Starch synthesis regulation gene OsMFP1 as well as encoding protein and application thereof

Abstract

The invention relates to a starch synthesis regulatory gene OsMFP1 as well as an encoded protein and application thereof, and belongs to the technical field of plant genetic engineering, the gene has a nucleotide sequence as shown in SEQ ID NO.1, and the encoded protein has an amino acid sequence as shown in SEQ ID NO.2. The function loss of the gene OsMFP1 leads to the reduction of the total starch content, the amylose content and the amylopectin content in rice grains, and leads to the reduction of the rice yield. The function and action mechanism of the OsMFP1 gene in the starch synthesis process are researched, it is found that the content of total starch, amylose and amylopectin in grains is reduced due to function deletion of the OsMFP1 gene, and the important theoretical value is provided for improvement of the rice quality.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a starch synthesis regulating gene OsMFP1 and a coded protein and application thereof. Background Art

[0002] Rice is an important food crop, and more than half of the world's population relies on rice as their staple food. With the development of social economy and the change of people's dietary structure, the demand for rice yield has increased, and higher requirements have been placed on its quality. Starch is an important component of rice grains, and its content and structure affect the yield and quality of rice. Although there have been many reports on the research of starch synthesis pathways and transcriptional regulation, there are few reports on the key regulatory proteins of starch synthesis.

[0003] Currently, in Arabidopsis, it has been found that thylakoid-associated MAR-binding filamentous protein is involved in the initiation of starch granules in leaves, but the function and mechanism of action of this protein in rice are still unclear. Based on the above research status, the present invention proposes a starch synthesis regulatory gene OsMFP1 and its encoded protein and application. Summary of the invention

[0004] The purpose of the present invention is to provide a starch synthesis regulatory gene OsMFP1 and its encoded protein and application in order to solve the above problems.

[0005] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0006] The present invention provides a starch synthesis regulating gene OsMFP1, which has a nucleotide sequence as shown in SEQ ID NO.1.

[0007] The present invention also provides a protein encoded by the gene OsMFP1, which has an amino acid sequence as shown in SEQ ID NO.2.

[0008] The present invention also provides an application of the gene OsMFP1 in regulating starch synthesis in rice grains.

[0009] Specifically, the starch is total starch, amylose and amylopectin in rice grains.

[0010] Specifically, the gene OsMFP1 plays a positive regulatory role in starch synthesis in rice grains.

[0011] Specifically, the functional loss of the gene OsMFP1 leads to a decrease in the total starch content, amylose content, and amylopectin content in rice grains.

[0012] The present invention also provides an application of the gene OsMFP1 in regulating rice yield.

[0013] Specifically, the gene OsMFP1 plays a positive regulatory role in rice yield.

[0014] Specifically, loss of function of the gene OsMFP1 resulted in reduced rice yield.

[0015] The beneficial effects of the present invention are:

[0016] The present invention identified a thylakoid-associated MAR filamentous binding protein from rice, named OsMFP1, obtained rice knockout mutant plants using CRISPR-Cas9 technology, and studied its function and mechanism in the starch synthesis process. It was found that the functional loss of the OsMFP1 gene would advance the heading time of rice and reduce the number of tillers. The morphology of starch granules in rice grains and the chain length distribution of amylopectin in the endosperm were also affected by the functional loss of the OsMFP1 gene. The regulatory effect of the functional loss of the OsMFP1 gene on starch synthesis in rice grains was manifested as a decrease in the total starch, straight-chain and amylopectin contents in the grains, and an increase in the contents of soluble and reducing sugars. The above findings of the present invention provide important theoretical value for improving rice yield and quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The tissue expression pattern of OsMFP1 gene (A: OsMFP1 gene heat map analysis, B: OsMFP1 gene tissue expression pattern analysis);

[0018] Figure 2 Biological information analysis of OsMFP1 gene (A: OsMFP1 amino acid sequence alignment, B: OsMFP1 gene phylogenetic tree analysis);

[0019] Figure 3 Analysis of subcellular localization of OsMFP1 (A: empty vector control, B: subcellular localization of OsMFP1-GFP in rice protoplasts (scale bar: 10 μm));

[0020] Figure 4 To verify the OsMFP1 rice mutant;

[0021] Figure 5 Phenotypic analysis of the mfp1 rice mutant (A: phenotype of the mfp1 mutant, B: panicle length, number of grains per panicle, and number of tillers of the mfp1 mutant);

[0022] Figure 6 Analysis of grain traits of mfp1 rice mutant (A: grain phenotype of mfp1 mutant, B: length, width, thickness and 100-grain weight of mfp1 mutant);

[0023] Figure 7Analysis of the morphology and structure of starch granules in the endosperm of the mfp1 rice mutant (A: grain phenotype, B: cross section of grain, C: iodine staining experiment, D: SEM analysis of the blue box, E: SEM analysis of the red box, F: TEM analysis of the blue box, G: TEM analysis of the red box);

[0024] Figure 8 Analysis of the composition of rice grains of the mfp1 mutant (A: total starch content, B: amylose content; C: amylopectin content, D: reducing sugar content, E: soluble sugar content, F: protein content);

[0025] Fig. 9 Analysis of the gelatinization characteristics of the mfp1 rice mutant (A: gelatinization characteristics of WT and mfp1 starch, B: swelling volume of starch in urea);

[0026] Fig.10 Analysis of amylopectin chain length distribution in mfp1 mutant grains (A: amylopectin chain length distribution between WT and mfp1, B: difference in amylopectin chain length distribution between WT and mfp1). DETAILED DESCRIPTION

[0027] The present application is described in further detail below. It is necessary to point out that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technicians in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0028] 1. Materials

[0029] Unless otherwise specified, the methods used in the present invention are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified.

[0030] The total starch and protein determinations were both performed using kits from Nanjing Jiancheng Bioengineering Research Institute, the amylose determination was based on the Megazyme measurement standard, the amylopectin determination was performed using a kit from Beijing Solebold Technology Co., Ltd., the soluble sugar determination was performed using a kit from Nanjing Jiancheng Bioengineering Research Institute, and the reducing sugar determination was performed using a kit from Beijing Solebold Technology Co., Ltd.

[0031] 2. Methods and Conclusions

[0032] 1. Analysis of tissue expression pattern of OsMFP1 gene

[0033] Through transcriptome sequencing technology, we screened and identified a key gene OSMFP1 in rice that may affect starch synthesis. We used the Rice Expression Database (https: / / expression.ic4r.org / ) database website for data analysis and obtained the expression data prediction of OsMFP1 in various rice tissues. The prediction results are as follows: Figure 1 As shown in A, OsMFP1 is highly expressed in rice leaves and mature seeds.

[0034] In order to verify the accuracy of the data, we collected the root, stem and leaves at the three-leaf stage, the root, stem and leaves at the heading stage, the husks and anthers at the heading stage, and the grains at different stages after pollination. RNA was extracted from the above tissues and reverse transcribed into cDNA. The relative expression levels of OsMFP1 in various organs and tissues of rice were analyzed by fluorescence quantitative PCR.

[0035] The primers used for fluorescence quantitative PCR are:

[0036] SEQ ID NO.3: OsMFP1 quantification-F CAGGAATCGAGGGGATGCTC;

[0037] SEQ ID NO.4: OsMFP1 quantification-R TGTCGTGGGTACTACTCCGT;

[0038] The internal reference gene used is OsActin, and the corresponding primers are:

[0039] SEQ ID NO.5: OsActin-F CTGACGGAGCGTGGTTACTCAT;

[0040] SEQ ID NO.6: OsActin-R TGGTCTTGGCAGTCTTCCATTC;

[0041] The results are as follows Figure 1 As shown in B, the results of tissue expression pattern analysis were consistent with the heat map, and the expression level of OsMFP1 was high in leaves and grains 15 days after pollination.

[0042] 2. Biological information analysis of OsMFP1 gene

[0043] Bioinformatics analysis was performed on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), and the DNA sequence of the OsMFP1 gene was 4750 bp in length, of which the CDS sequence was 2301 bp in length, encoding 766 amino acids, such as Figure 2As shown in A, it contains a thylakoid Tat signal sequence and a short transmembrane domain with a long coiled coil domain. The homologous proteins of OsMFP1 in different species were retrieved by BLASTp function in NCBI, and the domain sequences of these genes were compared and the evolutionary tree was constructed to explore the relationship between OsMFP1 and other higher plant homologs. The results are shown in Figure 2 As shown in B, MFP1 has two homologous genes in maize and Arabidopsis, which are highly similar, and the ones in rice are named OsMFP1 and OsMFP2. Phylogenetic tree analysis results show that these genes are closely homologous.

[0044] 3. Subcellular localization analysis of OsMFP1

[0045] In order to detect the subcellular localization of OsMFP1, the pCAMBIA1305 vector (hereinafter referred to as 1305) containing GFP signal was used. According to the vector map, two restriction sites were selected on the vector (SpeⅠ and BamHI were selected in the experiment) for double restriction digestion. After obtaining the target band of OsMFP1 gene by PCR and gel recovery, the homologous arms were added to the primers of cloning genes (the stop codon was removed) by homologous recombination method, and the 35S-OsMFP1-GFP expression vector was successfully constructed.

[0046] The primer sequences used in the homologous recombination process are as follows:

[0047] SEQ ID NO.7:

[0048] p1305-OsMFP1-F ggacagcccagatcaactagtATGGGGTACCTCCTCCTCGC;

[0049] SEQ ID NO.8:

[0050] p1305-OsMFP1-R gcccttgctcaccatggatccCGTTGATGCACCACCTTTTCT;

[0051] The recombinant vector was transferred into rice protoplasts through PEG-mediated transfer, and P1305 empty vector was used as control. After two days of dark culture, the cells were observed under a confocal microscope. Figure 3 As shown, the co-localization results of the GFP signal of the OsMFP1-GFP fusion protein and the chloroplast II autofluorescence signal indicated that OsMFP1 was localized in the chloroplasts in the cytoplasm.

[0052] 4. Validation of OsMFP1 knockout rice mutant by CRISPR / cas9 gene editing

[0053] In order to analyze the biological function of the OsMFP1 gene in rice, Weimi Biotechnology Co., Ltd. was commissioned to construct and obtain the F1 generation seeds of the OsMFP1 mutant, and then self-pollinate for multiple generations. DNA was extracted from the leaves of the material at the three-leaf stage, and specific primers were designed for PCR amplification.

[0054] The primer sequences are as follows:

[0055] SEQ ID NO.9: osmfp1-identification-F CGAACCCTGTCGTGGTCTAC;

[0056] SEQ ID NO.10: osmfp1-identification-R TGTGTATGCATGCAAAGATGGT;

[0057] SEQ ID NO.11: osflo6-identification-F ATGCTCCCCCTCCTCCTCC;

[0058] SEQ ID NO.12: osflo6-identification-R TCAAGTGACAGTCAGAAGGTTGTTT;

[0059] The PCR products were sent to the company for sequencing, and the sequencing results were compared with the CDS sequences downloaded from the gene library. The results showed that the two mutant strains obtained were homozygous mutant strains, named mfp1-1 and mfp1-2 (in the wild-type genetic background of Zhonghua 11). Figure 4 As shown, mfp1-1 and mfp1-2 lack one adenine (A) and two adenines (A), respectively, in the second exon of the gene sequence, resulting in frameshift and premature termination of translation.

[0060] 5. Analysis of agronomic traits of the mfp1 rice mutant

[0061] The two mutant lines and the wild type (Zhonghua 11) were planted at the same time. After the entire growth cycle was completed, the agronomic traits of the wild type and mutant obtained in the test field and the greenhouse barrels were observed separately. Figure 5 As shown in A, it can be seen in the rice barrel that both mfp1-1 and mfp1-2 headed earlier than the wild type, about 3 days earlier. In addition, the two mutants obtained in the experimental field had no significant difference in panicle length and number of grains per panicle compared with the wild type. Since the number of tillers is one of the factors affecting yield, the number of tillers of the wild type and mutants was investigated. The number of tillers of the wild type and mutants was counted in the experimental field. The two mutants had significantly lower tiller numbers than the wild type. The wild type has 20 tillers, and mfp1-1 and mfp1-2 have 8 and 7 fewer tillers, respectively, compared with the wild type ( Figure 5 B).

[0062] When investigating the grain traits of wild-type and mutants, 100 rice seeds were selected for the investigation of grain length, width and 100-grain weight. The length and width data of the rice seeds were obtained using an A3 Scanner purple light scanner, and the 100-grain weight of the rice seeds was weighed using a balance. For the investigation of grain thickness, 50 seeds were selected and the grain thickness of the rice seeds was measured using a vernier caliper. The results of the investigation after three biological replicates and three technical replicates were as follows: Figure 6 As shown, there were no significant differences in grain length, width, thickness and 100-grain weight between the mfp1-1 and mfp1-2 mutants and the wild type.

[0063] The above results indicate that the OsMFP1 gene has a certain effect on rice yield.

[0064] 6. Analysis of starch granule morphology and structure in endosperm of mfp1 rice mutant

[0065] Since the grain size of the mutant plants was changed, it was suggested that MFP1 might regulate the grain development process. Based on this, the structure of starch granules in the mutant rice grains was further studied. The grain phenotypes of the wild type and the two mutant plants were as follows: Figure 7 A. The wild type and two mutant plants were cross-sectioned, and the results were as follows Figure 7 As shown in B, about 75% of the endosperm of the mature grains of the mfp1-1 and mfp1-2 mutants is opaque, and the surface of the grains appears chalky after cross-section. Subsequently, iodine staining experiments were performed on wild-type and mutant plants, and the results are shown in Figure 2. Figure 7 As shown in C, both the wild type and the mutant are purple-red, but the color of the two mutants is lighter than that of the wild type, indicating that the starch content in the grain is affected by the mutation.

[0066] Since the mutants had changed their grain morphology, we further investigated the structural changes of starch granules. We selected two parts of the mature grains, the transparent (blue mark) and the chalky (red mark), for scanning electron microscopy observation. The results showed that the arrangement of starch granules in the transparent part and the chalky part of the endosperm was significantly different. The starch granules in the transparent part of the wild type and the two mutants were arranged regularly and tightly ( Figure 7 D), while the gaps between starch granules in the chalky part of wild-type rice grains were enlarged, and the starch granules in the chalky part of the two mutants were abnormally shaped and mostly appeared as spheres of different sizes, resulting in a loose arrangement of starch granules ( Figure 7 E), which may be the reason for the chalkiness. Transmission electron microscopy observation of the endosperm 18 days after pollination showed that the starch granules in the transparent part of the wild type and the two mutants developed an elliptical shape ( Figure 7F), the starch granules in the chalky part of the two mutants mostly showed fragmented development, and the gaps between the starch granules of the two mutants were large compared with the wild type ( Figure 7 G).

[0067] The above results indicate that the structure of starch granules in rice grains is affected to a certain extent during the development of the mfp1 mutant.

[0068] 7. Analysis of grain composition of mfp1 mutant

[0069] To further explore the reasons for the changes in the morphology of mutant grains and the structure of starch granules, the grain composition of wild-type and mutant plants was analyzed. The total starch, amylose, amylopectin, total protein, soluble sugar and reducing sugar contents of mature wild-type (Zhonghua 11) and mfp1-1 and mfp1-2 homozygous mutant rice grains were determined. Figure 8 As shown in AC, the total starch content in Zhonghua 11 was 73.12%, and the total starch content in the mfp1-1 mutant was 63.38%, which decreased by about 10%, and the total starch content in the mfp1-2 mutant decreased by about 11%. There were also significant differences in the amylose content in the grains of the mfp1-1 and mfp1-2 mutants, accounting for 10.76% and 12.07% in the grains, and the two mutants decreased by about 3% and 2% respectively compared with the wild type. Similarly, there were significant differences in the content of amylopectin. The wild type had amylopectin content of 60.36%, and the two mutants decreased by about 8% and 12% respectively compared with the wild type. The above results are consistent with the conclusions drawn from the iodine staining experiment.

[0070] The reducing sugar content, soluble sugar content and protein content in the wild-type grains and mutant grains were detected respectively. Figure 8 As shown in DF, the contents of reducing sugar and soluble sugar in the two mutants were significantly higher than those in the wild type, while the protein content in the two mutants was not significantly different from that in the wild type. Since sugar is the synthetic substrate of starch, and the sugar content in the mutants is higher than that in the wild type, the starch content in the mutants decreased.

[0071] The above results indicate that the OsMFP1 gene affects the synthesis of starch in grains.

[0072] 8. Analysis of gelatinization characteristics of mfp1 mutant

[0073] Since the starch content in the endosperm of the mfp1-1 and mfp1-2 mutant rice changes, and the change in starch content will change the gelatinization characteristics of rice and thus change the cooking quality, based on this, the gelatinization characteristics of the mutant rice were further studied. The starch was mixed with urea of ​​different concentrations in the urea gelatinization experiment to measure the solubility of starch in the urea solution, and the swelling volume of the mutant and the wild type in the urea solution was calculated. The results are shown in Figure 2. Fig. 9 As shown in A, compared with the wild type, mfp1-1 and mfp1-2 showed the greatest difference under the treatment condition of 5 mol / L urea, such as Fig. 9 As shown in B, both the wild type and the mutants were difficult to dissolve in 0-4 mol / L urea. The solubility of the wild type reached a maximum at 6 mol / L and then stabilized, while the solubility of the mfp1-1 and mfp1-2 mutants reached a maximum at 7 mol / L and then stabilized.

[0074] The above results indicate that the OsMFP1 gene affects the gelatinization characteristics of rice.

[0075] 9. Analysis of chain length distribution of amylopectin in mfp1 mutant grains

[0076] Since the amylopectin content of the mutant was significantly lower than that of the wild type, it was speculated that the structure of the amylopectin of the mutant might also have changed. Based on this, the structure of the amylopectin between the wild type and the mutant was further compared. Zhonghua11 and mfp1-1 mutant plants were selected to measure the amylopectin chain length distribution using ion chromatography. Fig.10 As shown in A, the chain length distribution (CLD) of amylopectin showed similar patterns in the mutant and the wild type, and there was a peak at a degree of polymerization (DP) of 12 in both the mutant and the wild type. Fig.10 As shown in B, compared with the wild type, the proportion of short chains or medium-length chains between DP7-12, DP23-35 and DP49-70 in the mutants was significantly increased, and the proportion of short chains or medium-length chains between DP13-22 and DP36-48 was significantly decreased.

[0077] The above results indicate that the OsMFP1 gene affects the chain length distribution of amylopectin in endosperm starch.

[0078] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A starch synthesis regulatory gene OsMFP1, characterized in that: The gene has a nucleotide sequence as shown in SEQ ID NO.

1.

2. A protein encoded by the gene OsMFP1 according to claim 1, characterized in that: The protein has an amino acid sequence as shown in SEQ ID NO.

2.

3. Use of the gene OsMFP1 as claimed in claim 1 in regulating starch synthesis in rice grains.

4. The use according to claim 3, characterized in that: The starch is total starch, amylose and amylopectin in rice grains.

5. The use according to claim 4, characterized in that: The gene OsMFP1 plays a positive regulatory role in starch synthesis in rice grains.

6. The use according to claim 5, characterized in that: The functional loss of the gene OsMFP1 leads to a decrease in the total starch content, the amylose content and the amylopectin content in rice grains.

7. Use of the gene OsMFP1 as claimed in claim 1 in regulating rice yield.

8. The use according to claim 7, characterized in that: The gene OsMFP1 plays a positive regulatory role in rice yield.

9. The use according to claim 8, characterized in that: The functional loss of the gene OsMFP1 leads to reduced rice yield.

Images