Recombinant lactobacillus casei for expressing toxoplasma gondii SAG2A protein as well as construction method and application of recombinant lactobacillus casei

Abstract

The invention provides recombinant lactobacillus casei for expressing toxoplasma gondii SAG2A protein as well as a construction method and application of the recombinant lactobacillus casei, and relates to the technical field of genetic engineering. The recombinant lactobacillus casei for genetically expressing the toxoplasma gondii SAG2A protein is constructed by connecting a toxoplasma gondii SAG2A gene segment with a lactic acid pPG612.1 vector segment lactic acid bacteria secretory expression vector. Experiments prove that the SAG2A gene can be stably inherited, and the protein can be successfully expressed in recombinant lactobacillus casei. The recombinant lactobacillus casei can colonize and secrete toxoplasma gondii SAG2A protein in the intestinal tract of a mouse for a long time, the IgA secretion level of the intestinal tract of the mouse is improved, a specific SAG2A protein antibody is generated, and mucosal immunity is enhanced; the proliferation activity of splenocytes is improved, and the IL-10 level in serum is improved. The recombinant lactobacillus casei has huge potential in resisting toxoplasmosis.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a recombinant Lactobacillus casei expressing Toxoplasma gondii SAG2A protein, and a construction method and application thereof. Background Art

[0002] Toxoplasma gondii is an important opportunistic pathogenic protozoan that widely parasitizes all nucleated cells. Humans and various vertebrates can serve as intermediate hosts, causing the zoonotic disease Toxoplasmosis. Toxoplasmosis is mainly divided into two categories, congenital and acquired. Congenital toxoplasmosis is caused by pregnant women infected with Toxoplasma and then transmitted to their babies, resulting in typical diseases such as hydrocephalus, organ damage, brain calcification, and even death in newborns. Acquired toxoplasmosis refers to infection acquired from the outside world, which is often latently transmitted. When the host's immune function is normal, there are no obvious clinical symptoms, and lymphadenopathy is the main clinical type. When the host's immune function is low, the symptoms of infection with Toxoplasma will manifest, manifested as meningoencephalitis, mental disorders and epilepsy. Toxoplasma can not only infect humans, but also various animals. When people eat raw or undercooked animal products contaminated with Toxoplasma oocysts, they will be infected with Toxoplasma, which seriously endangers human health.

[0003] To date, there is no commercially available vaccine that can completely prevent toxoplasmosis. The only commercially available vaccine is the attenuated S48 tachyzoite strain of Toxoplasma gondii. Due to the short shelf life of the vaccine, high production costs, and the fact that its safety and cost-effectiveness cannot be guaranteed, it is currently only used to prevent toxoplasmosis in sheep. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a recombinant Lactobacillus casei expressing Toxoplasma SAG2A protein, a construction method and an application thereof. The recombinant Lactobacillus casei has good colonization ability on intestinal cells, increases the proliferation activity of spleen cells, increases the secretion level of intestinal-specific IgA and the level of IL-10 in serum, and can partially protect mice from Toxoplasma infection. The recombinant Lactobacillus casei has broad application prospects in the preparation of anti-toxoplasmosis and vaccines thereof.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The invention provides a recombinant lactobacillus casei expressing a Toxoplasma gondii SAG2A protein. The recombinant lactobacillus casei contains a recombinant expression vector pPG612.1-SAG2A. The nucleotide sequence of the recombinant expression vector is shown in SEQ ID NO:1.

[0007] The present invention also provides a method for constructing the recombinant Lactobacillus casei, comprising the following steps: transforming the recombinant expression vector pPG612.1-SAG2A into Lactobacillus casei competent cells to obtain the recombinant Lactobacillus casei.

[0008] Preferably, the Lactobacillus casei competent cells are L. casei 393.

[0009] Preferably, the construction method of the recombinant expression vector pPG612.1-SAG2A comprises the following steps: connecting the Toxoplasma gondii SAG2A gene to the cloning vector pEASY-T1 Simple to obtain the recombinant vector pEASY-T1Simple-SAG2A; performing double enzyme digestion on the recombinant vector pEASY-T1 Simple-SAG2A and the lactic acid bacteria expression vector pPG612.1 to obtain a SAG2A fragment and a pPG612.1 vector fragment; connecting and transforming the SAG2A fragment and the pPG612.1 vector fragment to obtain the recombinant expression vector pPG612.1-SAG2A.

[0010] Preferably, the double digestion enzymes are restriction endonucleases BamHI and EcoRI.

[0011] The present invention also provides an application of the recombinant Lactobacillus casei or the recombinant Lactobacillus casei obtained by the construction method in preparing an anti-toxoplasmosis drug.

[0012] The present invention also provides an application of the recombinant Lactobacillus casei or the recombinant Lactobacillus casei obtained by the construction method in preparing a Toxoplasma gondii vaccine.

[0013] The present invention also provides a drug for resisting toxoplasmosis, which comprises the recombinant Lactobacillus casei or the recombinant Lactobacillus casei obtained by the construction method.

[0014] Preferably, the dosage form of the drug includes tablets, granules, pills, capsules or oral liquids.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The present invention uses lactic acid bacteria as a gene expression vector and delivery system, connects the Toxoplasma SAG2A gene fragment and the lactic acid pPG612.1 vector fragment lactic acid bacteria secretion expression vector, and constructs a recombinant Lactobacillus casei that transgenically expresses the Toxoplasma SAG2A protein. It has been confirmed by experiments that the SAG2A gene can be stably inherited, and the SAG2A protein can be successfully expressed in lactic acid bacteria. The recombinant Lactobacillus casei can be colonized in the mouse intestine for a long time, secrete the Toxoplasma SAG2A protein, improve the IgA secretion level of the mouse intestine, produce specific SAG2A protein antibodies, enhance mucosal immunity; increase the proliferation activity of spleen cells, and improve the IL-10 level in serum. The results of the Toxoplasma RH strain attack experiment after 35 days of oral immunization of mice show that oral immunization of the recombinant Lactobacillus casei vaccine can greatly improve the survival rate of mice, suggesting that the recombinant Lactobacillus casei and its oral vaccine have great potential in the prevention and treatment of toxoplasmosis. The Lactobacillus casei live vector vaccine of the present invention is significantly superior to the existing commercial vaccines on the market in terms of cost and safety, which provides strong economic support for achieving widespread popularization and application, and has great potential and broad application prospects in the future vaccine market.

[0017] The present invention successfully constructs a Toxoplasma gondii SAG2A recombinant Lactobacillus casei for the first time, and the recombinant Lactobacillus casei has good colonization ability on intestinal cells, increases spleen cell proliferation activity, increases the secretion level of intestinal specific IgA and the IL-10 level in serum, and can partially protect mice from infection. The recombinant Lactobacillus casei constructed by the present invention is simple to use, non-invasive (through the mouth or nose), can accept genetic modification and is genetically stable, does not require purification of expressed proteins, has low cost, has the highest safety performance, survives in the body and continuously expresses exogenous proteins, and can produce a relatively lasting immune response. According to the vaccine efficacy calculation method announced by the World Health Organization, the vaccine efficacy of the Toxoplasma gondii SAG2A recombinant Lactobacillus casei vaccine is calculated to be 62.5%, which has exceeded the 50% stipulated by the World Health Organization and has a wide range of application prospects in commercial vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 A schematic diagram of the construction process of the recombinant vector pPG612.1-SAG2A;

[0019] Figure 2 This is the positive clone identification diagram of the recombinant vector pPG612.1-SAG2A;

[0020] Figure 3 It is the amplification product of SAG2A gene. In the figure, M is DL1000 Marker, 1-4 are the amplification products of SAG2A gene, and 5 is the negative control;

[0021] Figure 4It is the double restriction enzyme digestion identification of pPG612.1-SAG2A, M in the figure: DL5000 Marker; 1-2 is the double restriction enzyme digestion identification of pPG612.1-SAG2A, among which 2 is identified as a positive recombinant plasmid;

[0022] Figure 5 The results of Western blot of His tag cloned antibody for identification of recombinant Lactobacillus casei, M in the figure: ProteinMarker, 1 is unconstructed Lactobacillus casei, 2 is pPG612.1-SAG2A recombinant Lactobacillus casei;

[0023] Figure 6 Western blot results of the positive serum for Toxoplasma gondii of the recombinant Lactobacillus casei were identified. In the figure, M: ProteinMarker, 1-2 are pPG612.1-SAG2A recombinant Lactobacillus casei, and 3-4 are unconstructed Lactobacillus casei;

[0024] Figure 7 Indirect immunofluorescence assay (IFA) is used to detect SAG2A protein. In the figure, the left picture is a fluorescence photo of unconstructed Lactobacillus casei, and the right picture is a fluorescence photo of recombinant Lactobacillus casei;

[0025] Figure 8 To detect the adhesion of recombinant Lactobacillus casei to colon cells CT-26;

[0026] Fig. 9 The level of anti-Toxoplasma gondii SAG2A antibodies in the peripheral blood of immunized mice;

[0027] Fig.10 is the concentration of IgG, IL-4, IL-10, TNF-α, and IFN-γ in the serum of immunized mice;

[0028] Fig.11 is the transcription level of IL-10, IL-4, TNF-α, and IFN-γ in the spleen cells of immunized mice;

[0029] Fig.12 The intestinal IgA antibody level of Toxoplasma gondii SAG2A recombinant Lactobacillus casei vaccine;

[0030] Fig.13 The results of spleen cell proliferation after oral immunization of mice with recombinant Lactobacillus casei;

[0031] Fig.14 The results are for the CD3 percentage of lymphocyte subsets after oral immunization of mice with recombinant Lactobacillus casei;

[0032] Fig.15 The results are for the percentage of CD8 lymphocyte subsets after oral immunization of mice with recombinant Lactobacillus casei;

[0033] Fig.16 The results are the CD4 percentage of lymphocyte subsets after oral immunization of mice with recombinant Lactobacillus casei;

[0034] Fig.17 The number of IgA secreting cells in the intestinal mucosal lamina propria of mice. In the figure, A is the PBS treatment group, B is the empty vector control treatment group, and C is the recombinant Lactobacillus casei treatment group;

[0035] Fig.18 After immunizing mice with recombinant Lactobacillus casei, 1×10 3 Mortality curve of Toxoplasma gondii RH strain. DETAILED DESCRIPTION

[0036] The present invention provides a recombinant Lactobacillus casei expressing Toxoplasma gondii SAG2A protein, wherein the recombinant Lactobacillus casei contains a recombinant expression vector pPG612.1-SAG2A; the nucleotide sequence of the recombinant expression vector is shown in SEQ ID NO: 1. In the present invention, the backbone plasmid of the recombinant expression vector pPG612.1-SAG2A is pPG612.1. In the present invention, preferably, Escherichia coli containing the pPG612.1 plasmid is inoculated into an LB liquid culture medium, cultured overnight with shaking, and the pPG612.1 plasmid is extracted using a plasmid small-scale extraction kit. In the present invention, the pPG612.1 plasmid can be purchased through conventional channels. In a specific embodiment of the present invention, the pPG612.1 plasmid is purchased from the BioVector Plasmid Vector Strain Cell Protein Antibody Gene Collection Center, Order ID: BioVector-01128569.

[0037] The present invention also provides a method for constructing the recombinant Lactobacillus casei, preferably comprising the following steps: transforming the recombinant expression vector pPG612.1-SAG2A into Lactobacillus casei competent cells to obtain the recombinant Lactobacillus casei. In the present invention, the transformation method is preferably electrotransformation, and the electrotransformation method is well known to those skilled in the art.

[0038] In the present invention, the Lactobacillus casei competent cells are preferably L. casei 393. In the present invention, the L. casei 393 competent cells are prepared by conventional methods from the L. casei 393 strain. In a specific embodiment of the present invention, the L. casei 393 strain is named Lacticaseibacillus casei (Orla-Jensen) 393, which is purchased from the American Type Culture Collection.

[0039] In the present invention, the construction method of the recombinant expression vector pPG612.1-SAG2A preferably includes the following steps: connecting the Toxoplasma gondii SAG2A gene to the cloning vector pEASY-T1 Simple to obtain the recombinant vector pEASY-T1 Simple-SAG2A; double-enzyme digesting the recombinant vector pEASY-T1 Simple-SAG2A and the lactic acid bacteria expression vector pPG612.1 to obtain the SAG2A fragment and the pPG612.1 vector fragment; connecting and transforming the SAG2A fragment and the pPG612.1 vector fragment to obtain the recombinant expression vector pPG612.1-SAG2A.

[0040] In the present invention, the GenBank accession number of the Toxoplasma gondii SAG2A gene is M33572.1, and primers are designed based on the Toxoplasma gondii SAG2A gene to obtain the target gene. The purified and recovered target gene fragment is connected to the cloning vector pEASY-T1 Simple, the connection product is transformed into an E. coli DH5α medium-coated plate, a single colony is picked, and it is inoculated in an LB liquid culture medium containing Amp and shaken to obtain the recombinant vector pEASY-T1Simple-SAG2A. In the present invention, the cloning vector pEASY-T1 Simple can be purchased through conventional channels. In a specific embodiment of the present invention, the cloning vector pEASY-T1 Simple is purchased from Quanshijin (Beijing) Biotechnology Co., Ltd., item number: CT111-01.

[0041] In the present invention, the primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is GAATTCTCCACCACCGAGACGCCAG (SEQ ID NO: 2); the nucleotide sequence of the downstream primer is GGATCCTGCCCGTGAGAGACACAGG (SEQ ID NO: 3), and the amplified fragment size is 448 bp.

[0042]

[0043] The nucleotide sequence of the SAG2A fragment is TCCACCACCGAGACGCCAGCGCCCATTGAGTGCACTGCCGGCGCAACGAAGACTGTTGATGCACCCTCCAGTGGTTCCGTTGTCTTCCAATGTGGGGATAAACTAACCATCAGTCCCAGTGGCGAAGGTGATGTCTTTTATGGCAAGGAATGCACAGACTCGAGGAAGTTGACGACTGTCCTTCCAGGTGCGGTCTTGACAGCTAAGGTCCA GCAGCCCGCGAAAGGTCCTGCTACCTACACACTGTCTTACGACGGTACTCCCGAGAAACCTCAGGTTCTCGTTACAAGTGCGTTGCCGAAGCAGGTGCTCCCGCTGGTCGAAATAATGATGGTTCTAGCGCTCCGACGCCTAAAGACTGCAAACTCATTGTTCGCGTTCCGGGTGCCGATGGCCGTGTCACATCTGGGTTTGACCCTGTGTCTCTCACGGGCA(SEQ ID NO: 5).

[0044] In the present invention, the double digestion enzymes are preferably restriction endonucleases BamHI and EcoRI.

[0045] The present invention also provides an application of the recombinant Lactobacillus casei or the recombinant Lactobacillus casei obtained by the construction method in the preparation of an anti-toxoplasmosis drug. Experiments have confirmed that the recombinant Lactobacillus casei can colonize in the mouse intestine for a long time, secrete Toxoplasma SAG2A protein, increase the level of IgA secretion in the mouse intestine, produce specific SAG2A protein antibodies, enhance mucosal immunity, increase spleen cell proliferation activity, and increase the level of IL-10 in serum. It is suggested that the recombinant Lactobacillus casei has the effect of preventing and treating toxoplasmosis.

[0046] The present invention also provides an application of the recombinant Lactobacillus casei or the recombinant Lactobacillus casei obtained by the construction method in preparing a toxoplasmosis vaccine. The results of the Toxoplasma RH strain attack experiment after oral immunization of mice for 35 days show that oral immunization of the recombinant Lactobacillus casei vaccine can greatly improve the survival rate of mice, indicating that the recombinant Lactobacillus casei has great potential in preparing an oral vaccine for toxoplasmosis.

[0047] The present invention also provides a drug for resisting toxoplasmosis, wherein the drug preferably comprises the recombinant Lactobacillus casei or the recombinant Lactobacillus casei obtained by the construction method. The drug of the present invention preferably also comprises a pharmaceutically acceptable excipient; and the dosage form of the drug preferably comprises tablets, granules, pills, capsules or oral liquids.

[0048] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0049] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are commercially available products unless otherwise specified.

[0050] Example 1

[0051] 1.1 Construction and identification of prokaryotic expression plasmids

[0052] Primer P22 was designed based on the sequence of the Toxoplasma gondii SAG2A gene (GenBank number: M33572.1) in GenBank, and BamHI and EcoRI restriction sites were introduced. The primer sequence was: P22-F (upstream primer): 5'- GAATTC TCCACCACCGAGACGCCAG-3' (SEQ ID NO: 2), the underlined part is the EcoRI restriction site; P22-R (downstream primer): 5'- GGATCC TGCCCGTGAGAGACACAGG-3' (SEQ ID NO: 3), the underlined portion is the BamHI restriction site; the amplified fragment size is estimated to be 448 bp by the software SnapGene.

[0053] PCR reaction system 50μL: 1μL of Toxoplasma RH strain DNA, 1μL of upstream and downstream primers, 25μL of Premix Taq, and ddH2O to 50μL. PCR reaction conditions: 95℃ pre-denaturation for 7min; 95℃ denaturation for 1min, 55℃ annealing for 30s, 72℃ extension for 1min, 35 cycles in total; 72℃ extension for 10min. The PCR product was detected by 1.0% agarose gel electrophoresis and the target fragment was recovered. The purified and recovered target gene fragment was connected to the cloning vector pEASY-T1 Simple at 25℃ for 15min. 10μL of the connection product was transformed into E.coli DH5α medium-coated plate, a single colony was picked, inoculated into LB liquid medium containing Amp, and cultured at 37℃ and 200r / min. The bacterial liquid was PCR identified with P22-F / R primers, the plasmid was extracted, and sent to a biological company for sequencing.

[0054] 1.2 Construction and identification of recombinant Lactobacillus casei

[0055] Activate the E.coli MC1061 stored in the laboratory, streak it on the LB agar medium plate, culture it at 37℃ overnight, pick up the overnight single colony, inoculate it into the LB liquid culture medium and culture it at 37℃ overnight. The next day, inoculate it into 50mL LB liquid culture medium at a ratio of 1% and culture it at 37℃. Ice-bathe the cultured bacterial solution for 15min, centrifuge it at 5000r / min for 8min at 4℃, discard the supernatant, suspend the cells with 10mL pre-cooled CaCl2 (0.06mol / L), ice-bathe it for 15min, centrifuge it at 4℃5000r / min for 8min, discard the supernatant, wash it with PBS 3 times, ice-bathe it for 25min and centrifuge it to discard the supernatant, and finally use 1mL of pre-cooled CaCl2 (0.06mol / L) containing 15% glycerol to gently suspend the competent cells, ice-bathe it for 25min, aliquot it and store it in a -80℃ refrigerator for later use.

[0056] Activate E. coli containing pPG612.1 plasmid, inoculate into LB liquid medium, shake culture at 37℃ overnight, extract plasmid with plasmid mini-extraction kit, double-digest the recombinant plasmid pEASY-T1Simple-SAG2A and lactic acid bacteria expression vector pPG612.1 with restriction endonucleases BamHI and EcoRI, respectively. Use T4 DNA ligase to connect the SAG2A fragment with the pPG612.1 vector fragment at 16℃ overnight. See the schematic diagram of the construction process of the recombinant plasmid pPG612.1-SAG2A for details. Figure 1 The ligation product was transformed into E. coli MC1061 competent cells, and the above bacterial solution was evenly spread on LB agar medium plates (containing 10 μg / mL chloramphenicol), and cultured at 37°C overnight. The suspected positive single colony was picked for plasmid extraction, and PCR and double enzyme digestion were performed for identification, and it was sent for sequencing. The positive clone identification of the recombinant vector pPG612.1-SAG2A is shown in the figure. Figure 2 .

[0057] Activate L. casei 393 strain, streak on non-resistant MRS agar medium plate and culture at 37°C overnight, pick a single colony overnight, inoculate into non-resistant MRS broth medium, and culture at 37°C overnight. The next day, inoculate 2% of the strain into 100 mL non-resistant MRS broth medium and culture at 37°C overnight. 600The cultured bacterial liquid was placed in an ice bath for 25 minutes, centrifuged at 4000r / min for 15 minutes at 4°C, the supernatant was discarded, and the bacteria were collected; the cells were washed three times with pre-cooled EPWB buffer (EPWB buffer was composed of 0.6mmol / L NaH2PO4 and 0.1mmol / L MgCl2), the supernatant was discarded, and the bacteria were collected; the cells were resuspended with 1.5mL pre-cooled EPB buffer (EPB solution was EPWB solution with 0.3mol / L sucrose added, the pH was adjusted to 7.4, and the cells were sterilized and stored at 4°C), the cells were placed in an ice bath for 12 minutes, and the cells were divided and stored at -80°C for later use.

[0058] Place L.casei 393 competent cells and electroporation cups on ice for 30 minutes, take 15 μL of recombinant plasmid pPG612.1-SAG2A and 100 μL of competent cells, mix them, place on ice for 8 minutes, transfer the mixed products to a 2 mm electroporation cup, and use an electroporator (parameters set to 2.54 kV 3ms) for electroporation. After the end, add 600 μL of recovery MRS liquid medium containing 15% sucrose, and place on ice for 12 minutes; culture anaerobically at 37°C for 2.5 hours, take 200 μL of bacterial liquid and spread it on an MRS agar medium plate (containing 10 μg / mL chloramphenicol), and culture anaerobically for 20-30 hours. After lysozyme is acted at 37°C for 1 hour, follow the steps of the plasmid extraction kit. Perform PCR and double enzyme digestion identification on the extracted plasmid to verify the recombinant plasmid, and send the suspected positive plasmid to a biological company for sequencing.

[0059] The recombinant Lactobacillus casei plasmid was extracted after electroporation, and the PCR product was identified by 1.0% agarose gel electrophoresis. The band obtained by PCR amplification showed a clear and single target fragment of about 448 bp ( Figure 3 ). After the recombinant plasmid was digested with BamHI and EcoRI, fragments of approximately 4157 bp and 436 bp appeared ( Figure 4 ). The inserted target gene fragment was identified by sequencing and comparison, and the sequence of the SAG2A gene was consistent, which verified that the recombinant plasmid pPG612.1-SAG2A was successfully constructed.

[0060] The positive bacteria were sent for sequencing, and the obtained sequences were analyzed. The results showed that the similarity with the P22 gene of Toxoplasma gondii was 100% homologous.

[0061] Example 2 Western blot identification of recombinant Lactobacillus casei

[0062] The recombinant Lactobacillus casei obtained by the construction of Example 1 was inoculated in MRS broth medium containing 10 μg / mL chloramphenicol, and cultured anaerobically at 37°C overnight. 5% of the overnight bacterial solution was inoculated in MRS broth medium containing 10 μg / mL chloramphenicol + 2% lactose, and induced anaerobically at 37°C overnight. The Lactobacillus casei Lc-pPG without SAG2A was constructed as a negative control in the same manner as in Example 1. The induced bacterial solution was centrifuged at 4°C 10000r / min for 10min, washed 3 times with sterile PBS, and lysozyme was added to break the cell wall for 1h after resuspending in PBS. The cells were collected by centrifugation under the same conditions, and the cells were resuspended in 100 μL PBS, and 20 μL 6×SDS-PAGE buffer was added, mixed and boiled for 10min, and stored at -20°C for standby use. SDS-PAGE electrophoresis was performed at 160V voltage.

[0063] After SDS-PAGE electrophoresis, the lower separation gel was taken out and soaked in the transfer solution for 5 minutes together with the filter paper. The PVDF membrane was soaked in methanol for 2 minutes. The electrode plates of the semi-dry transfer system were: 3 layers of filter paper, separation gel, PVDF membrane and 3 layers of filter paper in order from top to bottom; 200A constant voltage transfer was used for 30 minutes; after the transfer, the PVDF membrane was taken out and blocked in 5% skim milk for 1 hour, mouse anti-His tag antibody was used as the primary antibody at 4°C overnight, the membrane was washed 5 times with TBST, HRP-labeled goat anti-mouse IgG antibody was used for 1 hour, the membrane was washed 5 times with TBST, the PVDF membrane was placed on a multifunctional imager, and ECL luminescent liquid was added for color development.

[0064] The induced recombinant Lactobacillus casei protein was extracted, and His-tag monoclonal antibody and Toxoplasma gondii positive serum were used as primary antibodies to verify that the SAG2A protein was successfully expressed, with a size of about 30 kDa. However, no bands were seen in the control bacteria. Figure 5 , Figure 6 This indicates that the Toxoplasma gondii SAG2A recombinant Lactobacillus casei successfully expressed the SAG2A protein.

[0065] Example 3 Indirect immunofluorescence detection of recombinant Lactobacillus casei

[0066] The recombinant Lactobacillus casei constructed in Example 1 was induced, 1 mL of the induced bacterial solution was taken, centrifuged at 12000 r / min for 5 min, washed 3 times with sterile PBS, fixed with 4% paraformaldehyde for 30 min, washed 3 times with PBST, acted with 1% Triton X-100 for 5 min, washed 3 times with PBST, blocked with 5% skim milk for 1 h, mouse anti-His tag antibody was added, incubated at 4° C. overnight, goat anti-mouse IgG secondary antibody was added, incubated at 37° C. in the dark for 60 min, washed 3 times with PBST, and observed under a fluorescence microscope.

[0067] Immunofluorescence analysis (IFA) was performed using His-tag monoclonal antibody as primary antibody and AlexaFluor488 as secondary antibody. Figure 7 As shown, the bacteria showed green fluorescence, indicating that the recombinant Lactobacillus casei successfully expressed the SAG2A protein.

[0068] Example 4 Stability test of recombinant Lactobacillus casei

[0069] The recombinant Lactobacillus casei constructed in Example 1 was inoculated into MRS broth medium containing 10 μg / mL chloramphenicol at a ratio of 2%, and cultured in an incubator at 37°C under anaerobic and non-anaerobic conditions for 12 h. The culture was repeated at the same ratio, and plasmids were extracted every 2 generations, and PCR identification was performed at the same time. Finally, the plasmids after 10 generations were sent for sequencing.

[0070] After the recombinant Lactobacillus casei was cultivated for 10 generations, the plasmid was extracted with a kit, and the PCR identification results were performed with the primers of Example 1. The results showed that all were positive. The gel was recovered and sent to a biological company for sequencing. The sequencing results were 100% homologous to the Toxoplasma gondii gene sequence published by GenBank. It was proved that the recombinant Lactobacillus casei had stability and could be stored for a long time under anaerobic and non-anaerobic conditions.

[0071] Example 5 Detection of the adhesion performance of recombinant Lactobacillus casei to intestinal cells

[0072] The adhesion performance test steps are as follows:

[0073] (1) Take a tube of CT-26 cells stored in liquid nitrogen, thaw it in a 37°C water bath, add 4 mL of DMEM medium, centrifuge at 1000 r / min for 5 min, remove the supernatant, resuspend it in 5 mL of complete medium, count the cells, and then aliquot into T25 cell culture flasks and culture them in a cell culture incubator.

[0074] (2) The recombinant Lactobacillus casei obtained in Example 1 was inoculated into 10 mL of chloramphenicol-resistant MRS medium at a 1% inoculum amount and cultured at 37° C. for 18 h.

[0075] (3) CT-26 cells were digested with trypsin and digested with complete medium. The number of cells was counted with a cell counting plate. 1×10 5 The cells were placed in 6-well plates and cultured for 12 h.

[0076] (4) Wash three times with sterile PBS, count the number of bacteria by McFarland turbidimetry, and add 100 μL of 1×10 7 / ml bacterial solution was mixed with an equal volume of DMEM cell culture medium, incubated in a cell culture incubator for 3 hours, washed with PBS, fixed with 4% methanol for 30 minutes, and Gram-stained.

[0077] (5) Microscopic examination: Place the slide on the microscope platform and search and count the bacteria in the sample one by one. Use a high-power microscope (1000 times) to magnify and randomly select several fields of view in the sample for counting.

[0078] (6) Counting: Count the bacteria in each field of view using an eyepiece. Count by manual counting and record the number of bacteria observed in each field of view.

[0079] (7) Statistical analysis: calculate the average number of bacteria in each field of view, and estimate the number of bacteria in the entire sample based on the total area of ​​the sample and the average value, and record the results.

[0080] Adhesion rate = (number of adherent lactobacilli (CFU) ÷ number of adherent CT-26 cells) × 100%

[0081] The number of lactobacilli adhering to CT-26 cells in 20 fields of view was randomly counted under a microscope. The results are shown in Figure 8 The results of the adhesion test of recombinant Lactobacillus casei to intestinal cells showed that the recombinant Lactobacillus casei had a strong adhesion ability to cells, and the adhesion number ranged from 166±89.

[0082] Example 6

[0083] 33 female BALB / c mice were randomly divided into 11 groups, namely, SAG2A recombinant lactobacillus casei experimental group, lactobacillus casei empty vector control group and PBS group. The immunization procedure was as follows: the SAG2A recombinant lactobacillus casei experimental group was immunized by gavage with 0.2mL of SAG2A recombinant lactobacillus casei obtained by embodiment 1 constructed after culturing 12h under anaerobic conditions at 37°C incubator with a sterile syringe. The lactobacillus casei empty vector group was immunized by gavage with 0.2mL of lactobacillus casei empty vector, and the PBS group was immunized by gavage with 0.2mL of aseptic PBS. The first immunization was carried out on the 1st day, the second immunization was carried out on the 7th day, the third immunization was carried out on the 21st day, and the fourth immunization was carried out on the 35th day, and each immunization was continuously immunized for 3 days. Before immunization, the experimental mice needed to fast and deprive water for 8h to ensure the accuracy of the test results.

[0084] Three days after the end of immunization, mice in the immunization experimental group and the empty vector control group were challenged with the RH strain of Toxoplasma gondii. The RH strain of Toxoplasma gondii frozen in the liquid nitrogen tank was taken out and placed in 37°C warm water to dissolve it in a water bath. The tachyzoites were aspirated and inoculated into HFF-1 cells. After three generations, the parasites were collected and the tachyzoites were purified and then inoculated at 1×10 3 The mice were orally gavaged at a dose of 100 mg / mice, with 8 mice in each group, and the survival time of the 8 infected mice in each group was recorded. The following tests were performed on the immunized mice:

[0085] (1) Detection of anti-Toxoplasma gondii SAG2A antibody levels in mouse peripheral blood

[0086] Blood was collected from the tail vein of the immunized mice to collect serum, and the anti-Toxoplasma serum antibody level was detected using the coated SAG2A indirect ELISA kit. The specific method steps are as follows:

[0087] 1) Take 1 μL of serum per mouse and mix with 99 μL of 3% skim milk, add to each well, and incubate at 37°C for 60 min;

[0088] 2) Discard the liquid in each well, aspirate dry, and wash 6 times with PBST, 100 μL / time;

[0089] 3) Add 100 μL of HRP-labeled goat anti-mouse IgG to each plate and incubate at 37°C for 60 min;

[0090] 4) Discard the liquid in each well, aspirate dry, and wash 6 times with PBST, 100 μL / time;

[0091] 5) Add chromogenic substrates respectively and incubate at 37°C in the dark for 20 min;

[0092] 6) Add 50 μL of stop solution and read the absorbance at 450 nm using an ELISA reader.

[0093] The serum of mice was collected and the level of anti-IgG Toxoplasma gondii SAG2A antibody in the serum was detected. The results showed that there was no significant difference in the concentration of anti-Toxoplasma gondii SAG2A antibody in the serum (P>0.05). Fig. 9 .

[0094] (2) Detection of IgG antibodies and IL-4, IL-10, TNF-α, and IFN-γ cytokines

[0095] 28 days after the mice were immunized, blood was collected from the tail vein of the mice, left to stand at room temperature for 20 min, and centrifuged at 3000 r / min and 4°C for 10 min. Serum was collected for testing, and ELISA kits for IgG, IL-4, IL-10, TNF-α, and IFN-γ were used to detect cytokine levels according to the instructions.

[0096] The mouse serum was collected and the concentrations of IgG, IL-4, IL-10, TNF-α and IFN-γ in the serum were detected by ELISA. The results showed that there was no significant statistical difference in the concentrations of IgG, IL-4, TNF-α and IFN-γ in the serum between the experimental group and the empty vector group and the PBS group (P>0.05), but there was a significant statistical difference in the concentration of IL-10 (P<0.05). Fig.10 .

[0097] (3) Detection of transcriptional levels of IL-4, IL-10, TNF-α, and IFN-γ cytokines

[0098] 28 days after the mice were immunized, spleen cells were collected from the mice for testing, and mouse IL-4, IL-10, IFN-α, and IFN-γ detection primers were used to detect cytokine transcription levels.

[0099] Mouse spleen cells were collected to detect the relative expression levels of IL-10, IL-4, TNF-α and IFN-γ mRNA. The results showed that there was no significant statistical difference in the expression of TNF-α, IL-4 and IFN-γ in spleen cells between the experimental group and the empty vector group and the PBS group (P>0.05), and there was a significant statistical difference in the transcription level of IL-10 (P<0.05). Fig.11 . It shows that Lactobacillus casei live vector vaccine can promote the production of IL-10 cytokine, IL-10 can promote mitochondrial autophagy, enhance resistance to intestinal inflammation, enhance anti-inflammatory effect, and enhance intestinal plasma cell proliferation. Toxoplasma infection can increase the apoptosis of decidual regulatory T cells by activating the extrinsic apoptosis pathway of decidual regulatory T cells, resulting in a decrease in the number of regulatory T cells and a decrease in maternal tolerance function, thereby causing adverse pregnancy outcomes. IL-10 can reduce the apoptosis of decidual regulatory T cells caused by Toxoplasma infection through the extrinsic apoptosis pathway. IL-10 can effectively improve adverse pregnancy outcomes caused by Toxoplasma infection during pregnancy.

[0100] (4) Mouse intestinal IgA antibody detection

[0101] 28 days after immunization, blood was collected from the eyeballs of mice and the mice were killed. The small intestine of the mice was taken and rinsed with 1 mL PBS. The anti-Toxoplasma serum antibody level was detected using the coated SAG2A indirect ELISA kit. The specific steps are as follows:

[0102] 1) Collect 200 μL of washing solution and add it to each well, incubate at 37°C for 60 min;

[0103] 2) Discard the liquid in each well, aspirate dry, and wash 6 times with PBST, 100 μL / time;

[0104] 3) Add 100 μL of HRP-labeled goat anti-mouse IgA to each plate and incubate at 37°C for 60 min;

[0105] 4) Discard the liquid in each well, aspirate dry, and wash 6 times with PBST, 100 μL / time;

[0106] 5) Add 50 μL of stop solution and read the absorbance at 450 nm using an ELISA reader.

[0107] The concentration of anti-Toxoplasma gondii SAG2A antibodies in the intestine showed significant differences between the experimental group, the empty vector group, and the PBS group (P<0.05). Fig.12 . This indicates that the Lactobacillus casei live vector vaccine can produce IgA specific to Toxoplasma gondii SAG2A in the intestine.

[0108] (5) Effect of oral immunization of mice with recombinant Lactobacillus casei on spleen cell proliferation

[0109] After 28 days of immunization, the mice were sacrificed by blood sampling from their eyeballs, and the proliferation level of spleen cells was detected using concanavalin A. The specific steps are as follows:

[0110] 1) Cut the spleen of the mouse into pieces, grind it on a 200-mesh cell sieve, rinse it with DMEM culture medium, collect it into a 15 mL centrifuge tube, centrifuge it at 1200 r / min for 5 min, discard the supernatant, add 5 mL of red blood cell lysis buffer, shake and mix, centrifuge it at 1200 r / min for 5 min, discard the supernatant; resuspend it in 10 mL of DMEM culture medium and count it, take 4×10 5 100 μL of spleen cell suspension was prepared and added to a 96-well plate. The culture plate was pre-cultured in an incubator for 24 h.

[0111] 2) Add 10 μL of concanavalin A to the culture plate and incubate in an incubator for 48 h.

[0112] 3) Add 10 μL of CCK-8 solution to each well.

[0113] 4) Incubate the culture plate in an incubator for 3 hours.

[0114] 5) Measure the absorbance at 450 nm using an enzyme-labeled instrument.

[0115] In the mouse spleen lymphocyte proliferation test, spleen lymphocytes showed a certain proliferation activity, and there was a significant difference between the experimental group and the empty vector control group and the PBS group (P<0.05). Fig.13 . This indicates that the Lactobacillus casei live vector vaccine stimulates the body to produce a cellular immune response.

[0116] (6) Flow cytometry detection of lymphocyte subsets

[0117] 1) On the 28th day after mouse immunization, the spleen of mice sacrificed by eyeball blood sampling was taken, the spleen of the mice was cut into pieces, ground on a 200-mesh cell sieve, rinsed with 1× PBS, collected into a 15 mL centrifuge tube, centrifuged at 1200 r / min for 5 min, and the supernatant was discarded;

[0118] 2) Add 5 mL of red blood cell lysis buffer, shake and mix, place on ice for 3 min, centrifuge at 1200 rpm for 5 min, and discard the supernatant;

[0119] 3) Add 7 mL of 1× PBS, resuspend, centrifuge at 1200 rpm for 5 min, discard the supernatant, and repeat the operation once;

[0120] 4) Add 1 mL of 1× PBS, resuspend the cells, and count;

[0121] 5) Take 5×10 6 Cells were filled to 1 mL with 1× PBS, mixed and placed on ice for 15 min;

[0122] 6) Add 7 mL of 1× PBS containing 0.5% BSA, mix well, centrifuge at 1200 rpm for 5 min, discard the supernatant, and repeat the operation once;

[0123] 7) Block each tube with 100 μL of homologous antibody for 5 min, add 400 μL of 0.5% BSA in 1× PBS, mix well and transfer to a 1.5 mL centrifuge tube;

[0124] 8) Add 1 μL of antibodies CD3e FITC, CD4APC, and CD8a PE to each tube, shake to mix, and incubate at 4°C in the dark for 30 min;

[0125] 9) Add 700 μL 1× PBS respectively, mix well and centrifuge at 1200 rpm for 5 min, discard the supernatant, and repeat the operation once;

[0126] 10) Add 500 μL 1×PBS to suspend the cells and test on an instrument.

[0127] The results of statistical methods showed that there was no significant difference in the number of CD3, CD4 and CD8 of lymphocyte subsets between the experimental group and the empty vector group and PBS group (P>0.05). Figure 14-16 .

[0128] (7) qPCR detection of intestinal mucosal colonization of recombinant Lactobacillus casei

[0129] The mice were killed by eye blood sampling 28 days after immunization, and the small intestine of the mice was taken. The genome of the mouse intestinal saline flush was extracted using the bacterial genome extraction kit of Tiangen Company. The primers of Example 1 were used to detect the colonization of the recombinant Lactobacillus casei in the mouse intestinal mucosa after oral immunization by qPCR reaction.

[0130] The intestinal lavage material was amplified using the probe primers, and the results obtained by substituting the average CT value into the standard curve showed that the number of recombinant Lactobacillus casei colonization in the intestine was 10 4 The qPCR results showed that the recombinant Lactobacillus casei could colonize the intestine well.

[0131] (8) Immunohistochemical detection of IgA secreting cells in small intestinal mucosa

[0132] 1) Tissue collection and processing: 1 cm of each of the duodenum, jejunum and ileum was collected, washed with PBS, and fixed with Bouin's solution. The fixed tissues were routinely paraffin-embedded and stored at 4°C for sections.

[0133] 2) Sectioning: Paraffin sections were immersed in xylene, 100%, 95%, 85% and 70% ethanol in turn, each for 10 min. After dewaxing and rehydration, the sections were placed in a freshly prepared 0.3% H2O2 solution for 10 min and then washed with distilled water.

[0134] 3) Antigen repair: Use 1% 0.01M citrate buffer (pH 6.0) to repair antigens by microwave. Wash with PBS after repair.

[0135] 4) Add enzyme-labeled antibody: Add HRP-labeled goat anti-mouse IgA (1:2000 dilution) to the slices and incubate at 37°C for 120 min. Then wash with PBS.

[0136] 5) DAB staining: The sections were subjected to DAB staining under a microscope until the color changed to brown, and then the reaction was terminated with distilled water.

[0137] 6) Hematoxylin counterstaining and sealing: counterstain with hematoxylin for 30 seconds, then rinse with tap water until the tissue color turns blue. Finally, dehydrate and seal the slides, using 70%, 80%, 90%, 95% and 100% ethanol in sequence, soaking in each concentration of ethanol for 3 minutes, then soaking in ethanol and xylene (1:2), xylene I and II for 5 minutes each, and finally sealing with neutral gum.

[0138] 7) Counting under a microscope: Three fields of view were randomly selected for each slice and counted under a microscope at 400 times magnification.

[0139] Immunohistochemistry was used to detect IgA secreting cells in the lamina propria of the mucosa. IgA secreting cells were stained brown. Three fields of view were randomly selected for each section and counted under a 400x microscope. The number calculation between the experimental group and the empty vector control group and the PBS group showed a significant difference (P<0.05). Fig.17 After oral immunization of mice with recombinant Lactobacillus casei SAG2A, the number of IgA-secreting cells in the intestinal lamina propria increased significantly. This result is consistent with the results of intestinal IgA antibody level detection of Toxoplasma gondii SAG2A recombinant Lactobacillus casei vaccine, indicating that the live Lactobacillus casei vector vaccine can increase the IgA antibody level in the intestine.

[0140] (9) Immune protection effect of oral immunization of mice with recombinant Lactobacillus casei

[0141] Observe and record the survival time of mice after the onset of the disease. Fig.18 The results showed that all mice in the PBS group died on the 9th day, with an average survival time of 8.5 days. All mice in the Lactobacillus casei empty vector group and the immunization group died on the 12th day, with an average survival time of 10.37 days. Three animals died in the SAG2A recombinant Lactobacillus casei experimental group, and the remaining five animals survived ( Fig.18 ). The results showed that the Lactobacillus casei live vector vaccine can significantly increase the survival time of mice. According to the calculation method of the "Principles of Epidemiology in Public Health Practice, Third Edition", the vaccine efficacy of this vaccine is 62.5%, far exceeding the 50% stipulated by the World Health Organization. It is much safer than any commercial vaccine and costs much less than similar vaccines.

[0142] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A recombinant Lactobacillus casei expressing Toxoplasma gondii SAG2A protein, characterized in that: The recombinant Lactobacillus casei contains a recombinant expression vector pPG612.1-SAG2A; the nucleotide sequence of the recombinant expression vector is shown in SEQ ID NO:

1.

2. The method for constructing the recombinant Lactobacillus casei according to claim 1, wherein The method comprises the following steps: transforming the recombinant expression vector pPG612.1-SAG2A into Lactobacillus casei competent cells to obtain recombinant Lactobacillus casei.

3. The construction method according to claim 2, characterized in that: The Lactobacillus casei competent cell is L. casei 393.

4. The construction method according to claim 2, characterized in that: The construction method of the recombinant expression vector pPG612.1-SAG2A comprises the following steps: connecting the Toxoplasma gondii SAG2A gene to the cloning vector pEASY-T1 Simple to obtain the recombinant vector pEASY-T1 Simple-SAG2A; performing double enzyme digestion on the recombinant vector pEASY-T1 Simple-SAG2A and the lactic acid bacteria expression vector pPG612.1 to obtain a SAG2A fragment and a pPG612.1 vector fragment; connecting and transforming the SAG2A fragment and the pPG612.1 vector fragment to obtain the recombinant expression vector pPG612.1-SAG2A.

5. The construction method according to claim 4, characterized in that: The double enzyme digestion enzymes are restriction endonucleases BamHI and EcoRI.

6. Use of the recombinant Lactobacillus casei obtained by the recombinant Lactobacillus casei described in claim 1 or the recombinant Lactobacillus casei obtained by the construction method described in any one of claims 2 to 5 in the preparation of an anti-toxoplasmosis drug.

7. Use of the recombinant Lactobacillus casei obtained by the recombinant Lactobacillus casei described in claim 1 or the recombinant Lactobacillus casei obtained by the construction method described in any one of claims 2 to 5 in the preparation of a Toxoplasma gondii vaccine.

8. A drug for preventing toxoplasmosis, characterized in that: The drug comprises the recombinant Lactobacillus casei according to claim 1 or the recombinant Lactobacillus casei obtained by the construction method according to any one of claims 2-5.

9. The drug according to claim 8, characterized in that The dosage form of the drug includes tablets, granules, pills, capsules or oral liquids.

Images