Screening method of selenium-enriched saccharomycetes

Abstract

The invention discloses a screening method of selenium-enriched saccharomycetes. The method comprises the following steps: (1) mutagenesis of a starting strain; (2) carrying out gradient screening on the mutant strain by adopting a sulfur-free selenium-containing culture medium; and (3) carrying out pure culture and thallus concentration detection on the bacterial strain subjected to gradient screening to obtain a target bacterial strain. According to the screening method disclosed by the invention, a strain capable of efficiently utilizing selenium to replace sulfur to synthesize an intracellular functional product is obtained, and the breeding efficiency of selenium-enriched yeast is greatly improved.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial screening, and particularly relates to a method for screening selenium-enriched yeast. Background Art

[0002] Selenium (Se) is an indispensable trace element in organisms and plays an important physiological role. Most of the selenium that plays a physiological function exists in organisms in the form of selenoproteins. Selenium acts on the reactions catalyzed by enzymes in organisms and can protect biofilms. Literature reports that selenium has anti-cancer effects, antagonizes harmful metal elements that invade the body, and can also enhance the body's immunity and reproductive ability.

[0003] Yeast is the most widely used, safest and most effective nutritional microorganism. It is rich in protein, trace elements and other minerals, and is also rich in B vitamins (mainly vitamin B1 and B2).

[0004] Yeast can convert toxic inorganic selenium into non-toxic organic selenium during its growth. Supplementing selenium through selenium-enriched yeast is a safe and effective way, and is widely used in human pharmaceutical nutritional supplements and animal breeding.

[0005] At present, the selenium content of selenium-enriched yeast is generally 2000-3000 mg / kg (i.e. 2000-3000 ppm), and the absorption rate of inorganic selenium by selenium-enriched yeast strains is 50-70%. A large amount of inorganic selenium remains in the fermentation wastewater, which requires environmental protection treatment, increases the process operation cost and causes certain pollution to the environment. Therefore, it is particularly necessary to obtain a high absorption rate of inorganic selenium through strain breeding and reduce selenium emissions in fermentation wastewater. The existing strain screening method basically uses mutagenesis and high selenium concentration domestication for screening, which is cumbersome and inefficient. Summary of the invention

[0006] In view of the problems that the existing selenium-enriched yeast strains have a low absorption rate of inorganic selenium, and the screening method of selenium-enriched yeast is cumbersome and inefficient, the present invention uses plasma mutagenesis and then sulfur-free selenium-containing culture medium to screen selenium-enriched yeast for the first time, which greatly improves the screening efficiency. The inorganic selenium absorption rate of the screened strains reaches more than 91%, and the selenium content of the selenium-enriched yeast prepared by fermentation reaches 6100 mg / kg.

[0007] Specifically, the present invention proposes the following technical solutions:

[0008] In a first aspect, the present invention provides a method for screening selenium-enriched yeast, characterized in that the method comprises the following steps:

[0009] (1) Mutagenesis of the starting strain;

[0010] (2) The mutagenic strains were subjected to gradient screening using sulfur-free selenium-containing medium;

[0011] (3) After gradient screening, the strains are subjected to pure culture and bacterial concentration testing to obtain the target strains.

[0012] Preferably, the screening method is characterized in that, in step (1), the mutagenesis is selected from plasma mutagenesis;

[0013] Preferably, the plasma mutagenesis power is 60-180w;

[0014] and / or, the plasma mutagenesis gas flow rate is 8-12 L / min;

[0015] And / or, the mutagenesis time is 30-120s.

[0016] Preferably, the screening method is characterized in that in step (2), the sulfur-free selenium-containing medium comprises: glucose 5-40 g / L, ammonium chloride 1-10 g / L, potassium dihydrogen phosphate 0.1-2.0 g / L, magnesium chloride 0.01-0.5 g / L, potassium chloride 0.02-0.8 g / L, calcium chloride 0.01-0.2 g / L, zinc gluconate 0.02-0.3 g / L, copper chloride 0.05-0.8 mg / L, potassium iodide 0.01-0.9 mg / L / L, ferrous chloride 0.1-20mg / L, manganese chloride 0.02-0.9mg / L, sodium tetraborate 0.02-1.5mg / L, biotin 0.01-0.80mg / L, calcium pantothenate 0.1-10mg / L, inositol 0.01-15mg / L, riboflavin (VB2) 0.1-2mg / L, niacin (VB3) 0.2-10mg / L, pyridoxine (VB6) 0.02-3mg / L and sodium selenite 60-3000mg / L.

[0017] Preferably, the screening method is characterized in that, in step (2), the sulfur-free selenium-containing culture medium is sterilized by filtering through a 0.35-0.45 μm filter membrane.

[0018] Preferably, the screening method is characterized in that, in step (2), the induced strain is transferred to a sulfur-free selenium-containing medium for culture, and the concentration of sodium selenite is increased during the transfer process;

[0019] Preferably, the transfer is performed after 24-48 hours of each culture;

[0020] More preferably, the last transfer is performed by coating a selenium-containing solid culture medium plate, picking a single colony and then performing pure culture.

[0021] Preferably, the screening method is characterized in that in step (2), the culture temperature is 28-33°C and the rotation speed is 150-220 rpm for shaking culture.

[0022] Preferably, the screening method is characterized in that, in step (3), the strain obtained in step (2) is cultured and then the OD600 value is detected, and the strain with OD600 greater than 1.5 is selected as the target strain.

[0023] Preferably, the screening method is characterized in that in step (3), the culturing time is 45-50h;

[0024] And / or, the culture temperature is 28-30°C and the rotation speed is 150-220 rpm.

[0025] In a second aspect, the present invention provides a method for treating pollutants using selenium-rich yeast, characterized in that selenium-rich yeast is added to pollutants to absorb inorganic selenium to treat the pollutants, wherein the selenium-rich yeast is the selenium-rich yeast screened by the screening method for selenium-rich yeast.

[0026] Preferably, the method for treating pollutants using a selenium-enriched yeast strain is characterized in that the pollutants are sewage.

[0027] Beneficial effects of the present invention:

[0028] The present invention utilizes the property that brewer's yeast cannot grow in a culture medium without sulfur, and adopts plasma mutagenesis and sulfur-free selenium-containing culture medium to carry out directional breeding of selenium-enriched yeast strains, thereby obtaining strains that can efficiently use selenium to replace sulfur to synthesize intracellular functional products, thereby greatly improving the breeding efficiency of selenium-enriched yeast. The new selenium-enriched yeast strain has an absorption rate of more than 91% for inorganic selenium, which is a significant improvement compared to the current industry average absorption rate of 50-70%. It reduces selenium residues in fermentation wastewater, reduces process operating costs, and protects the environment. The screened selenium-enriched yeast strain can be added to selenium-rich pollutants to absorb inorganic selenium to treat pollutants.

[0029] Strain deposit information

[0030] The Saccharomyces cerevisiae SEMCX2Z1 strain provided by the present invention was deposited in the China Center for Type Culture Collection (CCTCC) on November 28, 2023, with a deposit number of CCTCC NO: M 20232369, and a deposit address: Wuhan University, Wuhan, China, Postal Code: 430072; Telephone: 027-68754052. DETAILED DESCRIPTION

[0031] The technical solution of the present invention is further described in detail below in conjunction with specific embodiments and comparative examples, but the present invention is not limited to the following technical solution.

[0032] The present invention adopts plasma mutagenesis combined with sulfur-free selenium-containing medium for the first time to screen selenium-enriched yeast, and its mechanism is: selenium and sulfur are elements of the same family and are also competitive elements. The two elements can replace each other when entering the strain cell to synthesize amino acids or other functional compounds, but most brewer's yeast strains have weak functions of replacing sulfur with selenium and cannot grow in sulfur-free selenium-containing medium. After plasma mutagenesis (mutagenesis is not limited to plasma mutagenesis, and conventional mutagenesis methods in the art can be used, such as ultraviolet mutagenesis and chemical mutagenesis, etc.), a large number of strains that do not produce positive mutations will die directly, and very few strains that produce positive mutations can grow in sulfur-free selenium-containing medium, indicating that these strains can efficiently use selenium to replace sulfur to synthesize intracellular functional products, and the faster the strain grows, the higher the absorption rate of selenium in theory, and the fast-growing strains are selected as target strains. This method can greatly improve the screening efficiency of selenium-enriched yeast strains.

[0033] The starting strain used for the screening of selenium-enriched yeast of the present invention is a strain of S. cerevisiae SEMCX2 isolated from a naturally fermented koji block of a winery in Jiujiang, Guangdong. The specific separation and purification method is: take 0.2g of koji block, add sterile water in turn according to the solid-liquid ratio of 1:10, 1:100, 1:1000, 1:10000 for dilution, take 50μl of dilutions of different concentrations, and spread them on YPD solid culture medium (sucrose 5%, yeast extract 2%, magnesium sulfate 0.1%, potassium dihydrogen phosphate 0.1%, agar powder 1.5%, add 50μg / ml ampicillin) with a coating rod, and after culturing in a 30°C incubator for 1-3 days, pick a milky white, large and thick, smooth, moist and sticky single colony, streak culture on YPD solid culture medium, repeat 2 times, and obtain a pure strain of yeast. The identification result of the strain is: the cell morphology of the strain is oval under an optical microscope, budding, and the single colony grown on the solid plate has a cheese-like texture, milky white color, smooth surface, and neat edges. The 26S rDNA gene was used for molecular biological identification and NCBI database comparison analysis, and the strain with the final identification number SEMCX2 was a Saccharomyces cerevisiae strain. The gene sequence of the 26S rDNA of the strain is shown in SEQ ID NO.1:

[0034] ACTCGTCTATGCCGCTCCTTGACTTACGTCGCAGTCCTCAGTCCCAGCT

[0035] GGAGATTCCCAAAGGTTATAATACTTACCGAGGCAAGTTACTTTCCTATG

[0036] GATTTATCCTGCCACCAAAACTGATGCTGGCCCAGGGAAAGGCAAAAT

[0037] TCCCCTACCCACAAGGAGCAAAGGGCACAAAACACCATGTCTGATCAA

[0038] AGGCCCTTCCCTTTCAACAATTTCACGAACTTTTTCACTCTCTTTTCAAA

[0039] GTTCTTTTCATCTTTCCATCACTGAACTTGTTCGCTATCGGCCTCTCGCC

[0040] AATATTTAGTTTTAAAGGGAATTTACCACCCACTTAAAGTTGCATTCCCA

[0041] AACAACTCGACTCTTCAAGGGCACTTTACAAAAAACCGCACTCCTCGC

[0042] CACACGGAATTCTCACCCTCTATGACGTCCTGTTCCAAGGAACATAAAC

[0043] AAGGAACGGCCCCAAAGTTGCCCTCTCCAAATTACAACTCGGGCACCG

[0044] AAGGAACCAAATTTCAAATTGAGCTTTTGCCGCTTCACTCGCCGTTAC

[0045] TAAGGCAATCCCGGTTGGTTTCTTTTCTTTTT

[0046] Unless otherwise specified, the various reagents and instruments used in the examples and comparative examples of the present invention are conventional commercially available products. The source information of the instruments and reagents used in the examples and comparative examples of the present invention is shown in Table 1 below.

[0047] Table 1

[0048]

[0049]

[0050] Example 1 Preparation of sulfur-free selenium-containing culture medium and screening of selenium-enriched yeast

[0051] Example 1-1

[0052] 1. Preparation of sulfur-free selenium-containing culture medium

[0053] (1) Preparation of sulfur-free and selenium-free culture medium

[0054] The culture medium includes: glucose 20g / L, ammonium chloride 5g / L, potassium dihydrogen phosphate 0.85g / L, magnesium chloride 0.2g / L, potassium chloride 0.4g / L, calcium chloride 0.1g / L, zinc gluconate 0.15g / L, copper chloride 0.6mg / L, potassium iodide 0.1mg / L, ferrous chloride 6mg / L, manganese chloride 0.4mg / L, sodium tetraborate 0.2mg / L, biotin 0.08mg / L, calcium pantothenate 3mg / L, inositol 2mg / L, riboflavin (VB2) 0.4mg / L, nicotinic acid (VB3) 4mg / L, pyridoxine (VB6) 0.75mg / L. The culture medium is obtained after sterilization by filtration with a 0.45um filter membrane.

[0055] (2) Preparation of 60 PPM sulfur-free and selenium-containing culture medium: 60 mg / L sodium selenite was added to the sulfur-free and selenium-free culture medium prepared in step (1), and the mixture was sterilized by filtration with a 0.45 um filter membrane.

[0056] (3) Preparation of 500 PPM sulfur-free and selenium-containing culture medium: 500 mg / L sodium selenite is added to the sulfur-free and selenium-free culture medium prepared in step (1), and the culture medium is sterilized by filtration through a 0.45 um filter membrane.

[0057] (4) Preparation of 1200 PPM sulfur-free and selenium-containing culture medium: 1200 mg / L sodium selenite is added to the sulfur-free and selenium-free culture medium prepared in step (1), and the culture medium is sterilized by filtration with a 0.45 um filter membrane.

[0058] (5) Preparation of 3000 PPM selenium-containing solid culture medium: Add 3000 mg / L sodium selenite to the sulfur-free and selenium-free culture medium prepared in step (1), filter and sterilize with a 0.45 um filter membrane, then add to sterilized hot agar with a final concentration of 1.5%, and cool to obtain.

[0059] 2. Screening of Selenium-enriched Yeast

[0060] (1) Mutagenesis of starting strain

[0061] From the brewer's yeast SEMCX2 slant strain, pick a loop and inoculate it in a test tube containing YPD medium. After culturing at 30℃ for 24 hours, take the bacterial solution and spread it on the slide. The coating amount of the slide is 20μl. EP tube is filled with 1ml of 60PPM sulfur-free and selenium-containing medium for plasma mutagenesis (ARTP mutagenesis). The mutagenesis power is 120w, the gas volume is 10L / min, and the mutagenesis time is 60s.

[0062] (2) Gradient screening of the mutagenic strain using the sulfur-free selenium-containing medium prepared in Example 1-1

[0063] a.60PPM sulfur-free selenium-containing medium culture

[0064] Take the mutagenesis EP tube and culture it at a temperature of 30°C and a rotation speed of 200 rpm for 24 hours; after the culture is completed, if there is no yeast growth under microscopic examination, repeat the mutagenesis and culture, if there is yeast growth under microscopic examination, proceed to the subsequent steps.

[0065] b.500PPM sulfur-free selenium-containing culture medium

[0066] Take 1 ml of culture solution a and inoculate it into 50 ml of 500 PPM sulfur-free selenium-containing fermentation medium, and culture it at a temperature of 30°C and a rotation speed of 200 rpm for 48 hours.

[0067] c.1200PPM sulfur-free selenium-containing culture medium

[0068] Take 1 ml of culture solution b and inoculate it into 50 ml of 500 PPM sulfur-free selenium-containing fermentation medium, and culture it at a temperature of 30°C and a rotation speed of 200 rpm for 48 hours.

[0069] d. 3000PPM selenium-containing solid culture medium coating

[0070] Take 1 ml of culture medium c and dilute it 10,000 times with sterile water. Take 50 μl of the diluted bacterial solution and spread it on a 3000 PPM selenium-containing solid culture medium plate. The culture temperature in the biochemical incubator is 30°C. Observe the growth of the colonies every 24 hours. Colonies will appear in about 96-120 hours. The colony morphology is white oval with a protrusion in the middle.

[0071] (3) The strains after gradient screening are subjected to pure culture and screening.

[0072] Pick multiple single colonies on the 3000PPM selenium-containing solid culture medium plate, inoculate them into 1200PPM sulfur-free selenium-containing culture medium, culture them at 30°C, 200RPM, and culture them for 48 hours. After the culture is completed, take 200μl of the fermentation liquid, transfer it into a 96-well plate, put it into a microplate spectrophotometer, select a wavelength of 600nm, and measure the optical density, i.e., the OD600 value. Select strains with OD600 greater than 1.5 for seed preservation. The obtained strains can grow in sulfur-free selenium-containing culture medium and can efficiently use selenium to replace sulfur.

[0073] Example 1-2

[0074] 1. Preparation of sulfur-free selenium-containing culture medium

[0075] (1) Preparation of sulfur-free and selenium-free culture medium

[0076] The culture medium includes: glucose 5g / L, ammonium chloride 1g / L, potassium dihydrogen phosphate 0.1g / L, magnesium chloride 0.01g / L, potassium chloride 0.02g / L, calcium chloride 0.01g / L, zinc gluconate 0.02g / L, copper chloride 0.05mg / L, potassium iodide 0.01mg / L, ferrous chloride 0.1mg / L, manganese chloride 0.02mg / L, sodium tetraborate 0.02mg / L, biotin 0.01mg / L, calcium pantothenate 0.1mg / L, inositol 0.01mg / L, riboflavin (VB2) 0.1mg / L, nicotinic acid (VB3) 0.2mg / L, pyridoxine (VB6) 0.02mg / L. It is obtained after sterilization by filtration through a 0.35um filter membrane.

[0077] (2) Preparation of 60 PPM sulfur-free and selenium-containing culture medium: Add 60 mg / L sodium selenite to the sulfur-free and selenium-free culture medium prepared in step (1), and filter and sterilize through 0.35 um filter membrane to obtain the culture medium.

[0078] (3) Preparation of 500 PPM sulfur-free and selenium-containing culture medium: 500 mg / L sodium selenite is added to the sulfur-free and selenium-free culture medium prepared in step (1), and the culture medium is sterilized by filtration through a 0.35 um filter membrane.

[0079] (4) Preparation of 1200 PPM sulfur-free and selenium-containing culture medium: 1200 mg / L sodium selenite is added to the sulfur-free and selenium-free culture medium prepared in step (1), and the culture medium is sterilized by filtration with a 0.35 um filter membrane.

[0080] (5) Preparation of 3000 PPM selenium-containing solid culture medium: Add 3000 mg / L sodium selenite to the sulfur-free and selenium-free culture medium prepared in step (1), filter and sterilize with a 0.35 um filter membrane, then add to sterilized hot agar with a final concentration of 1.5%, and obtain after cooling.

[0081] 2. Screening of Selenium-enriched Yeast

[0082] (1) Mutagenesis of starting strain

[0083] From the SemCX2 slant strain of Saccharomyces cerevisiae, a loop was picked and inoculated into a test tube containing YPD medium. After culturing at 30°C for 24 hours, the bacterial solution was taken and smeared on the slide. The coating amount of the slide was 20μl. EP tube was filled with 1ml of 60PPM selenium-containing medium for plasma mutagenesis (ARTP mutagenesis). The mutagenesis power was 60w, the gas volume was 8L / min, and the mutagenesis time was 120s.

[0084] (2) Gradient screening of the mutagenic strain using the sulfur-free selenium-containing medium prepared in Example 1-2

[0085] a.60PPM sulfur-free selenium-containing medium culture

[0086] The mutagenesis EP tube was incubated at 28°C and 150 rpm for 24 hours. After the incubation, if no yeast growth was observed under microscopic examination, the mutagenesis and incubation were repeated. If yeast growth was observed under microscopic examination, the subsequent steps were performed.

[0087] b.500PPM sulfur-free selenium-containing culture medium

[0088] Take 1 ml of culture solution a and inoculate it into 50 ml of 500 PPM sulfur-free selenium-containing fermentation medium, and culture it at a temperature of 28°C and a rotation speed of 150 rpm for 48 hours.

[0089] c.1200PPM sulfur-free selenium-containing culture medium

[0090] Take 1 ml of culture solution b and inoculate it into 50 ml of 500 PPM sulfur-free and selenium-containing fermentation medium, and culture it at a temperature of 28°C and a rotation speed of 150 rpm for 48 hours.

[0091] d. 3000PPM selenium-containing solid culture medium coating

[0092] Take 1 ml of culture medium c and dilute it 10,000 times with sterile water. Take 50 μl of the diluted bacterial solution and spread it on a 3000 PPM selenium-containing solid culture medium plate. The culture temperature in the biochemical incubator is 28°C. Observe the growth of the colonies every 24 hours. Colonies will appear in about 96-120 hours. The colony morphology is white oval with a protrusion in the middle.

[0093] (3) Cultivate and screen the strains after gradient screening.

[0094] Pick multiple single colonies on the 3000PPM selenium-containing solid culture medium plate, inoculate them into 1200PPM sulfur-free selenium-containing culture medium, culture them at 28°C, 150RPM, and culture them for 45 hours. After the culture is completed, take 200μl of the fermentation liquid, transfer it into a 96-well plate, put it into a microplate spectrophotometer, select a wavelength of 600nm, and measure the optical density, i.e., the OD600 value. Select strains with an OD600 value greater than 1.5 for seed preservation. The obtained strains can grow in sulfur-free selenium-containing culture medium and can efficiently use selenium to replace sulfur.

[0095] Examples 1-3

[0096] 1. Preparation of sulfur-free selenium-containing culture medium

[0097] (1) Preparation of sulfur-free and selenium-free culture medium

[0098] The culture medium includes: glucose 40g / L, ammonium chloride 10g / L, potassium dihydrogen phosphate 2.0g / L, magnesium chloride 0.5g / L, potassium chloride 0.8g / L, calcium chloride 0.2g / L, zinc gluconate 0.3g / L, copper chloride 0.8mg / L, potassium iodide 0.9mg / L, ferrous chloride 20mg / L, manganese chloride 0.9mg / L, sodium tetraborate 1.5mg / L, biotin 0.80mg / L, calcium pantothenate 10mg / L, inositol 15mg / L, riboflavin (VB2) 2mg / L, nicotinic acid (VB3) 10mg / L, pyridoxine (VB6) 3mg / L. It is obtained after sterilization by filtration with a 0.45um filter membrane.

[0099] (2) Preparation of 60 PPM sulfur-free and selenium-containing culture medium: 60 mg / L sodium selenite was added to the sulfur-free and selenium-free culture medium prepared in step (1), and the mixture was sterilized by filtration with a 0.45 um filter membrane.

[0100] (3) Preparation of 500 PPM sulfur-free and selenium-containing culture medium: 500 mg / L sodium selenite is added to the sulfur-free and selenium-free culture medium prepared in step (1), and the culture medium is sterilized by filtration through a 0.45 um filter membrane.

[0101] (4) Preparation of 1200 PPM sulfur-free and selenium-containing culture medium: 1200 mg / L sodium selenite is added to the sulfur-free and selenium-free culture medium prepared in step (1), and the culture medium is sterilized by filtration with a 0.45 um filter membrane.

[0102] (5) Preparation of 3000 PPM selenium-containing solid culture medium: Add 3000 mg / L sodium selenite to the sulfur-free and selenium-free culture medium prepared in step (1), filter and sterilize with a 0.45 um filter membrane, then add to sterilized hot agar with a final concentration of 1.5%, and cool to obtain.

[0103] 2. Screening of Selenium-enriched Yeast

[0104] (1) Mutagenesis of starting strain

[0105] From the SEMCX2 slant strain of Saccharomyces cerevisiae, a loop was picked and inoculated into a test tube containing YPD medium. After culturing at 30°C for 24 hours, the bacterial solution was taken and smeared on the slide. The coating amount of the slide was 20μl. EP tube was filled with 1ml of 60PPM sulfur-free and selenium-containing medium for plasma mutagenesis (ARTP mutagenesis). The mutagenesis power was 180w, the gas volume was 12L / min, and the mutagenesis time was 30s.

[0106] (2) Gradient screening of the mutagenic strain using the sulfur-free selenium-containing medium prepared in Example 1-3

[0107] a.60PPM sulfur-free selenium-containing medium culture

[0108] The EP tube for mutagenesis was incubated at 33°C and 220 rpm for 24 hours. After the incubation, if no yeast growth was observed under microscopic examination, the mutagenesis and incubation were repeated. If yeast growth was observed under microscopic examination, the subsequent steps were performed.

[0109] b.500PPM sulfur-free selenium-containing culture medium

[0110] Take 1 ml of culture solution a and inoculate it into 50 ml of 500 PPM sulfur-free selenium-containing fermentation medium, and culture it at a temperature of 33°C and a rotation speed of 220 rpm for 48 hours.

[0111] c.1200PPM sulfur-free selenium-containing culture medium

[0112] Take 1 ml of culture solution b and inoculate it into 50 ml of 500 PPM sulfur-free and selenium-containing fermentation medium, and culture it at a temperature of 33°C and a rotation speed of 220 rpm for 48 hours.

[0113] d. 3000PPM selenium-containing solid culture medium coating

[0114] Take 1 ml of culture medium c and dilute it 10,000 times with sterile water. Take 50 μl of the diluted bacterial solution and spread it on a 3000 PPM selenium-containing solid culture medium plate. The culture temperature in the biochemical incubator is 33°C. Observe the growth of the colonies every 24 hours. Colonies will grow in about 96-120 hours. The colony morphology is white oval with a protrusion in the middle.

[0115] (3) The strains after gradient screening are subjected to pure culture and screening.

[0116] Pick multiple single colonies on the 3000PPM selenium-containing solid culture medium plate, inoculate them into 1200PPM sulfur-free selenium-containing culture medium, culture them at 30°C, 220RPM, and culture them for 50 hours. After the culture is completed, take 200μl of the fermentation liquid, transfer it into a 96-well plate, put it into a microplate spectrophotometer, select a wavelength of 600nm, and measure the optical density, i.e., the OD600 value. Select strains with OD600 greater than 1.5 for seed preservation. The obtained strains can grow in sulfur-free selenium-containing culture medium and can efficiently use selenium to replace sulfur.

[0117] A strain with an OD600 value of 1.89 was screened in Examples 1-1, 1-2 and 1-3, which has the highest OD600 value among all the selected strains, and was named Saccharomyces cerevisiae SEMCX2Z1 strain. The strain was deposited in the China Center for Type Culture Collection (CCTCC) on November 28, 2023, with a deposit number of CCTCC NO: M20232369, and a deposit address: Wuhan University, Wuhan, China, Postal Code: 430072; Telephone: 027-68754052.

[0118] Example 2 Determination of Inorganic Selenium Absorption Rate and Total Selenium Content of Bacteria

[0119] From the slant strain of Saccharomyces cerevisiae SEMCX2Z1, a loop was inoculated into a test tube containing 10 ml 60 PPM sulfur-free selenium-containing medium prepared in Example 1-1, and the culture temperature was 30 ° C, the rotation speed was 200 rpm, and after culturing for 24 hours, a test tube seed solution was obtained. Take 5 ml of the test tube seed solution and inoculate it into a shake flask containing 500 ml 60 PPM sulfur-free selenium-containing medium for cultivation, the culture temperature was 30 ° C, the rotation speed was 200 RPM, and the culture was cultured for 24 hours to obtain a shake flask seed solution. All 500 ml of the shake flask seeds were inoculated into a 50L fermenter for cultivation. Prepare 16L of bottom water in the fermenter in advance.

[0120] The Saccharomyces cerevisiae SEMCX2Z1 in the fermentation tank was subjected to selenium-enriched culture, and the selenium-enriched culture used a sulfur-free selenium-containing medium, which was added to a 50L fermentation tank containing the fermentation liquid of the Saccharomyces cerevisiae SEMCX2Z1 strain by a feeding method. The selenium-enriched medium included: sulfur-free nutrient elements, 2L of 9g / L sodium selenite, 34.6% by mass of glucose and 24.8% by mass of ammonia water, which were added according to the needs of yeast growth.

[0121] Sulfur-free nutrient elements, measured in grams (g) per liter of volume, include 50g / L diammonium phosphate, 17.5g / L calcium chloride, 0.035g / L manganese chloride, 17.5g / L magnesium chloride, 0.02g / L ammonium molybdate, 6g / L zinc gluconate, 0.35g / L ferrous chloride, 0.01g / L potassium iodide, 0.05g / L sodium tetraborate, 0.035g / L cupric chloride, 12g / L threonine, 5g / L serine, 8g / L lysine, 12g / L glutamic acid, 12g / L alanine, 0.005g / L biotin, 0.025g / L riboflavin (VB2), 0.05g / L pyridoxine (VB6), 0.5g / L niacin (B3) and 0.2g / L calcium pantothenate (VB5), with a total of 2L.

[0122] Calculated per liter of fermentation liquid during fermentation culture, the amount of sulfur-free nutrient elements added is 20-60 ml / h, the amount of 9 g / L sodium selenite added is 17-54 ml / h, and the amount of glucose added is 10-30 ml / h with a mass percentage of 34.6%. The amount of added gradually increases as the fermentation proceeds. By adding 24.8% ammonia water by mass, the pH is adjusted to 4.0-6.0, and the pH gradually increases during the fermentation process. After the yeast is cultured at a temperature of 28°C for 28 hours, the fermentation liquid is centrifuged at 5000 rpm, the heavy phase is taken, and an equal volume of water is added for washing once, and the selenium-enriched yeast is obtained by spray drying, and the dry weight of the selenium-enriched yeast is 1.23 kg.

[0123] The total selenium content (mg / kg) and inorganic selenium absorption rate (%) of selenium-enriched yeast are shown in Table 2, and the calculation method is as follows.

[0124] For the detection method of total selenium content in selenium-enriched yeast, please refer to the first method hydride atomic fluorescence spectrometry in GB5009.93-2017.

[0125] Inorganic selenium absorption rate (%) = (dry weight of selenium-enriched yeast * total selenium content of selenium-enriched yeast / 1000) / (mass of added sodium selenite * 78.96 / 172.94) * 100;

[0126] The unit of dry weight of selenium-enriched yeast is kg, the unit of total selenium content in selenium-enriched yeast is mg / kg, and the unit of mass of added sodium selenite is g.

[0127] Table 2

[0128]

[0129] As can be seen from Table 2, the S. cerevisiae SEMCX2Z1 strain can efficiently utilize selenium to replace sulfur to synthesize intracellular functional products, the strain's absorption rate of inorganic selenium is ≥91%, and the selenium content of the obtained selenium-enriched yeast is 6100 mg / kg.

[0130] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for screening selenium-enriched yeast, characterized in that: The method comprises the following steps: (1) Mutagenesis of the starting strain; (2) The mutagenic strains were subjected to gradient screening using sulfur-free selenium-containing medium; (3) After gradient screening, the strains are subjected to pure culture and bacterial concentration testing to obtain the target strains.

2. The screening method according to claim 1, characterized in that In step (1), the mutagenesis is selected from plasma mutagenesis; Preferably, the plasma mutagenesis power is 60-180w; and / or, the plasma mutagenesis gas flow rate is 8-12 L / min; And / or, the mutagenesis time is 30-120s.

3. The screening method according to claim 1 or 2, characterized in that In step (2), the sulfur-free selenium-containing medium comprises: 5-40 g / L glucose, 1-10 g / L ammonium chloride, 0.1-2.0 g / L potassium dihydrogen phosphate, 0.01-0.5 g / L magnesium chloride, 0.02-0.8 g / L potassium chloride, 0.01-0.2 g / L calcium chloride, 0.02-0.3 g / L zinc gluconate, 0.05-0.8 mg / L cupric chloride, 0.01-0.9 mg / L potassium iodide, 0. 1-20mg / L, manganese chloride 0.02-0.9mg / L, sodium tetraborate 0.02-1.5mg / L, biotin 0.01-0.80mg / L, calcium pantothenate 0.1-10mg / L, inositol 0.01-15mg / L, riboflavin (VB2) 0.1-2mg / L, niacin (VB3) 0.2-10mg / L, pyridoxine (VB6) 0.02-3mg / L and sodium selenite 60-3000mg / L.

4. The screening method according to any one of claims 1 to 3, characterized in that In step (2), the sulfur-free selenium-containing culture medium is sterilized by filtration through a 0.35-0.45 μm filter membrane.

5. The screening method according to any one of claims 1 to 4, characterized in that In step (2), the induced strain is transferred to a sulfur-free selenium-containing medium for culture, and the concentration of sodium selenite is increased during the transfer process; Preferably, the transfer is performed after 24-48 hours of each culture; More preferably, the last transfer is performed by coating a selenium-containing solid culture medium plate, picking a single colony and then performing pure culture.

6. The screening method according to any one of claims 1 to 5, characterized in that In step (2), the culture temperature is 28-33°C and the rotation speed is 150-220 rpm.

7. The screening method according to any one of claims 1 to 6, characterized in that In step (3), the strain obtained in step (2) is cultured and the OD600 value is detected, and the strain with OD600 greater than 1.5 is selected as the target strain.

8. The screening method according to any one of claims 1 to 7, characterized in that In step (3), the culture time is 45-50 hours; And / or, the culture temperature is 28-30°C and the rotation speed is 150-220 rpm.

9. A method for treating pollutants using selenium-enriched yeast, characterized in that: The selenium-enriched yeast is added to the pollutants to absorb inorganic selenium to treat the pollutants, wherein the selenium-enriched yeast is the selenium-enriched yeast obtained by the method according to any one of claims 1-8.

10. The method for treating pollutants using selenium-enriched yeast strains according to claim 9, characterized in that: The pollutant is sewage.

Images