Dendrocalamus farinosus transcription factor DfMYB265 gene and application thereof

Abstract

The invention discloses a sinocalamus farinosus transcription factor DfMYB265 gene and application thereof. The nucleotide sequence of the sinocalamus farinosus transcription factor DfMYB265 gene is as shown in SEQ ID NO.1, and the coded amino acid sequence is as shown in SEQ ID NO.2. The DfMYB265 gene and a pCAMBIA1303-N vector are recombined into an expression vector, a moso bamboo seed embryo is subjected to genetic transformation through a gene gun, a moso bamboo plant over-expressing the DfMYB265 gene is obtained through transgenic positive identification and screening, and compared with wild type moso bamboo, the moso bamboo over-expressing the DfMYB265 gene grows rapidly, the branch number and bamboo shoot growing amount are increased, the plant height is increased, and the yield of the moso bamboo is increased. Moreover, the cellulose content in the stalks is remarkably increased, and the expression of cellulose synthase CESA4, CESA7 and CESA9 related to cellulose synthesis is remarkably up-regulated. The invention provides a theoretical basis for revealing a regulation mechanism of the DfMYB265 on cellulose in a secondary cell wall formation process, provides a thought and a theoretical basis for improving a genetic transformation variety of the neosinocalamus farinosus, and provides an effective way for creating new germplasm of bamboo plants and increasing the cellulose content.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering, and more specifically, relates to a transcription factor DfMYB265 gene of Phyllostachys liangshanensis and an application thereof. Background Art

[0002] Liangshan bamboo is an important economic bamboo species with fast growth, high yield, long fiber and thin wall. It can be used for bamboo pulp papermaking. The higher the cellulose content of bamboo, the higher the pulping rate and paper quality. As a natural renewable carbon source, cellulose can be used as a raw material for biofermentation and biochemical industry. Increasing the cellulose content is conducive to the conversion and utilization of biomass and achieving sustainable development. By optimizing the cellulose content, the cellulose in bamboo can be better converted into biofuel or other energy products, promoting the healthy development of human society. Thereby reducing dependence on fossil fuels, reducing carbon emissions, and achieving a more environmentally friendly energy and material supply.

[0003] Because bamboo has the characteristics of uncertain flowering period and dying after flowering, the improvement through traditional hybrid breeding is limited. In addition to improving the quality and yield of bamboo plant cellulose through conventional genetic improvement methods such as collecting germplasm resources and introducing domestication, most of the current methods are improved at the molecular level through genetic engineering, such as regulating some key enzyme genes in the bamboo cellulose synthesis pathway, thereby improving the fiber quality, and finally cultivating new bamboo varieties suitable for papermaking. Since bamboo seeds are few and some bamboo species do not produce seeds, it is difficult to induce callus by using embryos as explants, but the regeneration ability of bamboo stem segments to induce callus is low, making it difficult to culture and genetically transform bamboo plants. Therefore, the analysis of bamboo-related gene functions is currently mostly carried out in heterologous model plants Arabidopsis and rice, which greatly limits the creation of new bamboo germplasm. The selection and breeding of excellent bamboo species has restricted the development of many bamboo pulp and papermaking enterprises in my country. At present, cellulose has become the basis of modern industrial and agricultural scientific production, and it is also a key area of ​​research in forest molecular and biotechnology.

[0004] As one of the most abundant bamboo species in my country, the low cellulose content of moso bamboo affects its efficient development and utilization. Therefore, studying how to regulate the cellulose-related genes of moso bamboo through genetic engineering to improve its cellulose quality and yield and increase the cellulose content in the plant is of great significance to the development and utilization of moso bamboo as a resource plant. Summary of the invention

[0005] An object of the present invention is to solve at least the above problems and / or disadvantages and to provide at least the advantages which will be described hereinafter.

[0006] In order to achieve these purposes and other advantages of the present invention, a transcription factor DfMYB265 gene of Phyllostachys liangshanensis is provided, and the nucleotide sequence is shown in SEQ ID NO.1.

[0007] Preferably, the encoded amino acid sequence is as shown in SEQ ID NO.2.

[0008] An expression vector comprises the above-mentioned DfMYB265 gene of the transcription factor of Phyllostachys liangshanensis.

[0009] Preferably, the expression vector is pCAMBIA1303-N-DfMYB265.

[0010] An application of the Liangshan bamboo transcription factor DfMYB265 gene as described above in regulating plant cellulose content.

[0011] An application of the expression vector as described above in regulating plant cellulose content.

[0012] An application of the above-mentioned transcription factor DfMYB265 gene of Phyllostachys liangshanensis in promoting plant growth.

[0013] A use of the expression vector as described above in promoting plant growth.

[0014] Preferably, the application of the transcription factor DfMYB265 gene of Phyllostachys liangshanensis in regulating the cellulose content of plants includes:

[0015] Step 1, constructing the vector of the transcription factor DfMYB265 gene of the Psoralea corylifolia;

[0016] Step 2: transforming the constructed vector into plants or plant cells;

[0017] Step 3: Cultivate and screen plants with high cellulose content.

[0018] Preferably, the application of the DfMYB265 gene, a transcription factor of Phyllostachys chinensis, in promoting plant growth includes: increasing the height of the bamboo plant, and increasing the number of bamboo branches and the amount of bamboo shoots.

[0019] The present invention at least includes the following beneficial effects: the present invention clones a transcription factor DfMYB265 gene encoding 318 amino acid residues of P. liangshanensis, and by constructing a phylogenetic tree analysis of MYB family genes in P. liangshanensis and model plants such as Arabidopsis, rice, corn and poplar, it is shown that the sequence of DfMYB265 is highly conserved;

[0020] The invention recombines the DfMYB265 gene and the pCAMBIA1303-N vector into a binary expression vector, and then genetically transforms bamboo seed embryos by gene gun, and obtains bamboo plants overexpressing the DfMYB265 gene by positive transgenic identification and screening; compared with wild-type bamboo, the bamboo overexpressing the DfMYB265 gene grows rapidly, the number of branches and the amount of shoots increase, the plant height increases, and the cellulose content in the stems increases significantly; the expressions of cellulose synthases CESA4, CESA7 and CESA9 related to cellulose synthesis in the bamboo overexpressing the DfMYB265 gene are significantly upregulated;

[0021] The present invention analyzes genes interacting with DfMYB265 through yeast one-hybrid and LUC, and constructs a regulatory network of the DfMYB265 gene in the secondary wall formation process based on this, providing a theoretical basis for revealing the regulatory mechanism of DfMYB265 on cellulose in the secondary cell wall formation process, providing ideas and theoretical basis for improving the genetic transformation varieties of Liangshan bamboo, and providing an effective way to create new bamboo germplasm and increase cellulose content.

[0022] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the electrophoresis diagram of the total RNA of Phyllostachys liangshanensis in Example 1 of the present invention;

[0024] Figure 2 This is the electrophoresis diagram of the CDS sequence amplification of the DfMYB265 gene in Example 1 of the present invention;

[0025] Figure 3 The multiple sequence alignment result of amino acids encoded by the DfMYB265 gene in Example 1 of the present invention and homologous genes of other species;

[0026] Figure 4 This is a diagram showing the tissue expression level of DfMYB265 in Example 1 of the present invention;

[0027] Figure 5 This is the electrophoresis diagram for positive bacteria identification constructed by the expression vector in Example 2 of the present invention;

[0028] Figure 6 is the cellulose standard curve in Example 3 of the present invention;

[0029] Figure 7 This is the electrophoresis diagram for identifying positive plants of DfMYB265 transgenic bamboo in Example 3 of the present invention;

[0030] Figure 8The GFP wavelength light source in Example 3 of the present invention is used to test the GFP signal in the roots of bamboo overexpressing DfMYB265;

[0031] Fig. 9 This is an analysis diagram of the expression level of DfMYB265 overexpressed bamboo in Example 3 of the present invention, wherein WT is wild bamboo, and L1, L2 and L3 are DfMYB265 overexpressed bamboo;

[0032] Fig.10 The photos are of wild bamboo grown for one year and bamboo overexpressing DfMYB265 in Example 3 of the present invention;

[0033] Fig.11 The annual shoot yield (a) and average plant height (b) of the DfMYB265 overexpressing bamboo in Example 3 of the present invention;

[0034] Fig.12 This is a comparison diagram of cellulose content in bamboos overexpressing DfMYB265 in Example 3 of the present invention, wherein WT is wild bamboo, and OE-1, OE-2 and OE-3 are bamboos overexpressing DfMYB265;

[0035] Fig.13 is the relative expression level of genes related to cellulose synthesis in the bamboo with overexpression of DfMYB265 in Example 3 of the present invention;

[0036] Fig.14 Yeast one-hybrid (a) and luciferase activity (b) assays in Example 4 of the present invention verify the interaction between DfMYB265 and DfCESA9 promoter. DETAILED DESCRIPTION

[0037] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0038] It should be understood that terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0039] In the following examples, the experimental materials and main instruments used are as follows:

[0040] 1. Experimental materials: Two-year-old Liangshan bamboo was provided by the bamboo resource nursery of the School of Life Science and Engineering of Southwest University of Science and Technology; 4-5-week-old Nicotiana benthamiana was grown in this laboratory.

[0041] 2. Main reagents and strains:

[0042] (1) Enzyme preparation: LA Taq DNA polymerase, pMD19-T vector (TaKaRa), T4-DNA ligase, rTaq DNA polymerase; the vectors used were owned by the laboratory (empty pCAMBIA-1303N, PGADT7, pHisII, pGreenII-LUC).

[0043] (2) Kits: DNA gel recovery kit, plasmid extraction kit, RNAiso Plus reagent (TaKaRa), cDNA first-strand synthesis kit (TIANGEN), Taq Pro Universal SYBR qPCR Master Mix (Vazyme), isopropyl-β-D-thiogalactoside (IPTG), 5-bromo-4-chloro-3-indolyl-β-D-galactoside (X-gal), 5-bromo-4-chloro-3-indole-β-D-glucuronide (X-Glu) powder, 6× Loading buffer, DL 2000 DNA Marker, Trizol reagent, etc. were provided by Beijing Tiangen Biochemical Technology Co., Ltd.

[0044] (3) Bacterial strains: DH5α competent Escherichia coli and GV3103 / EHA105 competent Agrobacterium were prepared in our laboratory, and the yeast strain used was Y1H.

[0045] (4) Yeast extract, agarose, and tryptone were provided by Genentech, and AceQ Universal SYBR qPCR Master Mix was provided by Nanjing Novozyme Biotechnology Co., Ltd.

[0046] (5) Conventional reagents such as anhydrous ethanol, sulfuric acid, β-mercaptoethanol, hydrochloric acid, calcium chloride, acetone, and thioglycolic acid were all of ultrapure and analytical grade.

[0047] 3. Main instruments and equipment: 2.5μL, 10μL, 20μL, 100μL, 1000μL pipettes (Eppendorf), centrifuge (Eppendorf), Shanghai Qixinke DHP-9052 constant temperature incubator, FerroTec constant temperature metal bath, PCR automatic amplification instrument (Bio-Rad), LPC-V-15B double-sided clean bench (Shandong Xinhua), BSD-400 constant temperature shaking incubator (Boxun), MOST-L85 high pressure steam sterilizer (Shandong Xinhua), 1 / 10,000 electronic balance (Sartorius), HH-1 digital display constant temperature water bath (Zhibo Ruiyi), T6 UV-visible spectrophotometer (Puxi General), BXYC-DX2200 stacked intelligent precision shaker (Boxun), Bio-Rad GelDoc gel imaging system, DYCP-31 / DN agarose horizontal electrophoresis tank and DDY-8C electrophoresis instrument (Beijing Liuyi), Thermo forma ultra-low temperature freezer, CFX96tm Real-TimeSystem gradient real-time quantitative gene analyzer, NSZ-405 stereo microscope (Yongxin).

[0048] 4. Preparation of other main reagents:

[0049] (1) CTAB DNA extraction solution (1000 mL): 100 mL of 1 M tris(hydroxymethyl)aminomethane hydrochloride (Tris-HCl) (pH 8.0, 100 mmol / L), 20 g of CTAB (hexadecyltrimethylammonium bromide), 81.816 g of NaCl (1.4 mol / L), 40 mL of disodium ethylenediammonium tetraacetate (pH 8.0, 0.5 mmol / L), and 2 mL of β-mercaptoethanol (40 mmol / L).

[0050] (2) Phosphate buffer (pH = 7.2): Take 187 mL of 0.2 mol / L NaH2PO4 and 13 mL of 0.2 mol / L Na2HPO4, mix well, make up to 400 mL with distilled water, and filter to sterilize.

[0051] (3) 1M NaOH: Take 4 g of NaOH solid and dissolve it in distilled water to make up to 100 mL.

[0052] (4) 60% (v / v) H2SO4: Add 60 mL of concentrated sulfuric acid to 40 mL of distilled water.

[0053] (5) 2% anthrone: Take 0.2 g of anthrone powder and dissolve it in concentrated sulfuric acid to a final volume of 100 mL (Note: place in a -4°C refrigerator for 2 h before use).

[0054] (6) The preparation of other reagents such as LB liquid and solid culture medium, 50× Tris-acetate (TAE) buffer (1000 mL), IPTG (isopropylthiogalactoside) (200 mg / mL), ampicillin (Amp), various antibiotics and 15% glycerol was strictly in accordance with the experimental operation procedures.

[0055] Example 1

[0056] Acquisition and analysis of the coding sequence of DfMYB265 in Phyllostachys liangshanensis

[0057] 1. Extraction of total RNA from Phyllostachys liangshanensis

[0058] Select the roots, stems and leaves of two-year-old radix syriacus with good growth, cut them with scissors and put them into sterilized EP tubes, then quickly freeze them in liquid nitrogen, use TIANGEN's Trizol reagent, and extract RNA according to the kit steps. The specific steps are as follows:

[0059] (1) Grind the plant sample bottle thoroughly in liquid nitrogen, transfer to a 1.5 mL RNA-free centrifuge tube, add 1 mL Trizol, mix gently, incubate at room temperature for 10 min, add 200 mL chloroform for 3-5 min, and incubate at 12,000 rpm for 10 min (4°C);

[0060] (2) Transfer the supernatant to a new 1.5 mL sterilized EP tube, add an equal volume of isopropanol, place for 20 min, incubate at 12,000 rpm for 10 min (4°C), and discard the supernatant;

[0061] (3) Wash twice with 1 mL of 75% alcohol (12000 rpm, 5 min);

[0062] (4) Aspirate the alcohol, blow dry the precipitate, and dissolve the precipitate with 30-50 mL of RNA-free water.

[0063] (5) Take 2 μL RNA for 1% agarose gel electrophoresis and select clear RNA for subsequent experiments;

[0064] Wear a mask and gloves throughout the process to prevent contamination of samples and RNA degradation. After RNA extraction, place it in an ice box for subsequent experiments.

[0065] Figure 1 This is the electrophoresis diagram of total RNA from Psoralea corylifolia. It can be seen that the RNA has three bands (i.e., 28S, 18S, and 5.8S of RNA), which is of good quality and can be used for reverse transcription as a template for DfMYB265 cloning.

[0066] 2. Synthesis of cDNA of Psoralea corylifolia

[0067] (1) Measure the concentration of the extracted RNA, and then reverse transcribe cDNA using the reverse transcription kit of TIANGEN;

[0068] (2) Prepare the DNA removal mixture according to Table 1, mix thoroughly, centrifuge briefly, place at 42°C (3 min), and then place on ice;

[0069] (3) Prepare the reverse transcription mixture according to Table 2, mix thoroughly with the DNA removal mixture, and centrifuge;

[0070] (4) Finally, use a PCR instrument at 42°C (15 min) and 95°C (3 min) to obtain cDNA, which is then stored at -20°C until use.

[0071] Table 1

[0072] Composition Usage 5×gDNA Buffer 2μL RNA from leaves of Phyllostachys liangshanense 50ng-2μg <![CDATA[RNase-Free ddH2O]]> Make up to 8 μL

[0073] Table 2

[0074] Composition Usage 10×King RT Buffer 2μL FastKing RT Enzyme Mix 1μL FQ-RT Primer Mix 2μg <![CDATA[RNase-Free ddH2O]]> Make up to 10 μL

[0075] 3. Cloning of the MYB265 gene of Phyllostachys liangshanensis

[0076] (1) Primer design

[0077] PCR primers DfMYB265-F and DfMYB265-R were designed using Primer5 ( Table 3 );

[0078] Table 3

[0079] Primer name Primer sequence (5'-3') DfMYB265-F ATGGAGGGACATGTGGACAA DfMYB265-R AAATAAGCTTCTAATTGATA

[0080] (2) PCR amplification of the CDS sequence of the DfMYB265 gene

[0081] PCR amplification was performed using the cDNA of Psoralea corylifolia as a template. The PCR reaction system and reaction procedure are shown in Tables 4 and 5;

[0082] Table 4

[0083] Reagents volume TaKaRa LA Taq(5U / μL) 0.5μL 2×GC Buffer 25μL dNTP Mixture (2.5 mM each) 5μg DfMYB265-F 1.5μL DfMYB265-R 1.5μL cDNA 4μL <![CDATA[RNase-Free ddH2O]]> Make up to 50 μL

[0084] Table 5

[0085]

[0086]

[0087] (3) Recovery of amplified PCR products

[0088] After the PCR reaction is completed, electrophoresis detection is performed. All reaction solutions are subjected to 1% agarose gel electrophoresis at a voltage of 80V for about 30 minutes. The results are as follows: Figure 2 As shown; carefully cut the target band size in the UV gel irradiator with a scalpel, use TIANGEN's DNA fragment gel recovery kit to recover the gel, and after recovery, take 1 μL to measure and identify the DNA concentration and purity using a UV-visible spectrophotometer;

[0089] (4) Construction of pMD19-T-DfMYB265 vector. The ligation system is shown in Table 6. The ligation transformation process is as follows: after mixing the ligation system, put it into a PCR instrument and perform rapid ligation at 22°C for 30 min; add the above ligation product to the DH5α Escherichia coli competent cells taken out from the ultra-low temperature refrigerator, mix gently, and place on ice for 30 min; heat shock at 42°C for 3 min, and place on ice for 5 min; add 600 μL of liquid LB culture medium to the clean bench, and shake it in a constant temperature shaker at 37°C at 180 rpm for 1 h; centrifuge at 4000 rpm for 5 min to collect the cells, pour out the excess culture medium in the clean bench, mix the cells, apply them to LB (Amp) solid culture medium, and culture them inverted in a constant temperature incubator at 37°C for 18 h;

[0090] Table 6

[0091] Composition volume 10×T4 ligase Buffer 1μL T4 ligase 1μL DfMYB265 gene PCR product (40ng / μL) 6μL pMD19-T vector (10 ng / μL) 2μL

[0092] (5) Colony PCR verification and plasmid extraction

[0093] 12 colonies were selected from the LB (Amp) solid culture medium in (4) and placed in 800 μL LB (Amp) liquid culture medium. The culture medium was cultured in a shaker at 37°C until the culture medium became visibly turbid. The reaction system was then configured according to Table 7. The amplification was performed according to the procedure in Table 8. Finally, the PCR product was detected by electrophoresis. The bacterial solution samples of the target bands were selected according to the electrophoresis results and sent to BGI for sequencing. After the sequencing was correct, the samples were expanded and cultured, and the plasmids were extracted (stored at -20°C). The bacterial solution was preserved with glycerol.

[0094] Table 7

[0095]

[0096]

[0097] Table 8

[0098]

[0099] The sequencing result is shown in SEQ ID NO.1, the CDS sequence length is 957 bp, and the amino acid sequence encoded by it is shown in SEQ ID NO.2;

[0100] (6) Multiple sequence alignment of amino acids encoded by DfMYB265 gene and homologous genes in other species The amino acid sequence (SEQ ID NO. 2) of DfMYB265 (DfaA02G006840) screened from Liangshan bamboo was used to search for MYB amino acid sequences in rice and bamboo by BLAST (BLAST: Basic Local Alignment Search Tool (nih.gov)) on the NCBI online website, and multiple sequence alignment analysis was performed by using MEGA 7.0;

[0101] The multiple sequence alignment results are as follows Figure 3 As shown, the transcription factor DfMYB265 gene (DfaA02G006840) of Liangshan bamboo has low homology with rice and bamboo homologous genes, and the homology with rice is only 64%, indicating that the sequence of Liangshan bamboo DfMYB265 gene is highly specific;

[0102] (7) Analysis of tissue expression pattern of DfMYB265

[0103] Firstly, we selected Liangshan bamboos with good growth, sampled various tissue parts (stem, lateral branches, mature leaves, young leaves, shoots less than 10 cm long), placed them in liquid nitrogen, extracted RNA and reverse transcribed it into cDNA;

[0104] Then, quantitative primers were designed based on the conserved domain and homologous gene sequences of DfMYB265, and the Tublin sequence of Psoralea corylifolia was used as the internal reference gene. The primers are shown in Table 9;

[0105] Using cDNA from various parts of Liangshan bamboo as template, qRT-PCR detection was performed using quantitative reagents from Novozymes. The reaction system is shown in Table 10, the reaction procedure is shown in Table 11, and 2 －ΔΔCT The expression levels of DfMYB265 gene in stems, lateral branches, mature leaves, young leaves, and shoots less than 10 cm were calculated to facilitate the tissue expression pattern analysis of DfMYB265.

[0106] Table 9

[0107]

[0108] Table 10

[0109]

[0110] Table 11

[0111]

[0112] The results of tissue expression analysis of DfMYB265 are shown in Figure 4 As shown, it can be seen that DfMYB265 of Liangshan bamboo is expressed in various parts, among which the expression level in the stem is the highest.

[0113] Example 2

[0114] Construction and identification of pCAMBIA1303-N-DfMYB265 expression vector

[0115] SnapGene software was used to analyze the restriction sites of the DfMYB265 gene. Primers were designed using Primer5 based on the restriction sites of pCAMBIA1303-N. The primer sequences are shown in Table 12.

[0116] The pMD19-T-DfMYB265 plasmid obtained in Example 1 was used as a template for PCR amplification. The reaction system is shown in Table 13, and the reaction procedure is shown in Table 5, wherein the Tm value is 60°C. After the fragments were purified, the purified product and the pCAMBIA1303-N empty vector were double-digested with KpnI and XbaI endonucleases from TaKaRa Company at 37°C for 2h. The reaction system is shown in Table 14.

[0117] According to the mass ratio of PCR product to vector of 3:1, the overnight connection was carried out at 16°C (refer to Table 6), and then Escherichia coli genetic transformation and colony PCR verification were carried out, and the positive bacterial plasmid was extracted for double enzyme digestion verification. The reaction system is shown in Table 14. 1% agarose gel electrophoresis was used to verify whether DfMYB265 was successfully fused with the pCAMBIA1303-N vector, and the positive strain was stored in glycerol and further transformed with Agrobacterium. After that, the colonies were picked for colony PCR verification, and the obtained expression vector was named pCAMBIA1303 -N-DfMYB265; wherein, the specific method of Agrobacterium transformation is as follows: take EHA105 Agrobacterium competent cell, add 10 μL of plasmid, and flick to mix; place on ice for 10 minutes, quick-freeze with liquid nitrogen for 2 minutes, and water bath at 37°C for 5 minutes, then add 700 μL of LB (containing Rif) liquid culture medium on an ultra-clean workbench; culture in a 28°C shaker for 3-5 hours, then centrifuge at 4000 r / min for 6 minutes, discard the supernatant, and resuspend the bacteria; plate in LB (containing Rif and required antibiotics) solid culture medium, and culture in a 28°C incubator for 2-3 days.

[0118] Table 12

[0119]

[0120] Table 13

[0121]

[0122] Table 14

[0123]

[0124] The MYB265 gene fragment and the pCAMBIA1303-N vector were digested and recovered. The two recovered fragments were ligated overnight with T4 ligase and transferred into DH5α Escherichia coli competent cells. The grown colonies were verified by PCR positive clones. The electrophoresis diagram showed that 9 colonies were able to amplify the fragments, and the fragment size was about 1000 bp ( Figure 5 ).

[0125] Example 3

[0126] Application of the transcription factor DfMYB265 gene of Phyllostachys liangshanensis in regulating cellulose content and growth and development of Phyllostachys pubescens

[0127] 1. Transformation of bamboo seed embryos by gene gun method

[0128] Place the bamboo seeds on the foam for seeding, and when the embryos just germinate, they can be used as recipients for gene gun transformation;

[0129] Place the newly germinated bamboo seeds in a hypertonic medium for dark culture for 4 hours, and wipe the clean bench with 75% alcohol, including the inside and outside of the gene gun. The specific operation steps refer to Gong Daoyong's method (Gong Daoyong, Hu Shanglian, Cao Ying, et al. Cloning, bioinformatics analysis and induced expression of two bZIP genes of Phyllostachys edulis [J]. Plant Research, 2018, 38(2): 268-277).

[0130] After the gene gun bombardment was completed, the bamboo seeds were continued to be cultured in the dark at 25°C on a hyperosmotic medium for 16 hours, and then the bamboo seeds were restored to culture under dark conditions at 25°C for 3 days, and then cultured under light until three leaves grew, and then transplanted to soil to obtain seedlings.

[0131] 2. Identification of transgenic plants

[0132] (1) DNA of wild-type and transgenic bamboo was extracted using the CTAB method, and PCR was performed using HYG-F and HYG-R primers. The HYG-F and HYG-R primers are shown in Table 15;

[0133] Table 15

[0134]

[0135] (2) RNA was extracted from wild-type and transgenic bamboo leaves, and cDNA was reverse transcribed. Tublin was used as the reference gene for bamboo, and the relative expression level of DfMYB265 in overexpressed bamboo was detected;

[0136] (3) Use LUYOR-3415RG dual-wavelength fluorescent protein excitation light source to detect GFP protein in positive plants;

[0137] (4) Determination of cellulose content in transgenic bamboo, the method is as follows: take 0.5g of bamboo stems, grind to fine powder with liquid nitrogen, add 60mL of 60% sulfuric acid, and digest for 30min; transfer the digested cellulose solution to a 100mL volumetric flask, dilute to scale with 60% sulfuric acid, shake well, and filter with a Buchner funnel; take 5mL of the above solution and put it into a 100mL volumetric flask, add distilled water to dilute to scale in a cold water bath, and shake well; remove 2mL of the solution from the previous step and put it into a stoppered test tube, add 0.5mL of 2% anthrone, and add 5mL of concentrated sulfuric acid along the wall of the tube, plug the tube, shake well, let it stand for 12min, and measure the OD with a UV spectrophotometer 625 The value of

[0138] The standard curve of cellulose standard was determined as follows: 6 small test tubes were added with 0, 0.4, 0.8, 1.2, 1.6, and 2.0 mL of cellulose standard solution, and 2, 1.6, 1.2, 0.8, 0.4, and 0 mL of distilled water, respectively, and shaken well. Each tube contained 0, 40, 80, 120, 160, and 200 ug of cellulose, respectively; 0.5 mL of 2% anthrone was added to each tube, and 5 mL of concentrated sulfuric acid was added along the tube wall, the tube was plugged, shaken well, and allowed to stand for 1 min; the OD was measured with a UV spectrophotometer. 625 The absorbance is the y-axis, the cellulose content is the x-axis, and the cellulose standard curve is drawn as follows: Figure 6 shown.

[0139] The pCAMBIA1303-N-DfMYB265 expression vector was transformed into bamboo seed embryos by gene bombardment. After growing for a period of time, the positive plants were verified by PCR cloning using the HYG tag on pCAMBIA1303-N. The results showed that a specific band consistent with the pCAMBIA1303-N-DfMYB265 recombinant plasmid was amplified from the transgenic bamboo plants ( Figure 7 ), confirming that the DfMYB265 gene had been successfully integrated into the bamboo genome.

[0140] The roots of DNA-positive DfMYB265 transgenic bamboo were cut and irradiated with LUYOR-3415RG dual-wavelength fluorescent protein excitation light source to test the GFP-tagged protein in the plasmid pCAMBIA1303-N-DfMYB265. The results showed that after irradiation with GFP wavelength light source, green fluorescence appeared on the roots of DfMYB265-overexpressing bamboo, which once again confirmed that DfMYB265 was successfully transferred into bamboo ( Figure 8 ).

[0141] The relative expression level of DfMYB265 gene in transgenic plants was detected by RNA level, RNA was extracted from leaves of wild-type and DfMYB265-overexpressing bamboo-positive plants, and the relative expression level of DfMYB265 gene in DfMYB265-overexpressing bamboo was detected by qRT-PCR. The results showed that the expression level of DfMYB265 gene in DfMYB265-overexpressing bamboo was as high as 6.2 times that of the control, which was significantly higher than that of the wild type ( Fig. 9 ).

[0142] After one year of growth, the transgenic bamboo of DfMYB265 grew more vigorously and had more branches than the wild bamboo, which had no branches ( Fig.10 ). The number of shoots produced by DfMYB265 transgenic bamboo and wild bamboo after one year of growth, as well as the average height of all bamboos, were statistically analyzed. The results showed that the height of DfMYB265 transgenic bamboo was significantly higher than that of wild bamboo, and the number of shoots produced was also more than that of wild bamboo ( Fig.11 ).

[0143] The cellulose content of the successfully transgenic one-year-old DfMYB265 bamboo was analyzed, and the difference was analyzed by Graphpad Prism software. The results showed that the cellulose content of DfMYB265 transgenic bamboo was significantly higher than that of wild type ( Fig.12 ).

[0144] 3. Real-time fluorescence quantitative analysis

[0145] (1) RNA was extracted from leaves of wild-type and DfMYB265 overexpression (OE) bamboo positive plants. The wild-type plants were used as controls. The relative expression level of the DfMYB265 gene in the DfMYB265 overexpression bamboo was detected by qRT-PCR. After positive overexpression bamboo was identified, the expression levels of genes related to cellulose biosynthesis were analyzed. Tublin was used as an internal reference gene. The primers are shown in Table 16.

[0146] Table 16

[0147]

[0148] (2) qRT-PCR amplification system and procedure

[0149] PCR amplification was performed using bamboo cDNA as a template, and the reaction system and procedure were as shown in Tables 17 and 18;

[0150] Table 17

[0151] Reagents volume TaKaRa LA Taq(5U / μL) 0.5μL 2×GC Buffer 25μL dNTP Mixture (2.5 mM each) 5μg Primer F 1.5μL Primer R 1.5μL cDNA 4μL <![CDATA[RNase-Free ddH2O]]> Make up to 50 μL

[0152] Table 18

[0153]

[0154]

[0155] In order to explore the regulation of DfMYB265 on the secondary wall of bamboo, this example started with the key genes related to cellulose synthesis, and detected the expression level changes of genes related to cellulose lignin synthesis by qRT-PCR. The results showed that overexpression of DfMYB265 led to the upregulation of CESA4, CESA7, and CESA9 related to cellulose synthesis in bamboo ( Fig.13 ).

[0156] Example 4

[0157] DfMYB265 interacting protein verification

[0158] 1. Yeast one-hybrid verification of the interaction between DfMYB265 and DfCESA9

[0159] (1) Recombinant plasmid construction

[0160] According to the restriction sites on PGADT7 and DfMYB265, as well as the restriction sites on the pHisII vector and the lignocellulose-related promoter pDfCESA9 (DfaC06G009180), the corresponding primers DfMYB265-F (EcoRI), DfMYB265-R (BamHI) and the primers of the cellulose-related promoter are designed as shown in Table 19, and the PGADT7-DfMYB265 connection system and procedure are as in Example 2; the pHisII vector is double-digested with EcoRI and SacⅠ restriction endonucleases, and then the connection method of homologous recombination is used, the system is as shown in Table 20, and it is placed in a PCR instrument at 37°C for 30 minutes, and through Escherichia coli genetic transformation, colony PCR, plasmid extraction, double enzyme digestion verification, and finally a fusion expression vector of pHisII and cellulose-related promoter is obtained;

[0161] Table 19

[0162]

[0163] Table 20

[0164]

[0165]

[0166] Note: X(50-200ng):Y(10-200ng)=1:2

[0167] (2) Yeast two-hybrid transformation with recombinant plasmid

[0168] 1) Reagent preparation:

[0169] a. 50% PEG 4000 :Take 50g PEG 4000 Dissolve in distilled water, make up to 100 mL, sterilize at 121°C for 18 min;

[0170] b.1M LiAc: Dissolve 3.3g LiAc powder in distilled water to 50mL, adjust pH to 7.5 with 1M HCL, and sterilize at 121℃ for 18min;

[0171] c.10×TE: 10mL 1mol / L Tris-Hcl + 2mL 0.5mol / L EDTA, distilled water to 100mL, adjust pH to 7.5, sterilize at 121℃ for 18min;

[0172] d.1.1×TE / LiAc: 7.8mL H2O+1.1mL 10×TE+1.1mL LiAc;

[0173] e.1.1×TE / LiAc / PEG 4000 : 8mL 50% PEG 4000 +1mL 10×TE+1mL 1M LiAc

[0174] f. YDPA liquid culture medium: see Table 21;

[0175] Table 21

[0176]

[0177] g.10×Dex: 20 g glucose was dissolved in distilled water, the volume was adjusted to 100 mL, and sterilized by filtration with a 0.25 μm filter;

[0178] h.10×YNB: 5g ammonium sulfate, 1.7g YNB dissolved in distilled water, constant volume 100mL;

[0179] i. 10×AA: 150 mg L-Iso, 250 mg L-Phe, 750 mg L-Val, 1000 mg L-Thr, 100 mg L-Arg, 150 mg L-Tyr, 150 mg L-Lys, 100 mg L-Met, dissolved in distilled water, fixed to 500 mL, sterilized at 121°C for 18 min;

[0180] j.100×His: 0.2 g His was dissolved in distilled water, the volume was fixed to 100 mL, and sterilized at 121°C for 18 min;

[0181] k.100×Trp: 0.2 g Trp was dissolved in distilled water, the volume was fixed to 100 mL, and sterilized at 121°C for 18 min;

[0182] 1.100×Leu: 1 g Leu was dissolved in distilled water to a volume of 100 mL and sterilized at 121°C for 18 min;

[0183] m.100×Ade: 2 g Ade was dissolved in distilled water, the volume was fixed to 100 mL, and sterilized at 121°C for 18 min;

[0184] n.SD / -Trp solid medium: 10 mL 10×YNB, 10 mL 10×Dex, 10 mL 10×AA, 1 mL 100×His, 1 mL 100×Leu, 1 mL 100×Ade added to 67 ml sterile distilled water (containing 1.5 g agar powder);

[0185] o.SD / -Trp / -Leu / -Leu solid medium: 10 mL 10×YNB, 10 mL 10×Dex, 10 mL 10×AA, 1 mL 100×Ade, added to 69 ml sterile distilled water (containing 1.5 g agar powder).

[0186] 2) Preparation of Y1H yeast competent cells:

[0187] Streak the Y1H strain on YDPA solid medium and culture at 30℃ for 3 days. Pick a single colony and place it in 3mL YDPA medium and culture it in a shaking incubator at 30℃ for 8h. Pipet 5μL into 50mL YDPA medium and culture it at 30℃ for 16-20h until OD 600 =0.15-0.3;

[0188] Centrifuge at 700 × g for 5 min at room temperature to collect the yeast, resuspend the yeast in 100 mL YDPA, and culture at 30°C for 3-5 h until the OD 600 = 0.4-0.5, centrifuge at 700 × g for 5 min at room temperature to collect the cells, and resuspend them in 50 mL of sterile water;

[0189] The yeast was collected by centrifugation at 700 × g for 5 min at room temperature, and the yeast was resuspended in 3 mL of 1.1× TE / LiAc solution;

[0190] The resuspension was divided into three 1.5 mL centrifuge tubes, centrifuged at high speed for 15 s, the supernatant was discarded, and 600 μL 1.1× TE / LiAc solution was added to resuspend the yeast.

[0191] 3) Y1H yeast transformation:

[0192] Pre-add 3 μL of the constructed PGADT7 plasmid and 3 μL of the constructed pHisII plasmid, 3 μL of denatured Carrier DNA (salmon sperm), 300 μL of 1.1×TE / LiAcPEG 4000 , mix well;

[0193] Add 50 μL of resuspended yeast to the tube and mix gently. Place in a 30°C water bath for 30 min, mix every 10 min, and add 200 μL of DMSO to the tube and mix well.

[0194] Activate in a 42°C water bath for 15 min, mix by inverting every 5 min, centrifuge at 700 × g for 5 min, discard the supernatant, resuspend in 1 mL YPDA liquid medium, and resuscitate on a shaker at 30°C for 1 h;

[0195] Centrifuge at high speed for 15 seconds, discard the supernatant, resuspend with 100 μL NaCl (0.9%), take 10 μL of the resuspension and dilute 100 times to plate (SD / -Trp, SD / -Trp / -Leu / -His solid culture medium).

[0196] 4) Yeast spot plate:

[0197] Pick a single positive colony grown on SD / -Trp / -Leu / -His solid medium, inoculate it into 15 mL of YDPA liquid medium, and culture it overnight at 30°C and 200 rpm for 16-18 h;

[0198] Take 2 mL of overnight bacterial culture, centrifuge at 12000g for 1 min, remove the supernatant, and resuspend the bacteria in sterile H2O to OD 600 =0.5;

[0199] 100 μL of 30 mM 3AT and 200 μL of X-α-gal (24 mg of X-α-gal dissolved in 6 mL of DMF) were applied on SD / -Trp / -Leu / -Leu solid medium until the liquid was completely absorbed;

[0200] OD 600The bacterial solution with a value of 0.5 was diluted 10 times and 100 times respectively, and then 2 μL of the three different concentrations of bacterial solution were titrated on SD / -Trp / -Leu / -His solid culture medium (with 3AT and X-α-gal) and cultured at 30°C for 4-7 days.

[0201] 2. Bimolecular luciferase reporter assay (LUC) verifies the interaction between DfMYB265 and DfCESA9

[0202] (1) Recombinant plasmid construction

[0203] According to the restriction sites on pCAMBIA1303-N, DfMYB265, pGreenII-LUC vectors and cellulose-related promoter pDfCESA9, corresponding primers were designed as shown in Table 22, and PCR amplification, vector construction and restriction enzyme verification were performed respectively. The promoters of pCAMBIA1303-N-DfMYB265 and DfCESA9 were cloned and recovered, and the pGreenII-LUC vector was double-digested with EcoRⅠ and SacⅠ restriction endonucleases, and further connected by homologous recombination, placed in a PCR instrument at 37℃ for 30min, and genetically transformed with Escherichia coli, colony PCR, plasmid extracted, and double-enzyme verification were performed to finally obtain a fusion expression vector of pGreenII-LUC and DfCESA9 promoter.

[0204] Table 22

[0205]

[0206] (2) Agrobacterium transformation

[0207] Positive GV3103-p19 Agrobacterium of pCAMBIA1303-N-DfMYB265, LUC-ProDfCESA9 was obtained.

[0208] (3) Tobacco injection

[0209] Mix the two Agrobacterium strains in equal proportions, shake well, and let stand for 2-3 hours before injecting into tobacco.

[0210] (4) Luciferase activity detection

[0211] Cut the tobacco leaves in the injection area into an EP tube, put it in liquid nitrogen, and grind the leaves using a liquid nitrogen grinder;

[0212] Use the enzyme activity detection kit Dual-Luciferase Reporter Assay System (Promega, catalog number: E1910), add 100 μL of Passive Lysis Buffer (provided by Dual-Luciferase Reporter Assay System) to the ground sample, mix for 30 seconds, and centrifuge at 12000 rpm for 5 minutes at room temperature;

[0213] Take 50 μL of cell lysate to the ELISA plate, add 100 μL of substrate Luciferase Assay Rea gent II, and detect the fluorescence signal value emitted by the LUC-catalyzed substrate with an ELISA instrument after 10 seconds;

[0214] Add 100 μL of substrate STOP&Glo Substrate, detect the fluorescence signal value emitted by the substrate with an enzyme reader after 10 seconds, and calculate the ratio of LUC and REN.

[0215] Yeast one-hybrid and LUC assays were used to analyze whether DfMYB265 interacted with the promoter of CESA9 of P. liangshanensis. On SD / -Trp / -Leu / -Ade solid medium coated with X-α-gal and 3AT, the combination of DfMYB265 / ProDfCESA9 turned blue ( Fig.14 a). In addition, pCAMBIA 1303-N empty vector, pCAMBIA1303-N-DfMYB265, and LUC-ProDfCESA9 fusion vector were transformed into GV3103-P19 Agrobacterium, and the bacterial solution was mixed and injected into tobacco. After 2 days of dark culture, the luciferase activity was detected by LUC kit. DfMYB265 can bind to the promoter of DfCESA9 ( Fig.14 b).

[0216] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. A transcription factor DfMYB265 gene of Phyllostachys liangshanense, characterized in that: The nucleotide sequence is shown in SEQ ID NO.

1.

2. The transcription factor DfMYB265 gene of Phyllostachys liangshanensis as claimed in claim 1, characterized in that The encoded amino acid sequence is shown in SEQ ID NO.

2.

3. An expression vector, characterized in that: The invention comprises the transcription factor DfMYB265 gene of Phyllostachys liangshanensis according to claim 1.

4. The expression vector according to claim 3, characterized in that The expression vector is pCAMBIA1303-N-DfMYB265.

5. Use of the transcription factor DfMYB265 gene of Phyllostachys liangshanense as claimed in claim 1 in regulating plant cellulose content.

6. Use of the expression vector as claimed in claim 4 in regulating the cellulose content of plants.

7. Use of the transcription factor DfMYB265 gene of Phyllostachys liangshanense as claimed in claim 1 in promoting plant growth.

8. Use of the expression vector as claimed in claim 4 in promoting plant growth.

9. The use of the transcription factor DfMYB265 gene of the bamboo of Liangshan bamboo in regulating the cellulose content of plants as claimed in claim 5, characterized in that: include: Step 1, constructing the vector of the transcription factor DfMYB265 gene of the Psoralea corylifolia; Step 2: transforming the constructed vector into plants or plant cells; Step 3: Cultivate and screen plants with high cellulose content.

10. The use of the transcription factor DfMYB265 gene of the Phyllostachys liangshanensis in promoting plant growth as claimed in claim 7, characterized in that: include: Improve the height of bamboo plants, increase the number of bamboo branches and the amount of bamboo shoots.

Images