140ul AMPure XP beads (Beckman) to the solution after the cyclization reaction, mix well and incubate at room temperature for 5min; put the PCR tube on a magnetic rack and discard the supernatant; add 200ul freshly prepared 80% ethanol, let it stand for 30s, and discard the supernatant; add 200ul freshly prepared 80% ethanol again, let it stand for 30s, and discard the supernatant; centrifuge the PCR tube briefly on a centrifuge, put it on a magnetic rack again, and discard the supernatant; dry at room temperature for 1min; add 39ul nuclease-free water to the PCR tube, mix well and incubate at room temperature for 5min; aspirate the supernatant into a new 200ul PCR tube.
[0075] S2-3-1. Use exonuclease to degrade the residual linear DNA fragments in the circularized gDNA
[0076] Add exonuclease degradation mix to the 39ul DNA solution in S2-3-2. The exonuclease degradation mix is as follows: 45ul 10×NEBuffer, 5ul 10mMATP, 1ul Exonuclease V (NEB) 1ul. Place the sample on the PCR instrument. The reaction conditions are: 37℃ 30min; 70℃ 30min.
[0077] S2-3-2. Use AMPure beads to purify the circularized product after exonuclease degradation to obtain circularized gDNA
[0078] Add 35ul AMPure XP beads (Beckman) to the solution after the degradation reaction, mix well and incubate at room temperature for 5min; put the PCR tube on a magnetic rack and discard the supernatant; add 200ul freshly prepared 80% ethanol, let it stand for 30s, and discard the supernatant; add 200ul freshly prepared 80% ethanol again, let it stand for 30s, and discard the supernatant; centrifuge the PCR tube briefly in a centrifuge, put it on a magnetic rack again, and discard the supernatant; dry at room temperature for 1min; add 36ul nuclease-free water to the PCR tube, mix well and incubate at room temperature for 5min; aspirate the supernatant into a new 200ul PCR tube.
[0079] S3-1. Perform inverse PCR on circularized gDNA to enrich the target gene sequence and its adjacent sequences
[0080] Inverse PCR was performed using Phire Hot Start II DNA polymerase and reverse primers primer-F and primer-R that hybridize to the target nucleotide to amplify the target nucleotide sequence and the sequence of the adjacent host region.
[0081] The primer sequences used for reverse amplification of the target are as follows:
[0082] primer-F:CGTCACTTTTGCCACATCCG
[0083] primer-R:CCGAAGATCCCAACGAGGGAG
[0084] Reverse PCR reaction system: DNA 36ul, 5×phire reaction buffer 10ul, dNTP (10mM) 1ul, polyphire enzyme 1ul, primer-F (10uM) 1ul, primer-R (10uM) 1ul.
[0085] Set the reaction program on the PCR instrument: 98℃ 45sec; 98℃ 10sec, 60℃ 30sec, 72℃ 2minfor 30cycles; 72℃ 3min; 4℃ forever.
[0086] S3-2. Use AMPure beads to purify the inverse PCR product and obtain enriched DNA fragments
[0087] Add 25ul AMPure XP beads (Beckman) to the solution after the reverse PCR reaction, mix well and incubate at room temperature for 5min; put the PCR tube on a magnetic rack and discard the supernatant; add 200ul freshly prepared 80% ethanol, let it stand for 30s, and discard the supernatant; add 200ul freshly prepared 80% ethanol again, let it stand for 30s, and discard the supernatant; centrifuge the PCR tube briefly in a centrifuge, put it on a magnetic rack again, and discard the supernatant; dry at room temperature for 1min; add 20ul nuclease-free water to the PCR tube, mix well and incubate at room temperature for 5min; aspirate the supernatant into a new 200ul PCR tube.
[0088] S4-1. Library construction of the obtained enriched DNA fragments
[0089] The TruePrep DNA Library Prep Kit V2 for Illumina was used to construct the next-generation sequencing library of the enriched DNA fragments, and the library construction steps were carried out in full accordance with the instructions of the kit.
[0090] S4-2. Sequence the constructed library to obtain sequencing data
[0091] The constructed library was sequenced using Illumina Novaseq 6000.
[0092] S5. Perform bioinformatics analysis on the obtained sequencing data to obtain analysis results
[0093] S5-1: Use fastp to perform quality control on the sequencing data to obtain filtered reads. The quality control refers to removing sequencing adapters, low-quality reads, reads with N content greater than a set N% threshold, and reads with sequence lengths exceeding a set length threshold in the sequencing data. Low-quality reads are determined by the phred quality value of the reads.
[0094] S5-2: Using Burrows-Wheeler transform, filter reads were aligned to the human reference genome hg19 and the target gene reference genome AC_000008.1, and the alignment bam file was obtained as the alignment result.
[0095] S5-3: Using samtools, filter the filtered reads according to the alignment results obtained in S5-2 to obtain the break reads. The filtered reads that are simultaneously aligned to the target gene reference sequence and the host genome are used as the break reads. Figure 1 The enriched DNA fragments containing the target gene sequence and its adjacent sequences shown in S3 should have both the host end sequence and the target end sequence. Some of the fragmented reads also have circularized adapters, and the circularized adapters can be located in the middle of the host end sequence (refer to Figure 1 The first three enriched DNA fragments in S3), or in the middle of the target end sequence, or between the host end sequence and the target end sequence (reference Figure 1 The last enriched DNA fragment in S3).
[0096] S5-4: Using R software, the breakpoints of the break reads obtained in S5-3 on the host genome and the target gene reference sequence are counted to obtain the breakpoint information; the breakpoints include: the host end sequence of the break reads is aligned to the breakpoints at both ends of the host genome, and the target end sequence of the break reads is aligned to the breakpoints at both ends of the target gene reference sequence.
[0097] S5-5: Use R software to filter the break reads obtained in S5-3 according to the break site information obtained in S5-4, remove the separation reads, and obtain valid reads. Figure 1 The last enriched DNA fragment in S3) is used as the separation read. In this embodiment, the circularized adapter sequence is 5'-AGATGTGTATAAGAGACAG-3'. The separation read is removed from the break reads, and the remaining break reads are used as valid reads for integration site determination in S5-6.
[0098] S5-6: Statistics are performed on the break site information of the valid reads obtained in S5-5, and the number of valid reads with the same break site is obtained as the support amount of each break site, and the break site with a support amount exceeding 100 valid reads is determined as the integration site of the target gene. It can be understood that S5-6 first counts the integration sites supported by the valid reads: in this embodiment, there are 101 valid reads with the same break site, and the support amount of the break site is 101 valid reads; then the integration site of the target gene is determined, and the determination condition is: if the support amount of a certain break site exceeds 100 valid reads, the break site is determined as the integration site of the target gene. That is, in this embodiment, the integration site supported by more than 100 valid reads is a high-confidence integration site, and the above-mentioned break site with a support amount of 101 valid reads meets the determination condition and can be determined as the integration site of the target gene.
[0099] S6. Based on the analysis results obtained in S5, use bcftools software to identify mutation information within the coverage of the target gene; the mutation information includes any one of SNP, InDel, and SV. Since the analysis results obtained in S5 include the sequence information of the target gene and the sequence information of the target gene adjacent sequence, the technician can identify the mutation information within the coverage of the target gene based on the above analysis results.
[0100]
Result Analysis
[0101] The sequence specificity measured using this method is high, and the depth at the target is more than 5000 times that of the non-target area. Figure 2 The coverage of ADV5 adjacent host sequences on the genome measured by targeting the ADV5 gene is shown, and the results show that the integration position of the ADV5 gene in the host is located on chromosome chr19.
[0102] Through further bioinformatics analysis, the integration site of the ADV5 gene 5' was found to be located at the host chr19:43607304, connected to the ADV5:1 base. Table 1 shows the specific integration position information of the ADV5 gene 5' on the host and the number of chimeric reads supporting the integration event. The results show that the ADV5 gene 5' base 1 is connected to the host chr19:43607304 base, which is consistent with the results of the literature and verified by Sanger sequencing.
[0103] Table 1. Integration position of the 5' ADV5 gene identified in Example 1 on the host
[0104] Fusionsite Readscount chr19:43697304-AC_000008.1:1 43082
[0105] This method improves the accuracy of the detection results by sequencing the target sequence at an extremely deep depth. Figure 3 The signal coverage near the integration site chr19:43607304 is shown. In this result, the region near the integration site with a sequencing depth greater than 500× is 1469bp (chr19:43697304-chr19:43698773), and the region with a sequencing depth greater than 1000× is 1318bp (chr19:43697304-43698622). Figure 4 The coverage of the ADV5 gene identified this time in the ADV5 reference genome (AC_000008.1) is shown. In the experimental results, there are 1754bp (ADV5: 1-169, ADV5: 726-2311) in the region with a sequencing depth of >500× on the target ADV5, and 1264bp (ADV5: 1-169, ADV5: 728-1823) in the region with a sequencing depth of >5000×.
[0106] Based on the obtained analysis results, bcftools software was used to identify mutation information within the coverage range of the target gene; no mutation SNV / InDel was found in the mutation analysis of this experiment.
[0107] In one embodiment of the present invention, a kit for determining the exogenous target gene sequence and its integration site in a recombinant cell is also provided, which is used to perform steps S1 to S4 in the method of Example 1, specifically including: a shearing reagent group for obtaining fragmented gDNA, a cyclization reagent group for obtaining cyclized gDNA, a reverse PCR reagent group for obtaining enriched DNA fragments, and a library construction reagent group for library construction. The shearing reagent group has a Tn5 transposon with a cyclization adapter embedded; the cyclization reagent group has a PCR reagent, a terminal phosphorylation reagent, and a cyclization reagent; the PCR reagent includes a DNA polymerase and a primer that hybridizes with a sequencing adapter; the reverse PCR reagent group has a DNA polymerase and a primer that hybridizes with a target gene sequence; and the library construction reagent group matches the Illumina sequencing platform. When the kit is used to determine the exogenous target gene sequence and its integration site in the recombinant cell, steps S1 to S4 in the above method are performed to construct a library, and the constructed library is sequenced using the Illumina platform; bioinformatics analysis is performed on the obtained sequencing data to obtain analysis results; the analysis results include sequence information, position information, integration site of the target gene, and sequence information of the target gene adjacent sequence.
[0108] In one embodiment of the present invention, the application of the above-mentioned kit in detecting the genetic stability of the genome of a recombinant cell is also provided, and the contents of the detection include: the integration site of the exogenous gene, the quantification of the average copy number, and the integrity of the exogenous gene. When the kit is used to detect the genetic stability of the genome of a recombinant cell, steps S1 to S4 in the above-mentioned method are performed to construct the obtained library, and the constructed library is sequenced using the Illumina platform; the obtained sequencing data is subjected to bioinformatics analysis to obtain the analysis results; the analysis results include the sequence information, position information, and integration site of the target gene, as well as the sequence information of the target gene adjacent sequence; according to the analysis results, the integration site of the exogenous gene, the quantification of the average copy number, and the integrity of the exogenous gene are identified. For specific application methods, refer to the method provided in Example 1.
[0109] The present invention also provides the use of the above-mentioned kit in the safety assessment of cell lines established by random integration of lentivirus, and the content of the assessment includes: exogenous gene integration site and exogenous gene integrity. When the kit is used to conduct a safety assessment of a cell line established by random integration of lentivirus, steps S1 to S4 in the above-mentioned method are performed to construct a library, and the constructed library is sequenced using the Illumina platform; the obtained sequencing data is subjected to bioinformatics analysis to obtain analysis results; the analysis results include sequence information, position information, integration site of the target gene, and sequence information of the target gene adjacent sequence; according to the analysis results, the exogenous gene integration site and exogenous gene integrity are identified. For specific application methods, refer to the method provided in Example 1.
[0110] The embodiments described above are merely descriptions of preferred implementation modes of the present invention and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope of the present invention.
Claims
1. A method for determining a target gene sequence and its adjacent sequences in a cell, characterized in that: The steps include: S1. Fragment the gDNA and connect the circular adapters at both ends of the fragment to obtain fragmented gDNA; S2. cyclizing the fragmented gDNA obtained in S1 to obtain circularized gDNA; S3. performing inverse PCR on the circularized gDNA obtained in S2 to enrich the target gene sequence and its adjacent sequences to obtain enriched DNA fragments; S4. constructing a library and sequencing the enriched DNA fragments obtained in S3 to obtain sequencing data; S5 performs bioinformatics analysis on the sequencing data obtained in S4 to obtain analysis results; the analysis results include sequence information, position information, integration site of the target gene, and sequence information of the target gene adjacent sequence.
2. The method according to claim 1, characterized in that Step S1 includes: The gDNA is sheared using a transposon enzyme that embeds a circularized adapter and the circularized adapters are connected at both ends of the fragment to obtain fragmented gDNA, which is then purified by magnetic beads.
3. The method according to claim 1, characterized in that Step S2 includes: S2-1. Use T4 PNK to terminally phosphorylate the fragmented gDNA obtained in S1, and purify the phosphorylated product by magnetic beads to obtain phosphorylated fragmented gDNA; S2-2. Use T4 DNA ligase to cyclize the fragmented gDNA after S2-1 phosphorylation, and purify the cyclized product by magnetic beads to obtain circularized gDNA.
4. The method according to claim 1, characterized in that Step S2 also includes: A pretreatment step, the pretreatment step comprising: performing end-filling and / or amplification on the fragmented gDNA obtained in S1; and / or, A post-processing step, comprising: using an exonuclease to degrade the residual linear DNA fragments in the circularized gDNA obtained in S2.
5. The method according to claim 1, characterized in that Step S3 includes: The circularized gDNA obtained from S2 is subjected to inverse PCR using DNA polymerase and primers that hybridize to the target gene sequence, and the inverse PCR product is purified by magnetic beads to obtain enriched DNA fragments.
6. The method according to claim 1, characterized in that Step S5 includes: S5-1. Perform quality control on sequencing data to obtain filtered reads; S5-2. Align the filtered reads to the host genome and the target gene reference sequence, respectively, to obtain an alignment result; the alignment result includes sequence information, position information, and sequence information of the target gene adjacent to the target gene; S5-3. The filtered reads are screened according to the alignment results obtained in S5-2 to obtain break reads; the break reads have a host end sequence aligned to the host genome and a target end sequence aligned to the target gene reference sequence; S5-4. Count the break sites of the break reads obtained in S5-3 on the host genome and the target gene reference sequence to obtain the break site information; S5-5. Screening the break reads obtained in S5-3 according to the break site information obtained in S5-4, removing the separated reads, and obtaining valid reads; the separated reads also have a circularized linker, and the host end sequence and the target end sequence of the separated reads are separated by the circularized linker; S5-6. The break site information of the valid reads obtained in S5-5 is counted to obtain the number of valid reads with the same break site and use it as the support amount for each break site. The break site whose support amount exceeds the set threshold is determined as the integration site of the target gene.
7. The method according to claim 1, characterized in that The method further comprises: According to the analysis results obtained in S5, identifying the mutation information within the coverage range of the target gene; the mutation information includes any one of SNP, InDel, and SV; and / or, According to the analysis results obtained in S5, the integration site of the target gene is annotated and analyzed; the content of the annotation analysis includes the distribution of the integration site on the genome and whether the integration site is located in the gene element region.
8. A kit for determining a target gene sequence and its adjacent sequences in a cell, characterized in that: The method comprises a shearing reagent set for obtaining fragmented gDNA, a circularization reagent set for obtaining circularized gDNA, an inverse PCR reagent set for obtaining enriched DNA fragments, and a library construction reagent set for library construction used in the method according to any one of claims 1 to 7; The disruption reagent set has a Tn5 transposon that embeds a circularized linker; The cyclization reagent group comprises a PCR reagent, a terminal phosphorylation reagent, and a cyclization reagent; the PCR reagent comprises a DNA polymerase and a primer hybridized with a sequencing adapter; The inverse PCR reagent set comprises a DNA polymerase and primers that hybridize with the target gene sequence; The library construction reagent set is compatible with the Illumina sequencing platform.
9. Use of the kit according to claim 8 in detecting the genetic stability of a recombinant cell genome, characterized in that: The detection contents include: exogenous gene integration site, average copy number quantification, and exogenous gene integrity.
10. Use of the kit according to claim 8 in safety assessment of a cell line established by random integration, characterized in that: The evaluation contents include: exogenous gene integration site, exogenous gene integration site annotation analysis, and exogenous gene integrity.