Hsa-miR-12117 related to cisplatin resistance of tumor cells and application of hsa-miR-12117

Abstract

The invention discloses hsa-miR-12117 related to the cisplatin resistance of tumor cells and an application of the hsa-miR-12117. Through establishment of a Helaa / DDP drug-resistant cell strain and a detection experiment thereof, it is found that hsa-miR-12117 is remarkably overexpressed in cervical cancer cells and can be used as a marker of cervical cancer drug resistance. The further research finds that the drug resistance of Helan / DDP cells to cis-platinum can be reversed by down-regulating the expression of hsa-miR-12117, and the drug sensitivity is improved; by down-regulating the expression of the hsa-miR-12117, the proliferation speed and the clone forming ability of the Helaa / DDP cells of the cervical cancer can be inhibited. The invention provides a novel cervical cancer molecular treatment target, and provides a scientific basis for guiding clinical medication and more effectively resisting cis-platinum drug resistance.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to molecular markers related to cisplatin resistance of tumor cells and applications thereof. Background Art

[0002] Malignant tumors, also known as cancer, are diseases that pose a major threat to human health worldwide. According to statistics from the World Health Organization, there are approximately 12.7 million new cases of cancer and approximately 7.6 million deaths from cancer each year worldwide. It is estimated that by 2030, the number of deaths from cancer each year will exceed 13.1 million. Currently, traditional treatments for cancer mainly include surgery, chemotherapy, and radiotherapy. Chemotherapy, also known as drug therapy, uses drugs to kill cancer cells or prevent their growth. However, the dose-dependent toxicity of chemotherapy drugs limits their therapeutic effects, and over time, tumors may develop resistance to these drugs, which further reduces the effectiveness of treatment.

[0003] Cisplatin, as the first generation of platinum anticancer drugs, has become an indispensable first-line drug in the treatment of various cancers since it was introduced into clinical practice in 1978. Its unique anti-tumor activity is mainly attributed to its ability to form cross-links with DNA, which leads to the obstruction of tumor cell replication and transcription, and ultimately induces cell death. However, with the widespread clinical application of cisplatin, the problem of tumor cell resistance to cisplatin has gradually emerged, becoming a major obstacle to its efficacy and scope of application. In order to overcome tumor resistance, improve the efficacy of chemotherapy and targeted therapy, reduce the risk of drug resistance, and prolong the survival of patients, this field urgently needs in-depth exploration, hoping to improve the efficacy of cisplatin in cancer treatment, reduce the risk of drug resistance, and ultimately prolong the survival of patients and improve their quality of life. Summary of the invention

[0004] The purpose of the present invention is to find key microRNAs that improve the sensitivity of tumor cells to cisplatin and to develop corresponding detection reagents and therapeutic drugs.

[0005] To achieve the above objectives, the present invention cultured Hela (cervical cancer) cells and established Hela / DDP-resistant cell lines, and detected the differential expression of genes between the two, and found that hsa-miR-12117 can be used as a marker for cervical cancer cell resistance.

[0006] Further research on the role of hsa-miR-12117 in Hela / DDP cell resistance to cisplatin found that downregulating hsa-miR-12117 expression can reverse Hela / DDP cell resistance to cisplatin; downregulating hsa-miR-12117 expression can inhibit the proliferation rate of cervical cancer Hela / DDP cells and also inhibit their cloning ability. This provides a scientific basis for finding new molecular therapeutic targets, guiding clinical medication, and more effectively combating cisplatin resistance.

[0007] The present invention found that the expression level of hsa-miR-12117 can reflect the therapeutic effect of cisplatin on patients and can be used to guide clinical medication; and the therapeutic effect of cisplatin can be increased by the inhibitor of this microRNA, which has more clinical transformation value.

[0008] To achieve the purpose of the present invention, the specific technical scheme adopted is as follows: The present invention provides a molecular marker for cisplatin resistance of cervical cancer cells, characterized in that the molecular marker is hsa-miR-12117, whose nucleotide sequence is shown in SEQ ID NO: 1, and the expression level of hsa-miR-12117 is increased in cervical cancer cells resistant to cisplatin.

[0009] The nucleotide sequence of hsa-miR-12117 is shown in SEQ ID NO.1: GAAGTGGAGCGCATCAGTGA.

[0010] The present invention provides a detection reagent for detecting the resistance of cervical cancer to cisplatin, which is used for detecting the expression level of a marker hsa-miR-12117 whose nucleotide sequence is shown in SEQ ID NO: 1. The detection reagent comprises a reverse transcription reagent and an amplification reagent. The reverse transcription reagent contains an hsa-miR-12117 reverse transcription primer, and the nucleotide sequence of the reverse transcription primer is shown in SEQ ID NO: 2; the amplification reagent contains an hsa-miR-12117 amplification primer pair, the nucleotide sequence of the hsa-miR-12117 forward primer is shown in SEQ ID NO: 3, and the nucleotide sequence of the hsa-miR-12117 reverse primer is shown in SEQ ID NO: 4.

[0011] The detection reagent also includes 10 × Buffer, dNTP, MgCl 2 , Taq enzyme and TaqMan probe.

[0012] The present invention provides an hsa-miR-12117 inhibitor for reducing the expression level of hsa-miR-12117 in cervical cancer cells.

[0013] The nucleotide sequence of the hsa-miR-12117 inhibitor is shown in SEQ ID NO: 6, and the hsa-miR-12117 inhibitor is selected from the following siRNA, dsRNA, shRNA, miRNA, antisense nucleotide that can reduce the expression level of hsa-miR-12117 in cervical cancer cells; or a construct or small molecule compound that can express or form the siRNA, dsRNA, shRNA, miRNA, antisense nucleotide.

[0014] Furthermore, the present invention provides the use of an hsa-miR-12117 inhibitor in the preparation of a drug for reversing cervical cancer resistance to cisplatin.

[0015] The hsa-miR-12117 inhibitor contained in the drug downregulates the expression of hsa-miR-12117 in cervical cancer resistant cells, and can reverse the resistance of cervical cancer resistant cells to cisplatin.

[0016] Furthermore, the present invention also provides the use of an hsa-miR-12117 inhibitor in the preparation of an enhancer for enhancing the sensitivity of cervical cancer to cisplatin.

[0017] The hsa-miR-12117 inhibitor contained in the promoter down-regulates the expression of hsa-miR-12117 in cervical cancer resistant cells, reduces the half inhibitory concentration of cisplatin on cervical cancer resistant cells, and improves the drug sensitivity of cervical cancer resistant cells to cisplatin.

[0018] Furthermore, the present invention provides the use of hsa-miR-12117 inhibitor and cisplatin in the preparation of cervical cancer chemotherapy drugs. The hsa-miR-12117 inhibitor contained in the drug can downregulate the expression of hsa-miR-12117 in cervical cancer resistant cells, inhibiting the proliferation rate and cloning ability of cervical cancer resistant cells.

[0019] Furthermore, the present invention provides a cervical cancer chemotherapy drug, which contains an hsa-miR-12117 inhibitor and cisplatin as main active ingredients. The hsa-miR-12117 inhibitor contained in the drug can downregulate the expression of hsa-miR-12117 in cervical cancer resistant cells, thereby inhibiting the proliferation rate and cloning ability of cervical cancer resistant cells.

[0020] Based on the above technical solution, the present invention has the following beneficial effects: The present invention discovers through Hela / DDP cell lines that hsa-miR-12117 can be used as a marker for cervical cancer resistance to cisplatin, providing a new molecular therapeutic target for the treatment of cervical cancer. The expression level of hsa-miR-12117 can reflect the therapeutic effect of cisplatin on patients, which is beneficial for guiding clinical medication.

[0021] Further research found that downregulating the expression of hsa-miR-12117 can reverse the resistance of Hela / DDP cells to cisplatin, inhibit the proliferation rate of cervical cancer Hela / DDP cells, and also inhibit their cloning ability. The inhibitor of this microRNA can increase the therapeutic effect of cisplatin, which has more clinical translation value and provides a scientific means to effectively combat cisplatin resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a comparative diagram of the expression of hsa-miR-12117 in the control cell line and the drug-resistant cell line detected in Example 2; Figure 2 This is a screening diagram of the optimal transfection concentration when the drug-resistant tumor cells are transfected with the hsa-miR-12117 inhibitor in Example 3; Figure 3 This is a diagram for screening the optimal transfection time when the drug-resistant tumor cells are transfected with the hsa-miR-12117 inhibitor in Example 3; Figure 4 This is a comparison chart of the half-maximal inhibitory concentration of cisplatin in Example 3 for the experimental group (drug-resistant tumor cells transfected with hsa-miR-12117 inhibitor) and the control group; Figure 5 This is a comparison chart of the monoclonal formation ability of drug-resistant tumor cells in the experimental group and the control group in Example 3 under the action of the same concentration of drugs. DETAILED DESCRIPTION

[0023] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0024] IC50 (half maximal inhibitory concentration) refers to the half inhibitory concentration of the antagonist being measured. Log IC50 is the logarithmic value of IC50. Logarithmic conversion helps to standardize the range of IC50 values, making it more suitable for statistical analysis and comparison.

[0025] The present invention found through qRT-PCR analysis that compared with the control Hela cell line, the expression of hsa-miR-12117 in Hela / DDP cells resistant to cisplatin was significantly increased. Further observation of the possible role of hsa-miR-12117 in tumor cell resistance to cisplatin, this study transfected Hela / DDP cells with hsa-miR-12117 inhibitors, and found that the drug sensitivity to cisplatin changed significantly, and the IC50 value of cisplatin for Hela / DDP cells transfected with hsa-miR-12117 inhibitors was significantly lower than that of the control group. It shows that inhibiting hsa-miR-12117 can increase the sensitivity of Hela / DDP cells to cisplatin. In addition, the study found that inhibiting hsa-miR-12117 can significantly inhibit the proliferation and clone formation of Hela / DDP cells.

[0026] The nucleotide sequences involved in the present invention are shown in Table 1 below.

[0027] Table 1 Nucleotide sequence table name Sequence (5'—3') SEQ ID NO hsa-miR-12117 GAAGTGGAGCGCATCAGTGA SEQ ID NO.1 hsa-miR-12117 reverse transcription primers CAGTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTTTTTTTVN SEQ ID NO.2 hsa-miR-12117 forward primer GAAGTGGAGCGCATCAG SEQ ID NO.3 hsa-miR-12117 reverse primer CAGTGCAGGGTCCGAGGT SEQ ID NO.4 hsa-miR-12117 probe TGCCCAGGTGGCT SEQ ID NO.5 hsa-miR-12117 inhibitors TCACTGATGCGCTCCACTTC SEQ ID NO.6 miR-NC inhibitors TACGTAGTCTAGCTAGGCTAGAGCT SEQ ID NO: 7 Example 1 Cultivation of Hela cells and establishment of Hela / DDP-resistant cell line 1. HeLa cell culture Hela (cervical cancer cells) were cultured in DMEM medium containing 10% FBS at 37°C and 5% CO 2 Culture in an incubator.

[0028] 2. Establishment of Hela / DDP-resistant cell line Tumor-resistant cell lines are screened by continuously increasing drug concentrations.

[0029] First, the IC50 of cisplatin in Hela cells (cervical cancer cells) is 500nM. The cisplatin concentration of Hela cells in the logarithmic growth phase starts from 500nM. After 3 days of culture, the cells are replaced with fresh culture medium to remove dead cells and continue to be cultured without adding drugs. After 1 to 2 weeks of culture, the surviving cells gradually grow into cell clusters. After trypsin digestion and subculture, the drugs are added and cultured for 1 to 2 weeks. The surviving cells can tolerate 500nM of drugs. After the cell state improves, the drug concentration is increased to 600nM. After some cells die, the medium is changed and culture is continued. After observing no obvious dead cells, cells in the logarithmic growth phase are selected for subculture, and the cisplatin drug concentration is continued to increase. The subculture is repeated until the IC50 of cisplatin increases to 5-10μM, which is equivalent to increasing the IC50 by about 10 times. The cells are considered to have obvious drug resistance, and a tumor cell line resistant to cisplatin is obtained.

[0030] Example 2 Detection of differential expression of hsa-miR-12117 (I) Detection of the differential expression of hsa-miR-12117 in Hela wild-type cells and Hela / DDP cells The expression difference of hsa-miR-12117 in Hela wild-type cells and drug-resistant cells Hela / DDP was detected by fluorescence quantitative PCR.

[0031] 1. miRNA Extraction Hela wild cells and Hela cisplatin-resistant cells were collected from the control group. Using Tiangen's miRNA extraction kit, 50 mg of cell sample tissue was supplemented with lysis buffer MZ to 1 mL and quickly mixed; the homogenate sample was placed at 15-30°C for 5 minutes to completely separate the nucleic acid-protein complex; centrifuged at 12,000 rpm for 5 minutes at 4°C, and the supernatant was transferred to a new RNase-free centrifuge tube; 200 μL of chloroform was added, the tube was covered and shaken vigorously for 15 seconds, and placed at room temperature for 5 minutes; the solution and the precipitate were transferred to the adsorption column miRspin, centrifuged at 12,000 rpm for 30 seconds at room temperature, the effluent was discarded, and the adsorption column was retained; the volume of the transfer solution was measured, and 0.43 times the volume of the transfer solution was slowly added with anhydrous ethanol, and mixed; 500 μL of deproteinized solution MRD and 500 μL of rinse solution RW were added to the adsorption column miRelute, and the waste solution was discarded after centrifugation at room temperature for 30 seconds, and the rinse step was repeated; the adsorption column miRelute was placed in 2 Transfer the adsorption column miRelute to a new RNase-Free 1.5mL centrifuge tube, and drop 15-30μL RNase-Free ddH2O in the middle of the adsorption membrane. 2 O, place at room temperature for 2 minutes and then centrifuge for 2 minutes.

[0032] 2. Tailing Reverse Transcription Take 100pg-1μg RNA template and mix it with 2μL 10×Poly (A) Polymerase Buffer, 0.5μL E.coliPoly (A) Polymerase (5U / μl), 1μL ATP (10mM), 1μL dNTP Mix (10μM), 1μL HiScript ⅡReverse Transcriptase (200U / μl), 1μL RNase inhibitor (40μM), 1μL RT primer universal (5μM), and 2.5μL RNase-free ddH2O, and place it in a gene amplification instrument for tailing and reverse transcription. The reaction conditions are 42℃, 60min; 85℃, 5min; 4℃, forever.

[0033] The sequence of the reverse transcription primer involved in the reverse transcription reaction is shown in SEQ ID NO: 2: CAGTGCAGGGTCCGAGGTCAGAGCCACCTGGGCAATTTTTTTTTTTVN.

[0034] 3. Q-PCR detection A 20 μL reaction system was used, and 3 parallel tubes were set for each sample. All amplification reactions were repeated three times to ensure the reliability of the results. The routine steps were followed, and the sequences of the cDNA amplification primers for hsa-miR-12117 were shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. The following reaction system was prepared: 2×TaqMan miX 10 μL, forward primer (5 μM) 1 μL, reverse primer (5 μM) 1 μL, template cDNA 2 μL, enzyme-free water 6 μL. All operations were performed on ice. The amplification program was: 95℃ 2min, (95℃ 5s, 60℃ 30s) 40 cycles. TaqMan probe was used as a fluorescent marker, and PCR reaction was performed on an ABI 7500 fluorescent real-time quantitative PCR instrument. RNU6-1 was used as an internal reference to detect the relative expression level (ΔCt value) of hsa-miR-12117 in cells.

[0035] The amplification primers and probes involved in the amplification reaction are shown below: The nucleotide sequence of the hsa-miR- 12117 forward primer is shown in SEQ ID NO: 3: GAAGTGGAGCGCATCAG; The nucleotide sequence of the hsa-miR- 12117 reverse primer is shown in SEQ ID NO: 4: CAGTGCAGGGTCCGAGGT; The nucleotide sequence of the hsa-miR-12117 probe is shown in SEQ ID NO: 5: TGCCCAGGTGGCT.

[0036] Test results such as Figure 1 As shown, hsa-miR-12117 was significantly overexpressed in cisplatin-resistant human cervical cancer cell lines compared with the control group.

[0037] (II) Detection of the differential expression of hsa-miR-12117 in cervical cancer cell lines with different resistance to cisplatin The establishment process of the Hela / DDP-resistant cell line in Example 1 was carried out by sampling the cell lines after adding cisplatin at different concentrations, and the above-mentioned method for detecting the differential expression of hsa-miR-12117 in Hela and Hela / DDP-resistant cell lines was used to detect the differential expression of hsa-miR-12117 in the Hela / DDP-resistant cell lines after culturing with different concentrations of cisplatin. By detecting the expression, as the concentration of cisplatin added increases, the expression of hsa-miR-12117 in the cultured Hela / DDP-resistant cell lines increases, that is, the higher the degree of resistance of cervical cancer resistant cells to cisplatin, the higher the expression of hsa-miR-12117.

[0038] The experiment of Example 2 shows that hsa-miR-12117 is significantly highly expressed in cervical cancer cell lines resistant to cisplatin, and the higher the degree of resistance of cervical cancer cells to cisplatin, the higher the expression of hsa-miR-12117. Therefore, the degree of resistance of tumor cells to cisplatin can be determined by detecting the expression of hsa-miR-12117 in cervical cancer cells.

[0039] Therefore, the detection reagent of the present invention for detecting the expression level of the marker hsa-miR-12117 whose nucleotide sequence is shown in SEQ ID NO: 1 can be used as a detection reagent for detecting the drug resistance of cervical cancer to cisplatin.

[0040] The detection reagent comprises a reverse transcription reagent and an amplification reagent, wherein the reverse transcription reagent contains an hsa-miR-12117 reverse transcription primer, and the nucleotide sequence of the reverse transcription primer is shown in SEQ ID NO: 2; the amplification reagent contains an hsa-miR-12117 amplification primer pair, wherein the nucleotide sequence of the hsa-miR-12117 forward primer is shown in SEQ ID NO: 3, and the nucleotide sequence of the hsa-miR-12117 reverse primer is shown in SEQ ID NO: 4.

[0041] Example 3 Effect of interfering with hsa-miR-12117 on cell drug resistance The hsa-miR-12117 inhibitor and miR-NC inhibitor were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0042] In the experiment of evaluating the effect of hsa-miR-12117 inhibitor on cell resistance, miR-NC inhibitor served as a control group to eliminate nonspecific effects, verify the specific effect of miRNA, enhance the credibility of experimental results, provide benchmark data and ensure the rigor of the experiment.

[0043] The nucleotide sequence of the hsa-miR- 12117 inhibitor is shown in SEQ ID NO: 6: TCACTGATGCGCTCCACTTC; The nucleotide sequence of the miR-NC inhibitor is shown in SEQ ID NO: 7: TACGTAGTCTAGCTAGGCTAGAGCT.

[0044] (1) Screening for the optimal transfection concentration and time of hsa-miR-12117 inhibitor Hela / DDP-resistant cells in the logarithmic growth phase were digested with 0.5% trypsin and prepared into a single cell suspension. The cells were seeded in a 96-well culture plate at 6×10 3 cells / well. After the cells adhered, cisplatin was added at a final concentration of 5 nmol / L, 100 μL / well. The hsa-miR-12117 inhibitor was transfected into the cells according to the instructions of the transfection reagent lipofectamine 3000, with a final concentration of 10 nmol / L, 100 nmol / L, 1 μmol / L, 10 μmol / L, and 100 μmol / L. 37°C, 5% CO 2 After continuous culture in the incubator for 24 hours, discard the culture medium in the wells, add 100 μL of fresh culture medium and 10 μL of CCK8 solution to each well, and culture at 37°C for 1 hour. After the culture is completed, put the plate into the microplate reader, read the absorbance value of each well at OD450nm, and take the average absorbance value (OD value) of 3 replicate wells. The results are as follows Figure 2 As shown, the optimal transfection concentration of hsa-miR-12117 inhibitor was 1 μmol / L.

[0045] Cell preparation was the same as before. After Hela / DDP-resistant cells adhered to the wall, cisplatin with a final concentration of 5 nmol / L and hsa-miR-12117 inhibitor at 1 μM were added. 37°C, 5% CO 2 After culturing in the incubator for 12h, 24h and 48h, the absorbance of each well was detected by CCK method, and the average OD value of 3 replicate wells was taken. Figure 3 As shown, the optimal transfection time of hsa-miR-12117 inhibitor was 24h.

[0046] (2) The CCK8 method was used to detect the half inhibitory concentration (logIC50) of cells to drugs before and after hsa-miR-12117 interference.

[0047] By inhibiting the function of this miRNA, we observe whether the drug resistance of tumor cells can be reduced.

[0048] Cells in logarithmic growth phase were taken for cell transfection, and 1 μmol / L hsa-miR-12117 inhibitor and miR-NC inhibitor were transfected into Hela / DDP-resistant cells respectively. Another group of Hela / DDP-resistant cells were not transfected as control.

[0049] 24 h after cell transfection, cells were digested with 0.5% trypsin and prepared into single cell suspension. Cells were seeded in 96-well culture plates at 6×10 3 After the cells adhered, add cisplatin at a final concentration of 6nmol / L, 5nmol / L, 4nmol / L, 3nmol / L, 2nmol / L, 1nmol / L, 100μL / well. 37℃, 5% CO 2 After continuous culture in the incubator for 48 hours, discard the culture medium in the wells, add 100 μL of fresh culture medium and 10 μL of CCK8 solution to each well, and culture at 37°C for 1 hour. After the culture, place the plate in a microplate reader, read the absorbance value of each well at OD450nm, and take the average absorbance value (OD) of 3 replicate wells. Use graphpad 10.0 software to draw a cell growth inhibition curve based on the data, and calculate the half inhibitory concentration (logIC50) of cisplatin on cells to analyze the changes in cell resistance. The results are as follows Figure 4 As shown, the logIC50 of cisplatin against resistant cells transfected with hsa-miR-12117 inhibitor was significantly decreased, that is, inhibition of hsa-miR-12117 led to increased sensitivity of Hela resistant cells to cisplatin.

[0050] Based on the above experiments, the present invention develops an hsa-miR-12117 inhibitor for reducing the expression of hsa-miR-12117 in cervical cancer cells and its application.

[0051] The nucleotide sequence of the hsa-miR-12117 inhibitor is shown in SEQ ID NO: 6, and the hsa-miR-12117inhibito is selected from the following siRNA, dsRNA, shRNA, miRNA, antisense nucleotide that can reduce the expression level of hsa-miR-12117 in cervical cancer cells; or a construct or small molecule compound that can express or form the siRNA, dsRNA, shRNA, miRNA, antisense nucleotide.

[0052] Furthermore, the hsa-miR-12117 inhibitor is used to prepare a drug for reversing the resistance of cervical cancer to cisplatin. The hsa-miR-12117 inhibitor contained in the drug downregulates the expression of hsa-miR-10523 in cervical cancer resistant cells and can reverse the resistance of hepatocellular carcinoma resistant cells to 5-fluorouracil.

[0053] Furthermore, the hsa-miR-12117 inhibitor is used to prepare an enhancer for the sensitivity of cervical cancer to cisplatin. The enhancer contains the hsa-miR-12117 inhibitor, which downregulates the expression of hsa-miR-10523 in cervical cancer resistant cells and increases the sensitivity of cervical cancer resistant cells to cisplatin.

[0054] (3) Cell plate clone formation assay to detect the proliferation ability of Hela / DDP-resistant cells after transfection After 24 hours of cell transfection, the cells were digested with 0.5% trypsin and prepared into single-cell suspension using DMEM culture medium containing 10% FBS (final concentration of cisplatin was 5 μM). The cells were seeded in 6-well plates at 2×10 3 The cells were evenly distributed and cultured for 7 days at 37°C and 5% CO 2 After the culture is completed, the plate is placed in a microplate reader, and the absorbance value of each well is read at OD450nm, and the average absorbance value (OD) of three replicate wells is taken.

[0055] The number of Hela / DDP cell clones transfected with hsa-miR-12117 inhibitor was significantly reduced compared with the control group ( Figure 5 ). Therefore, the hsa-miR-12117 inhibitor not only inhibits the proliferation rate of cervical cancer Hela / DDP cells, but also inhibits their clone formation ability.

[0056] Based on the above experiments, the present invention provides the use of hsa-miR-12117 inhibitor and cisplatin in the preparation of cervical cancer chemotherapy drugs. The hsa-miR-12117 inhibitor contained in the drug can downregulate the expression of hsa-miR-12117 in cervical cancer resistant cells, inhibiting the proliferation rate and cloning ability of cervical cancer resistant cells.

[0057] Furthermore, a cervical cancer chemotherapy drug is provided, which has an hsa-miR-12117 inhibitor and cisplatin as main active ingredients. The hsa-miR-12117 inhibitor contained in the drug can downregulate the expression of hsa-miR-12117 in cervical cancer resistant cells, thereby inhibiting the proliferation rate and cloning ability of cervical cancer resistant cells.

[0058] The present invention provides a new molecular therapeutic target for cervical cancer, provides a scientific basis for guiding clinical medication, and more effectively combats 5-fluorouracil resistance.

[0059] Although the specification of the present invention fully describes the technical solution, those skilled in the art can make some modifications or improvements to the technical solution of the present invention on this basis without creative work. Any technical solution obtained by replacing the same or equivalent technical means shall fall within the scope of protection required by the present invention.

Claims

1. A marker for cisplatin resistance of cervical cancer cells, characterized in that: The marker is hsa-miR-12117, and its nucleotide sequence is shown in SEQ ID NO:

1. The expression level of hsa-miR-12117 is increased in cervical cancer cells that are resistant to cisplatin.

2. A detection reagent for detecting cisplatin resistance in cervical cancer, characterized in that: Used to detect the expression level of the marker hsa-miR-12117 whose nucleotide sequence is shown in SEQ ID NO: 1, the detection reagent comprises a reverse transcription reagent and an amplification reagent, the reverse transcription reagent contains an hsa-miR-12117 reverse transcription primer, and the nucleotide sequence of the reverse transcription primer is shown in SEQ ID NO: 2; the amplification reagent contains an hsa-miR-12117 amplification primer pair, the nucleotide sequence of the hsa-miR-12117 forward primer is shown in SEQ ID NO: 3, and the nucleotide sequence of the hsa-miR-12117 reverse primer is shown in SEQ ID NO:

4.

3. An hsa-miR-12117 inhibitor for reducing the expression of hsa-miR-12117 in cervical cancer cells, characterized in that: The nucleotide sequence of the hsa-miR-12117 inhibitor is shown in SEQ ID NO: 6, and the hsa-miR-12117 inhibitor is selected from the following siRNA, dsRNA, shRNA, miRNA, antisense nucleotide that can reduce the expression level of hsa-miR-12117 in cervical cancer cells; or a construct or small molecule compound that can express or form the siRNA, dsRNA, shRNA, miRNA, antisense nucleotide.

4. Use of an hsa-miR-12117 inhibitor in the preparation of a drug for reversing the resistance of cervical cancer to cisplatin, wherein the hsa-miR-12117 inhibitor contained in the drug downregulates the expression of hsa-miR-12117 in cervical cancer resistant cells, and can reverse the resistance of cervical cancer resistant cells to cisplatin.

5. Use of an hsa-miR-12117 inhibitor in the preparation of an enhancer for the sensitivity of cervical cancer to cisplatin, wherein the hsa-miR-12117 inhibitor contained in the enhancer downregulates the expression of hsa-miR-12117 in cervical cancer resistant cells, reduces the half inhibitory concentration of cisplatin on cervical cancer resistant cells, and improves the drug sensitivity of cervical cancer resistant cells to cisplatin.

6. Application of hsa-miR-12117 inhibitor and cisplatin in the preparation of cervical cancer chemotherapy drugs. The hsa-miR-12117 inhibitor contained in the drug can downregulate the expression of hsa-miR-12117 in cervical cancer resistant cells, inhibiting the proliferation rate and cloning ability of cervical cancer resistant cells.

7. A chemotherapeutic drug for cervical cancer, characterized in that: The drug has an hsa-miR-12117 inhibitor and cisplatin as main active ingredients. The hsa-miR-12117 inhibitor contained in the drug can downregulate the expression of hsa-miR-12117 in cervical cancer resistant cells and inhibit the proliferation rate and cloning ability of cervical cancer resistant cells.

Images