Application of FtHDA8 gene in increasing flavone content of arabidopsis thaliana

Abstract

The invention discloses application of an FtHDA8 gene in increasing the flavone content of arabidopsis thaliana, and belongs to the technical field of molecular breeding. The invention provides an application of an FtHDA8 gene in increasing the flavone content of a plant. A nucleotide sequence of a coding region of the FtHDA8 gene is shown as SEQ ID No.1. The invention also provides an application of the FtHDA8 gene in increasing the flavone content of the plant. The invention provides an arabidopsis thaliana material with high flavone content which is successfully cultivated through specific overexpression of the FtHDA8 gene. The application is not limited to arabidopsis thaliana, the flavonoid content in the tartary buckwheat can be increased through a similar mechanism, the biological activity of the tartary buckwheat is enhanced, and the flavonoid content of the tartary buckwheat is increased. By implementing the method, the planting area of the tartary buckwheat can be expanded, and the diversified development of local agricultural economy is promoted.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular breeding, and particularly relates to application of a FtHDA8 gene in improving the flavonoid content of Arabidopsis thaliana. Background Art

[0002] Tartary buckwheat, also known as Tatar buckwheat (Fagopyrum tataricum), is an annual or perennial dicotyledonous plant of the genus Fagopyrum Gaertn. of the Polygonaceae family. It is widely distributed all over the world and is a well-known minor grain crop with medicinal and edible properties. Tartary buckwheat is known as the "king of grains". It is not only rich in nutritional functional ingredients such as protein, fat, starch, dietary fiber, vitamins and minerals, but also rich in sugar alcohols, terpenes, phenylpropanoid glycosides, phenolic acids, and flavonoid active ingredients that are not contained in other grass crops. Tartary buckwheat is rich in flavonoids, which are distributed in roots, stems, leaves, flowers, fruits and seeds. The flavonoid content of each tissue is between 0.5% and 6.3%, making it an important potential resource for the source of natural flavonoid active ingredients. Studies have shown that flavonoids are an important material basis for the health benefits of buckwheat and its processed products. They have antibacterial and anti-inflammatory, antioxidant, antiviral, cardiovascular and cerebrovascular disease prevention and treatment, lipid-lowering, diabetes prevention and treatment, cancer prevention and treatment, as well as enhancing immunity and improving sub-health. The development prospects are very broad. Therefore, breeding flavonoid-rich buckwheat varieties will help improve its economic value.

[0003] In buckwheat, the FtHDA8 gene regulates the expression of genes related to growth, development and stress response of buckwheat by affecting the compactness of chromatin, and participates in regulating metabolic pathways in plants, such as the synthesis of secondary metabolites, which is crucial to the nutritional value and medicinal value of buckwheat. Therefore, the function of the FtHDA8 gene and its regulatory mechanism have potential application value for the genetic improvement of buckwheat. As a histone deacetylase in buckwheat, the FtHDA8 gene has important scientific significance for analyzing the biological characteristics, adaptability and potential agricultural applications of buckwheat. Summary of the invention

[0004] In order to solve the above technical problems, the present invention proposes the use of FtHDA8 gene in increasing the flavonoid content of Arabidopsis thaliana. The present invention provides Arabidopsis thaliana materials with high flavonoid content that are successfully cultivated by specifically overexpressing the FtHDA8 gene.

[0005] The present invention provides the following technical solutions:

[0006] Technical solution 1: Application of the FtHDA8 gene in increasing the flavonoid content of plants, the nucleotide sequence of the coding region of the FtHDA8 gene is shown in SEQ ID No.1.

[0007] Technical solution 2: Application of a recombinant vector containing the FtHDA8 gene in increasing the flavonoid content of plants.

[0008] Technical solution three: Application of host bacteria containing the recombinant vector in increasing the flavonoid content of plants.

[0009] Furthermore, by overexpressing the FtHDA8 gene, the flavonoid content of the plant increases; and by inhibiting the FtHDA8 gene, the flavonoid content of the plant decreases.

[0010] Technical solution 4: A method for regulating the content of plant flavonoids, comprising the steps of regulating the expression of the FtHDA8 gene or the protein encoded by it in a recipient plant;

[0011] The nucleotide sequence of the coding region of the FtHDA8 gene is shown in SEQ ID No.1.

[0012] Furthermore, the flavonoid content of the plant is increased by overexpressing the FtHDA8 gene or the protein encoded by it.

[0013] Furthermore, the plants include Arabidopsis thaliana and Tartary buckwheat.

[0014] Compared with the prior art, the present invention has the following advantages and technical effects:

[0015] The inflorescence transformation was mediated by positive Agrobacterium GV3101, and transgenic Arabidopsis was obtained after kanamycin resistance screening. The expression level of FtHDA8 in transgenic Arabidopsis was detected by qRT-PCR, and the flavonoid content of FtHDA8 overexpressed Arabidopsis was determined. The results show that the present invention successfully cultivated Arabidopsis materials with high flavonoid content by specifically overexpressing the FtHDA8 gene. The high flavonoid Arabidopsis plants obtained by the present invention have significantly improved flavonoid content compared with the wild type, providing important germplasm resources for the breeding of flavonoid-rich buckwheat varieties and the study of flavonoid synthesis mechanism. The application of the present invention is not only limited to Arabidopsis, but also can improve the flavonoid content in buckwheat through similar mechanisms, enhance its biological activity, and by increasing the flavonoid content of buckwheat, the present invention helps to improve the processing value and market competitiveness of buckwheat and promote the high-value development of the buckwheat industry. The implementation of the present invention helps to expand the planting area of ​​buckwheat and promote the diversified development of the local agricultural economy. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0017] Figure 1 is the expression level of FtHDA8 gene in wild type (WT) and FtHDA8 overexpression (OX-1 and OX-2) strains;

[0018] Figure 2 Comparison of the phenotypes of wild-type (WT) and FtHDA8-overexpressing (OX-1 and OX-2) lines grown for 7 weeks;

[0019] Figure 3 Comparison of flavonoid content in leaves of wild-type (WT) and FtHDA8 overexpression (OX-1 and OX-2) lines. DETAILED DESCRIPTION

[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0021] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0022] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0023] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0024] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0025] Example 1

[0026] Experimental methods

[0027] 1. Construction of FtHDA8 gene (FtPinG0006335800.01) overexpression vector

[0028] FtHDA8 CDS (SEQ ID NO. 1) was synthesized by gene synthesis, and an EcoRI restriction site was added to its 5' end and a HindIII restriction site was added to its 3' end.

[0029] The overexpression vector pEGOEP35S-H-eGFP (https: / / doi.org / 10.1016 / j.jhazmat.2024.134625) was double-digested with EcoRI and HindIII and then connected to FtHDA8 CDS; the ligation product was transformed into Escherichia coli DH5a competent cells by electroporation, and the transformed bacteria were spread on LB screening plates containing 50 mg / L kanamycin. After the plaques grew, a single clone was picked and inoculated into LB liquid culture medium (containing 50 mg / L kanamycin), cultured overnight, and the plasmid was extracted and sent to the company for sequencing verification. The recombinant plasmid verified by sequencing was used to transform Agrobacterium GV3101 to ensure that the Agrobacterium used for transformation contained the target gene.

[0030] The FtHDA8 CDS nucleotide sequence is as follows:

[0031] ATGGCCGTGGCCGGTGAGGAATCGGATAAGATTGACGTCTTCTGGGAGGAGAGAAT

[0032] GCTAAAACACGATACGGGACGCGGCGAATTCGACACAGGCATGGATCCAGGCTTCCTCG

[0033] ACGTCCTTGAGAACCACCCTGAGAACGCCGATAGGGTTAGGAATATGGTCTCCATTCTCC

[0034] GGCGAAGCCCCATCTCCCCCTTCCTTTCATGGCACGCTGGTAGGCCAGCTTCCCTCCCCG

[0035] AATTGCTCTCCTTCCATTCTCAAGATTACATCAATGAATTGGATCAGGCAGATAAATCTGG

[0036] CGGAAAGGAACTGTGTTCTGGAACCTTCTTAAACCCTGGTTCCTGGGAATCCGCTCTTT

[0037] TTGCTGCTGGTACCACTCTCGCAGCCATGAAGCACATACTTGACGGCCATAGAAACATA

[0038] GCTTACGCATTGGTTAGACCTCCTGGCCACCATGCCCAACCCACACAAGCTGATGGATAT

[0039] TGTTTCCTCAACAATGCCGGCCTTGCTGTTCAACTGGCCTTAAATGGAGGTTGCGAAAA

[0040] GGTTGCAGTCATCATCATTGATGTTCATTATGGCAATGGTACTGCACAGGGATTCTATGGA

[0041] TCTGATAAAGTTCTTACTGTGTCCCTTCACATGAATCACGGTTCTTGGGGGGCCTCTCAT

[0042] CCTCAAAGGGGCACTATTCATCAGATTGGTGAAGGGGGAGGCTTAGGGTATAACTTGAA

[0043] CATTCCCTTGCCTAATGGAACTGGAGACATTGGATATGGCTATGCTGTTACTGAGTTGGTA

[0044] GTCCCAGCTGTTAACAACTTTAGGCCTGATGTCATCGTTTTTGTTGTTGGACAGGATTCT

[0045] AGTGCTGGAGGTTAA(SEQ ID NO.1)。

[0046] 2. Agrobacterium activation and propagation

[0047] Take 10 μL of transformed Agrobacterium bacterial solution for streaking, and wait for a single colony to grow on the bacterial plate and inoculate it into 5 mL of liquid LB (50 mg / L kanamycin + 50 mg / L rifampicin (Rif) added to LB) at 28°C, 200 r / min, and shake for 6 hours. Inoculate and expand the culture at a ratio of 1:100 (e.g., take 500 μL of activated transformed Agrobacterium bacterial solution and inoculate it into 50 mL of liquid LB), shake and culture overnight at 28°C, 200 r / min. Collect the bacterial solution at room temperature, discard the supernatant after centrifugation, and resuspend the bacterial solution with a suspension.

[0048] 3. Planting and transplanting using 1 / 2MS solid culture medium

[0049] Arabidopsis seeds (variety Col-0) were sterilized on a clean bench. After sterilization, the seeds were transferred to a culture dish with 1 / 2MS culture medium using a pipette, placed in a culture room for culture, and transplanted to nutrient soil when two true leaves grew. After bolting, they were used for infection during the flowering period (the grown siliques were cut off in advance, and the inflorescences were immersed in the transformed Agrobacterium bacterial solution for about 30 seconds, during which the inflorescences were gently shaken, and the excess bacterial solution on the inflorescences was shaken off when the inflorescences were taken out). The seeds were cultured in the dark for 2 days, and then the T0 seeds were harvested by normal culture.

[0050] 3. Screening of resistant plants

[0051] After sterilization, the T0 seed was sown on a solid screening medium containing hygromycin and placed in a light culture room (16 h light / 8 h dark, 22 °C, relative humidity 75%, light intensity 100 μmol·m -2 ·s -1 ) for 7 weeks, and take photos and record the results. Figure 2 .

[0052] 4. Detection

[0053] Positive seedlings will grow two true leaves and roots, while negative seedlings will die after germination or only grow two cotyledons. The positive seedlings are transplanted into nutrient soil and planted. After growing for about a week, transgenic Arabidopsis OX-1 and OX-2 strains are obtained, and DNA is extracted from leaves for testing.

[0054] 5. Screening of FtHDA8 overexpressing plants

[0055] The expression level of FtHDA8 in the overexpression lines OX-1 and OX-2, as well as the wild-type line, was detected by qRT-PCR. The qRT-PCR amplification procedure was referred to the instructions of the SYBR (Servicebio) kit. The qRT-PCR amplification primer sequences are as follows: forward primer (FtHDA8-F): 5'-TGGCGGAAAGGAACTGTGTT-3' (SEQ ID NO.2); reverse primer (FtHDA8-R): 5'-GTATGTGCTTCATGGCTGCG-3' (SEQ ID NO.3); internal reference gene AtACTIN2 forward primer: 5'-TCCCTCAGCACATTCCAGCAGAT-3' (SEQ ID NO.4), reverse primer: 5'-AACGATTCCTGGACCTGCCTCATC-3' (SEQ ID NO.5). The expression levels of FtHDA8 in the overexpression lines OX-1 and OX-2, as well as the wild-type line are shown in Figure 1 Table 1 shows the reaction system for qRT-PCR amplification.

[0056] Table 1 Reaction system

[0057] Reagents Addition amount (μL) SYBR Master Mix (2×) 5 Forward Primer 2 Reverse primer 2 cDNA 1

[0058] 6. Determination of flavonoid content

[0059] Take the leaves of the overexpression strains OX-1 and OX-2, as well as the wild-type strain, freeze-dry or quickly freeze with liquid nitrogen, weigh 0.5g of sample powder and place it in a 10mL centrifuge tube, dilute to 10mL with 70% methanol, extract by ultrasonic for 30min, and then centrifuge (8000r / min, 15min), and take the supernatant for later use. Pipette 0.25mL of extract, 4.75mL of 70% methanol solution, 2mL of AlCl3 solution (0.1mol / L) and 3mL of potassium acetate solution (1mol / L), mix evenly, keep it away from light for 30min, and measure the absorbance of the sample reaction solution at 415nm. Finally, the flavonoid content in the Arabidopsis leaves of each strain was calculated according to the rutin standard curve (in mg / g). The results are shown in Figure 3 .

[0060] Figure 1 The results showed that the expression level of FtHDA8 in FtHDA8 overexpression (OX-1 and OX-2) lines was significantly higher than that in the wild type (WT); Figure 2 The results showed that there was no significant difference in phenotype between the FtHDA8 overexpression (OX-1 and OX-2) lines and the wild type (WT) after 7 weeks of light culture, indicating that overexpression of FtHDA8 had no significant effect on the growth of Arabidopsis plants. Figure 3The results showed that the flavonoid content in the leaves of FtHDA8 overexpression (OX-1 and OX-2) lines was significantly higher than that of the wild type (WT), indicating that overexpression of FtHDA8 can significantly promote flavonoid synthesis in Arabidopsis plants.

[0061] The present invention provides Arabidopsis materials with high flavonoid content that are successfully cultivated by specifically overexpressing the FtHDA8 gene. The Arabidopsis plants cultivated by the method of the present invention have significantly higher flavonoid content than the wild type. The application of the present invention is not limited to Arabidopsis, but can also increase the flavonoid content in tartary buckwheat through a similar mechanism to enhance its biological activity. By increasing the flavonoid content of tartary buckwheat, the present invention helps to improve the processing value and market competitiveness of tartary buckwheat and promote the high-value development of the tartary buckwheat industry. The implementation of the present invention helps to expand the planting area of ​​tartary buckwheat and promote the diversified development of the local agricultural economy.

[0062] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. The application of FtHDA8 gene in increasing the content of flavonoids in plants is characterized by: The nucleotide sequence of the coding region of the FtHDA8 gene is shown in SEQ ID No.

1.

2. Use of a recombinant vector containing the FtHDA8 gene described in claim 1 in increasing the content of plant flavonoids.

3. Use of a host bacterium containing the recombinant vector described in claim 2 in increasing the flavonoid content of plants.

4. The use according to any one of claims 1 to 3, characterized in that: When the FtHDA8 gene is overexpressed, the flavonoid content of the plant increases; when the FtHDA8 gene is inhibited, the flavonoid content of the plant decreases.

5. A method for regulating the content of plant flavonoids, characterized in that: The method comprises the steps of regulating the expression level of the FtHDA8 gene or the protein encoded by the gene in the recipient plant; The nucleotide sequence of the coding region of the FtHDA8 gene is shown in SEQ ID No.

1.

6. The method according to claim 5, characterized in that The flavonoid content of the plant is increased by overexpressing the FtHDA8 gene or the protein encoded by it.

7. The method according to any one of claims 5-6, characterized in that: The plants include Arabidopsis thaliana and Tartary buckwheat.

Images