Molecular markers, primer combinations and application of the major spike length gene QS1-YB.saas-4B in wheat large-spike germplasm YB
By developing KASP molecular markers, the problem that the excellent allele QSl-YB.saas-4B in wheat large ear germplasm YB cannot be rapidly and efficiently identified, achieving efficient detection of this gene and improving breeding efficiency.
Patent Information
- Application Number
- CN202411690366.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-25
- Publication Date
- 2025-02-28
- Estimated Expiration
- 2044-11-25
AI Technical Summary
The prior art cannot rapidly and efficiently identify the excellent allele QS1-YB.saas-4B in wheat large ear germplasm YB, limiting the utilization of this gene in wheat yield breeding.
Two pairs of KASP-specific linkage markers were developed, and genetic maps were constructed using wheat 16K SNP chip data and QTL IciMapping 4.2 software, and QSl-YB.saas-4B is located in the 42.9~46.4Mb interval of 4B chromosome, and two pairs of closely linked KASP molecular markers, KASP-4B-442201 and KASP-4B-457515, were designed.
The efficient and accurate detection of the main-effect gene of wheat ear growth QSl-YB.saas-4B is achieved, which improves breeding efficiency and has important practical significance in the molecular marker assisted selection breeding of ear growth genes.
Smart Images
Figure 00000000_0000_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of wheat gene detection, and specifically relates to a molecular marker, a primer combination and an application of a major gene QS1-YB.saas-4B of wheat large-spike germplasm YB spike length. Background Art
[0002] As one of the three major crops in the world, wheat provides about 20% of the world's population's energy intake and an important source of protein. Cultivating high-yield wheat varieties and continuously improving wheat yields are one of the important measures to ensure food security. The ear traits of wheat play a vital role in its yield regulation and have always received great attention. The three elements of wheat yield, the number of ears per unit area, the number of grains per ear, and the thousand-grain weight are all related to the ear traits. The ear length trait is a quantitative trait and is one of the important traits that affect the yield of a single plant. However, it is less sensitive to the environment and has a higher heritability than yield. Therefore, identifying, verifying, and cloning quantitative trait loci (QTLs) or genes related to ear length are of great significance for analyzing their genetic mechanisms and breeding high-yield wheat.
[0003] With the development of gene sequencing technology, plant genome data is becoming more and more abundant. Single nucleotide polymorphism (SNP) data is widely used in the development and application of molecular markers due to its high density, high throughput and easy automated analysis. Competitive allele-specific polymerase chain reaction (KASP) is a new genotyping technology based on single nucleotide polymorphism (SNP), which can accurately type SNP and insertion and deletion polymorphism (Indel) at the genome level. Due to its advantages of high throughput, low cost and strong operability, it has great application potential in the fields of crop trait improvement. KASP genotyping technology can be used for the precise positioning of candidate genes, as well as the rapid identification and screening of individuals carrying target functional genes in the early generations of breeding or primary selection populations, eliminating unnecessary strains, reducing the size of breeding populations, and significantly reducing breeding costs and improving breeding efficiency.
[0004] The wheat large-spike germplasm YB has the characteristics of long spike length (20cm) and grain weight per spike (4.40g), etc. Through genetic positioning, a major gene for wheat spike length was located from the large-spike germplasm YB, which is located on the short arm of chromosome 4B and named QSl-YB.saas-4B. At present, there is no report on molecular markers related to the excellent gene QSl-YB.saas-4B, and it is impossible to achieve rapid and efficient molecular identification of the excellent allele QSl-YB.saas-4B from the wheat large-spike germplasm YB, which greatly limits the use of this excellent gene locus in wheat yield breeding. Summary of the invention
[0005] The purpose of the present invention is to provide a molecular marker, primer combination and application of a major gene QS1-YB.saas-4B for ear length in wheat large-ear germplasm YB.
[0006] To achieve the above object, the present invention adopts the following technical solution:
[0007] A molecular marker of a major gene QS1-YB.saas-4B for spike length in wheat germplasm YB, wherein the major gene QS1-YB.saas-4B for spike length in wheat germplasm YB is located in the 42.9-46.4Mb interval on the long arm of chromosome 4B; the molecular marker is developed by using two pairs of KASP-specific linkage markers using SNP probes on both wings of the major gene QS1-YB.saas-4B for spike length in wheat germplasm YB, wherein the probes are probe sequence 4B-442201 of nucleotide sequence such as SEQ ID NO.1 and probe sequence 4B-457515 of nucleotide sequence such as SEQ ID NO.2;
[0008] The linkage markers are KASP marker KASP-4B-442201 and KASP marker KASP-4B-457515.
[0009] The invention constructs a genetic map using QTL IciMapping 4.2 software based on wheat 16K SNP chip data, locates QTL sites related to the spike length trait in combination with spike length phenotypic data of a population, locates the major spike length gene QS1-YB.saas-4B on the short arm of chromosome 4B, develops molecular markers for the obtained polymorphic SNP sites, and finally obtains two pairs of KASP molecular markers closely linked to QS1-YB.saas-4B, including KASP-4B-442201 and KASP-4B-457515.
[0010] A primer combination of a KASP molecular marker linked to the major effect gene QS1-YB.saas-4B of wheat large-ear germplasm YB spike length, the primer combination is a KASP-4B-442201 primer set and a KASP-4B-457515 primer set;
[0011] The KASP-4B-442201 primer set includes KASP-4B-442201F1 having a nucleotide sequence as shown in SEQ ID NO.3, KASP-4B-442201F2 having a nucleotide sequence as shown in SEQ ID NO.4, and KASP-4B-442201C having a nucleotide sequence as shown in SEQ ID NO.5;
[0012] The KASP-4B-457515 primer set includes KASP-4B-457515F1 with a nucleotide sequence as shown in SEQ ID NO.8, KASP-4B-457515F2 with a nucleotide sequence as shown in SEQ ID NO.9, and KASP-4B-457515C with a nucleotide sequence as shown in SEQ ID NO.10.
[0013] Furthermore, a FAM fluorescent label sequence is added to the 5' end of the KASP-4B-442201F1, and a HEX fluorescent label sequence is added to the 5' end of the KASP-4B-442201F2; a FAM fluorescent label sequence is added to the 5' end of the KASP-4B-457515F1, and a HEX fluorescent label sequence is added to the 5' end of the KASP-4B-457515F2.
[0014] The beneficial effects of the present invention are as follows: a KASP molecular marker KASP-4B-442201 and KASP-4B-457515 which are closely linked to the major effect gene QSl-YB.saas-4B of wheat large-ear germplasm YB spike length are developed, which can not only efficiently and accurately detect wheat strains containing the major effect gene QSl-YB.saas-4B of wheat spike length, but also can be used for high-throughput molecular marker-assisted selection, effectively improving breeding efficiency and serving the molecular breeding of wheat yield; and the present invention has important practical significance in molecular marker-assisted selection breeding of spike length gene. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 The spike length gene QSl-YB.saas-4B was located in the F9 population of the recombinant inbred line between the large-spike germplasm YB and Sichuan wheat 62.
[0016] Figure 2 This is the genotype diagram of the parent Chuanmai 62, large-ear germplasm YB and its F9 generation population detected by the KASP molecular marker KASP-4B-442201 of the present invention.
[0017] Figure 3 This is the genotype diagram of the parent Chuanmai 62, large-ear germplasm YB and its F9 generation population detected by the KASP molecular marker KASP-4B-457515 of the present invention.
[0018] Marks in the figure: 1, indicates the typing consistent with the large-spiked germplasm YB; 2, indicates the typing consistent with Chuanmai 62; 3, indicates gene heterozygosity; 4, indicates blank control. DETAILED DESCRIPTION
[0019] Example 1
[0020] The major gene QSl-YB.saas-4B for spike length in wheat large-spike germplasm YB is a major QTL locus related to wheat spike length and is located on chromosome 4B.
[0021] 1. Test materials
[0022] The multi-spike wheat variety Chuanmai 62 was used as the female parent and the large-spike germplasm YB was used as the male parent to obtain the first-generation hybrid variety F1. The F1 generation was self-pollinated to obtain the F2 generation, which was then passed to the F9 generation using the single-grain method. A recombinant inbred line containing 172 individuals was obtained to form a genetic mapping population.
[0023] 2. Phenotypic identification of ear length and grain weight per ear
[0024] The field was sown in a single row area with a row length of 1.5m and a row width of 30cm, with 20 seeds sown in each row. Field management and disease control were carried out according to local routine management methods.
[0025] The experiment adopted a completely randomized block design, with 2 replicates in each block. Eight plants with the same growth were selected in the late grain filling period to identify the ear length, which included the range from the base of the spike axis to the top spikelet, excluding the awn. After the wheat matured, eight plants with the same growth were selected from each strain to collect single ears, which were weighed after threshing and the grain weight per ear was identified.
[0026] 3. Wheat 16K SNP chip analysis
[0027] The DNA of the parent Chuanmai 62, large spike germplasm YB and recombinant inbred line F9 population was extracted using a plant DNA extraction kit (DP350-03, Tiangen Biochemical Technology (Beijing) Co., Ltd.); the samples were sent to the company for genotype analysis. In this example, the genotype analysis of the parent and mapping population was completed by Shijiazhuang Boredi Biotechnology Co., Ltd. A genetic map was constructed using QTL IciMapping 4.2 based on the wheat 16KSNP chip typing data.
[0028] Combined with the spike length phenotypic data of the population, the Inclusive Composite Interval Mapping-ADD (ICIM-ADD) method in QTL IciMapping 4.2 was used to detect QTL in 4 environments from 2023 to 2024 under the condition of setting the threshold LOD ≥ 3, and the wheat spike length trait-related locus QSl-YB.saas-4B was located. Figure 1 As shown, the marker interval where the QTL peak is located is X-4B-442201~X-4B-457515, which corresponds to the physical position of the Chinese Spring genome in the interval of 42.9~46.4Mb.
[0029] 4. Linkage marker of major gene QS1-YB.saas-4B in wheat large-ear germplasm YB spike length
[0030] The positioning results of wheat 16K SNP chip data were used to design KASP molecular markers according to the polymorphic sites marked by SNPs, and the primer specificity was detected using the Ensembl Plants website (https: / / plants.ensembl.org / ).
[0031] The KASP marker was used to perform KASP amplification reaction on the genomic DNA of Chuanmai 62, large-spike germplasm YB and recombinant inbred line F9 population, and the materials could be clearly typed. The two molecular markers were named KASP-4B-442201 and KASP-4B-457515, respectively; KASP-4B-442201 and KASP-4B-457515 were designed according to the probe sequences of 4B-442201 and 4B-457515, respectively.
[0032] The nucleotide sequence of 4B-442201 (SEQ ID NO.1):
[0033] 5'-CTCCACTCATACTTCTACTCTTTTTACACAACGCCATGAATCAGAGGTGGTCGGATGGAGGAGCCGGGTCACGGTAGATCATAGGAGATAGAAGGCTCGT[T / C]GTATACGAAGTGAATGGGAAGGTTGTAGAGGCAGGATAGGACACGACAAGATGTGATCCGGTGTTCCTCCTACCTTTTGTACGAGAGGATGCACAGTGCC-3'.
[0034] The nucleotide sequence of 4B-457515 (SEQ ID NO.2):
[0035] 5'-TTACACACAAAAAACCCTAGTGGGGTGGGTGGACCTGCTACCTAACAGCAAATTCTACTAAGTCATAAACAGGAAGGACGGCCTCAGGCATCTCCGGCTTC[G / A]GGCCGCGAAGTCGACGGCTCCCCTACGACGGCTCCGGGTCTGCCGAAGTACGGGTGTCCTCCTCGGTGCCCTGGCACGGTAGACCCCTGTCTCCTCGGA-3'.
[0036] The KASP molecular marker primer set of KASP-4B-442201 includes three primers, namely: KASP-4B-442201F1, KASP-4B-442201F2 and KASP-4B-442201C; the fluorescent primer sets used to amplify the KASP-4B-442201 marker are: KASP-4B-442201F1-FAM, KASP-4B-442201F2-HEX and KASP-4B-442201C.
[0037] Nucleotide sequence of KASP-4B-442201F1 (SEQ ID NO.3):
[0038] 5'-tcataggagatagaaggctcgtT-3';
[0039] Nucleotide sequence of KASP-4B-442201F2 (SEQ ID NO.4):
[0040] 5'-tcataggagatagaaggctcgtC-3';
[0041] KASP-4B-442201 (SEQ ID NO. 5, shared downstream primer C):
[0042] 5′-cctgcctctacaaccttccc-3′.
[0043] Fluorescent tags were then added to the 5' ends of KASP-4B-442201F1 and KASP-4B-442201F2, namely KASP-4B-442201F1-FAM and KASP-4B-442201F2-HEX.
[0044] The nucleotide sequence of KASP-4B-442201F1-FAM (SEQ ID NO.6):
[0045] 5'-GAAGGTGACCAAGTTCATGCTtcataggagatagaaggctcgtT-3';
[0046] Nucleotide sequence of KASP-4B-442201F2-HEX (SEQ ID NO.7):
[0047] 5'-GAAGGTCGGAGTCAACGGATTtcataggagatagaaggctcgtC-3'.
[0048] The KASP molecular marker primer set of 4B-457515 includes three primers, namely: KASP-4B-457515F1, KASP-4B-457515F2 and 4B-457515C;
[0049] Nucleotide sequence of KASP-4B-457515F1 (SEQ ID NO.8):
[0050] 5′-caggcatctccggcttcG-3′;
[0051] Nucleotide sequence of KASP-4B-457515F2 (SEQ ID NO.9):
[0052] 5′-caggcatctccggcttcA-3′;
[0053] KASP-4B-457515 (SEQ ID NO.10, shared downstream primer C):
[0054] 5′-gaggaggacacccgtacttc-3′.
[0055] Then, fluorescent tags were added to the 5' ends of KASP-4B-457515F1 and KASP-4B-457515F2, namely KASP-4B-457515F1-FAM and KASP-4B-457515F2-HEX.
[0056] Nucleotide sequence of KASP-4B-457515F1-FAM (SEQ ID NO.11):
[0057] 5'-GAAGGTGACCAAGTTCATGCT caggcatctccggcttcG-3';
[0058] Nucleotide sequence of KASP-4B-457515F2-HEX (SEQ ID NO.12):
[0059] 5'-GAAGGTCGGAGTCAACGGATT caggcatctccggcttcA-3'.
[0060] Example 2
[0061] The present embodiment provides a method for screening the major gene QSl-YB.saas-4B for wheat ear length, comprising: using the genomic DNA of the plant sample to be tested as a template, performing fluorescent quantitative PCR amplification on the template using a primer set of a molecular marker linked to the wheat ear length gene QSl-YB.saas-4B; and performing genotyping using the amplification results.
[0062] The PCR amplification system of the primers for KASP-4B-442201 and KASP-4B-457515 was the same. The PCR amplification system was: 5 μL 2×Master Mix (LGC), 0.04 μL upstream primer FAM, 0.04 μL upstream primer HEX, 0.08 μL universal primer COM, 5 μL DNA template, and ultrapure water added to 10 μL.
[0063] The PCR amplification procedure is as follows:
[0064] (1) Pre-denaturation at 94°C for 15 min;
[0065] (2) denaturation at 94°C for 20 s, annealing and extension at 61-55°C for 60 s, 10 cycles, with the annealing and extension temperature lowered by 0.6°C in each cycle;
[0066] (3) Denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, for 30 cycles.
[0067] (4) Read the fluorescence signal at 30°C for 30 s.
[0068] The genotype diagram of the KASP molecular marker KASP-4B-442201 provided in this example for detecting the parent Chuanmai 62, the wheat large-ear germplasm YB and the recombinant inbred line F9 population is shown in FIG. Figure 2 As shown, the genotyping diagram of the KASP molecular marker KASP-4B-457515 provided in the embodiment of the present invention for detecting the parent Chuanmai 62, the wheat large-ear germplasm YB and the recombinant inbred line F9 population is shown in FIG. Figure 3 shown.
[0069] PCR amplification results, genotyping: 1 indicates the same typing as the large-spiked germplasm YB; 2 indicates the same typing as Chuanmai 62; 3 indicates genetic heterozygosity; 4 indicates blank control.
[0070] This example provides an application of a KASP molecular marker linked to the major effect gene QS1-YB.saas-4B of spike length in wheat large spike germplasm YB. KASP molecular markers KASP-4B-442201 and KASP-4B-457515 linked to the QS1-YB.saas-4B segment were used to detect KASP markers in 172 recombinant inbred lines obtained by hybridization and selection of Chuanmai 62 and large spike germplasm YB. Leaf DNA was extracted as a template according to the method of Example 2, and amplification was performed using the fluorescent primer set of KASP molecular markers KASP-4B-442201 and KASP-4B-457515 provided in Example 1. The fluorescent primer set for amplifying KASP-4B-442201 and KASP-4B-457515 markers is shown in Example 1. The PCR amplification system, PCR amplification procedure and genotyping are the same as those in Example 2.
[0071] Through the results of marker typing, 70 strains were screened that were consistent with the large-ear germplasm YB in the amplified genotyping of KASP-4B-442201 and KASP-4B-457515. These strains obtained carry the QSl-YB.saas-4B segment of the major gene for ear length of the large-ear germplasm YB. The population was subjected to ear length phenotypic identification, and the field phenotypic identification method was the same as in Example 1. The genotype and phenotypic identification values of each strain are shown in Example 1. The test results show that these 70 strains containing the major gene for ear length of the large-ear germplasm YB QSl-YB.saas-4B show a positive effect on ear length in the field, and the genotyping of some strains is shown in Table 1 below.
[0072] Table 1 Typing results of KASP-4B-442201 and KASP-4B-457515 markers in F9 lines selected from the hybridization of Chuanmai 62×big spike germplasm YB
[0073] Material Name KASP-4B-442201 genotype KASP-4B-457515 genotype Spike length / cm Grain weight per ear / g YB 2 2 20.69 4.40 Sichuan wheat 62 0 0 11.01 2.57 23PW2 2 2 17.61 3.64 23PW13 0 0 13.15 2.49 23PW4 2 2 20.95 3.86 23PW49 0 0 13.57 2.51 23PW7 2 2 18.52 4.15 23PW58 0 0 13.68 2.32 23PW14 2 2 17.18 3.70 23PW70 0 0 12.11 2.25 23PW28 2 2 21.04 3.96 23PW79 0 0 13.10 2.12 23PW37 2 2 17.18 3.91 23PW85 0 0 11.27 2.38 23PW42 2 2 18.22 4.12 23PW100 0 0 12.59 2.10 23PW52 2 2 18.43 3.93 23PW102 0 0 13.83 2.36 23PW132 2 2 16.29 4.22 23PW130 0 0 12.89 2.32 23PW147 2 2 19.94 3.79 23PW142 0 0 12.93 2.34 23PW152 2 2 18.93 3.73 23PW149 0 0 11.97 2.22 23PW159 2 2 16.35 4.15 23PW172 0 0 13.26 2.57
[0074] Note: 23PW1 to 23PW172 represent the F9 lines bred from the hybridization of Sichuan wheat 62 and large-ear germplasm YB.
[0075] In summary, the KASP molecular markers KASP-4B-442201 and KASP-4B-457515 linked to the wheat large-spike germplasm YB spike length major gene QS1-YB.saas-4B developed in this embodiment can realize high-throughput accurate detection of the wheat spike length major gene QS1-YB.saas-4B, and can be used to track and identify the wheat spike length major gene QS1-YB.saas-4B. The strain containing the wheat large-spike germplasm YB spike length major gene QS1-YB.saas-4B showed a positive effect on spike length in the field. Therefore, the wheat large-spike germplasm YB spike length major gene QS1-YB.saas-4B developed in this embodiment and its tightly linked KASP molecular markers KASP-4B-442201 and KASP-4B-457515 have important practical significance in the molecular marker-assisted selection breeding of wheat spike length genes.
[0076] The above description is only a preferred implementation manner of the present invention, but the protection scope of the present invention is not limited thereto, and any modification and replacement based on the technical solution and inventive concept provided by the present invention should be included in the protection scope of the present invention.
Claims
1. Application of KASP molecular marker primer sets KASP-4B-442201 and KASP-4B-457515 in molecular marker-assisted selection breeding of wheat spike length traits; The primer set KASP-4B-442201 of the KASP molecular marker includes KASP-4B-442201F1 with a nucleotide sequence as shown in SEQ ID NO.3, KASP-4B-442201F2 with a nucleotide sequence as shown in SEQ ID NO.4, and KASP-4B-442201C with a nucleotide sequence as shown in SEQ ID NO.5; The primer set KASP-4B-457515 of the KASP molecular marker includes KASP-4B-457515F1 with a nucleotide sequence as shown in SEQ ID NO.8, KASP-4B-457515F2 with a nucleotide sequence as shown in SEQ ID NO.9, and KASP-4B-457515C with a nucleotide sequence as shown in SEQ ID NO.10; The wheat refers to the F9 generation population of Chuanmai 62 and wheat large-ear germplasm YB recombinant inbred line.
2. The use of the KASP molecular marker primer set KASP-4B-442201 and KASP-4B-457515 according to claim 1 in molecular marker-assisted selection breeding of wheat spike length trait, characterized in that: A FAM fluorescent label sequence is added to the 5' end of the KASP-4B-442201F1, and a HEX fluorescent label sequence is added to the 5' end of the KASP-4B-442201F2; A FAM fluorescent label sequence is added to the 5' end of the KASP-4B-457515F1, and a HEX fluorescent label sequence is added to the 5' end of the KASP-4B-457515F2.