Molecular marker linked with wheat stripe rust resistance gene YrZ41-2AL and application of molecular marker

Abstract

The invention provides a molecular marker linked with a wheat stripe rust resistance gene YrZ41-2AL and application of the molecular marker, and belongs to the technical field of molecular markers. The nucleotide sequence of the molecular marker KASP-2AL-2 provided by the invention is as shown in SEQ ID NO. 1, and the polymorphism of the nineteenth base of the nucleotide sequence is T or C. The molecular marker KASP-2AL-2 has the advantages that the nucleotide sequence is shown in SEQ ID NO. The molecular marker KASP-2AL-2 is closely linked with the stripe rust resistant gene YrZ41-2AL on the wheat 2A chromosome, can rapidly and accurately detect the stripe rust resistant gene, and has high application value in the aspects of screening or identifying the wheat stripe rust resistance, cultivating wheat with stripe rust resistance, improving wheat germplasm resources and the like.

Description

Technical Field

[0001] The invention relates to the technical field of molecular markers, in particular to a molecular marker linked to a wheat stripe rust resistance gene YrZ41-2AL and an application thereof. Background Art

[0002] Wheat (Triticum aestivum L.) is an important food crop, and its yield directly affects my country's food security. With the continuous growth of the world's population, in order to meet the food demand of the rapidly growing population, it is estimated that food production will need to increase by 70% by 2050. Therefore, ensuring high and stable yields of wheat and continuously improving wheat yields is not only an effective means to ensure my country's food security, but also an important challenge faced by the majority of breeders.

[0003] Wheat is often threatened by various diseases during its growth process, which affects its yield. Stripe rust, caused by Puccinia striiformis f.sp.tritici (Pst), is a major biological disaster that threatens the safe production of wheat. Stripe rust is one of the most widespread and most harmful wheat diseases in my country. It can cause a yield loss of 10-30% in the year of occurrence, and more serious yield losses or even crop failure in the year of epidemic. Breeding and promoting disease-resistant varieties and reducing wheat yield losses caused by diseases are effective means to ensure my country's food security.

[0004] Common wheat is an allohexaploid, and has lost a large number of excellent genes from its ancestral species during the process of evolution and domestication. Cultivated emmer wheat (T. turgidum ssp. dicoccum) is a primitive tetraploid wheat with husk domesticated from wild emmer wheat. It carries abundant loci for resistance to powdery mildew, stem rust, leaf rust, and stripe rust, and is an important resource material for the genetic improvement of common wheat. At present, there are few studies on the stripe rust resistance genes of cultivated emmer wheat.

[0005] The cultivated two-grain wheat Z41 is a resource material collected and preserved by the Wheat Research Institute of Sichuan Agricultural University. It shows a high level of resistance to stripe rust in the field. Exploring the stripe rust resistance gene of Z41 can provide a new source of resistance for the breeding of disease-resistant wheat varieties. Developing molecular markers closely linked to the Z41 disease-resistant gene can accelerate the use of this disease-resistant gene in disease-resistant breeding. Summary of the invention

[0006] In view of this, the present invention aims to provide a molecular marker linked to the wheat stripe rust resistance gene YrZ41-2AL and its application. The molecular marker KASP-2AL-2 provided by the present invention is a tightly linked marker with accurate and efficient detection and convenient and stable amplification.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] A molecular marker linked to the wheat stripe rust resistance gene YrZ41-2AL and its application. The molecular marker is KASP-2AL-2, and its nucleotide sequence is shown in SEQ ID NO.1. The 19th base polymorphism of the nucleotide sequence is T or C.

[0009] In certain embodiments, the KASP-2AL-2 is tightly linked to the wheat stripe rust resistance gene YrZ41-2AL and co-localized at the end of the long arm of wheat chromosome 2A.

[0010] In certain embodiments, the wheat stripe rust resistance gene YrZ41-2AL corresponds to the 783-788 Mb physical interval of the wild emmer wheat reference genome 2.0.

[0011] In certain embodiments, the genetic distance between KASP-2AL-2 and YrZ41-2AL is 0.9 cM.

[0012] In certain embodiments, the localization method of YrZ41-2AL is as follows: a highly susceptible tetraploid durum wheat 'Langdon' is used as the female parent and a stripe rust resistant tetraploid cultivated emmer wheat 'Z41' is used as the male parent to obtain a hybrid F1, and the hybrid F2 is obtained by self-pollination; the F2 individual plants are continuously self-pollinated by the single seed transmission method to obtain an F5 population; wherein, the highly resistant F5 line HR74 is self-pollinated to obtain a population containing 111 individual plants, and field stripe rust resistance identification shows that 77 plants are resistant and 34 plants are susceptible (chi-square value = 1.024, p = 0.312), which is consistent with the dominant single locus. Due to the segregation ratio, the disease-resistant gene was temporarily named YrZ41-2AL. RNA was extracted from leaves of 18 extremely resistant and 18 extremely susceptible plants in the segregation population, and disease-resistant RNA pools and susceptible RNA pools were constructed, respectively, for transcriptome sequencing. Polymorphic SNP markers between the parental and resistant-susceptible pools in the BSR-Seq data were screened and converted into KASP markers. The stripe rust phenotype of the genetic segregation population was identified, and DNA of the parents 'Langdon', 'Z41' and the resistant-susceptible segregation population was extracted. Based on the developed KASP markers, a genetic map was constructed using JoinMap 4.0, and the disease-resistant gene YrZ41-2AL was located in combination with the resistance phenotypic data of individual plants in the population.

[0013] In certain embodiments, the YrZ41-2AL is from the male tetraploid cultivated emmer wheat 'Z41'.

[0014] The present invention also provides a primer set for amplifying the molecular marker described in the above technical solution, wherein the primer set comprises: a primer KASP-2AL-2F1 having a nucleotide sequence as shown in SEQ ID NO.2, a primer KASP-2AL-2F2 having a nucleotide sequence as shown in SEQ ID NO.3, and a primer KASP-2AL-2C having a nucleotide sequence as shown in SEQ ID NO.4.

[0015] In certain embodiments, the primers shown in SEQ ID NOs. 2 to 3 are respectively connected with different fluorescent modification groups.

[0016] The present invention also provides a method for identifying wheat resistance to stripe rust, which comprises using the genomic DNA of the wheat to be tested as a template, using the primer set described in the above technical scheme to perform fluorescent quantitative PCR amplification, and performing genotyping on the wheat to be tested according to the amplification result to determine whether it has stripe rust resistance.

[0017] In certain embodiments, the judgment criteria of the method are: if the base T corresponding to KASP-2AL-2F1 is detected, the wheat to be tested does not contain the YrZ41-2AL site; if the base C corresponding to KASP-2AL-2F2 is detected, the wheat to be tested contains the homozygous YrZ41-2AL site; if the base T corresponding to KASP-2AL-2F1 and the base C corresponding to KASP-2AL-2F2 are detected at the same time, it is judged that the wheat to be tested contains the heterozygous YrZ41-2AL site; wherein, the wheat to be tested containing the YrZ41-2AL site is resistant to stripe rust.

[0018] The present invention also provides an application of the molecular marker described in the above technical solution or the primer set described in the above technical solution, and the application is any of the following applications:

[0019] (1) Screening or identification of wheat stripe rust resistance;

[0020] (2) Improvement of wheat germplasm resources;

[0021] (3) Development of wheat stripe rust resistant materials;

[0022] (4) Wheat molecular marker-assisted breeding.

[0023] Beneficial technical effects:

[0024] (1) The molecular markers linked to the wheat stripe rust resistance gene YrZ41-2AL provided by the present invention can be used to detect the stripe rust resistance gene YrZ41-2AL, quickly screen plants with the locus, and promote molecular assisted breeding of disease-resistant wheat. KASP-2AL-2 is tightly linked to the stripe rust resistance gene YrZ41-2AL on wheat chromosome 2A, and can be used to locate the trait of wheat stripe rust resistance, thereby eliminating susceptible plants during the breeding process, improving breeding efficiency, and providing a basis for the study of wheat stripe rust resistance genes.

[0025] (2) The present invention discloses for the first time a stripe rust resistance gene from tetraploid cultivated emmer wheat Z41. The gene is located on the long arm of wheat chromosome 2A and can significantly increase wheat stripe rust resistance, thus having potential application value in wheat stripe rust resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 is the genetic linkage map of the wheat stripe rust resistance gene YrZ41-2AL in Example 1;

[0027] Figure 2 The molecular marker KASP-2AL-2 genotyping results of the individual plants of the YrZ41-2AL segregation population in Example 1; wherein, HEX (blue, 'Z41') fluorescence typing is for plants carrying the YrZ41-2AL gene homozygous for stripe rust resistance, and FAM (orange, 'Langdon') fluorescence typing is for susceptible plants that do not contain the YrZ41-2AL gene; green fluorescence is for plants heterozygous for the YrZ41-2AL gene and resistant; and black fluorescence is the blank control NTC. DETAILED DESCRIPTION

[0028] In order to better understand the present invention, the content of the present invention is further explained in conjunction with the following examples, but the content of the present invention is not limited to the following examples. The materials, reagents, etc. used in the examples and test examples of the present invention, unless otherwise specified, can be obtained from commercial channels; the methods used in the examples and test examples of the present invention, unless otherwise specified, are conventional methods.

[0029] The wheat 'Langdon' and 'Z41' used in the following examples are both stored in the Wheat Research Institute of Sichuan Agricultural University and have been published in the following document "Frequent occurrence of unreduced gametes in Triticumturgidum-Aegilops tauschii hybrids, Zhang et al. 2010, Euphytica, 172: 285-294" before the application date, and the applicant promises to make them available to the public within 20 years from the application date.

[0030] Example 1 Obtaining the wheat stripe rust resistance gene YrZ41-2AL and its molecular marker KASP-2AL-2

[0031] (1) Test materials: The stripe rust susceptible tetraploid durum wheat 'Langdon' was used as the female parent and the stripe rust resistant tetraploid cultivated emmer wheat 'Z41' was used as the male parent. The F1 was hybridized and the F1 was self-pollinated to obtain the F2 population. The F2 individual plants were self-pollinated continuously using the single seed transmission method to obtain the F5 population. The F5 disease-resistant strain HR74 was self-pollinated to obtain a population of 111 individual plants that showed resistance and sensitivity segregation. This segregation population was used as the resistance segregation population of YrZ41-2AL.

[0032] (2) Phenotypic identification of stripe rust in the field was conducted on the parents 'Langdon', 'Z41' and the individual plants of the resistant segregating population. Mixed stripe rust species (CYR32, CYR33, CYR34, Zhong4 and HY46, all provided by the Institute of Plant Protection, Gansu Academy of Agricultural Sciences) were inoculated in the field; the materials used for stripe rust resistance identification were planted with 15 seeds per row with a row length of 1.5 m, a plant spacing of 0.1 m, and a row spacing of 0.3 m. The inducing material Avocet S was planted between the rows. At the three-leaf and one-heart stage, artificial inoculation was carried out by smearing method. In March and April of the following year, after Avocet S was fully developed, stripe rust resistance phenotype identification was carried out according to the 0-9 grade grading standard (Line and Qayoum, 1992, Virulence, aggressiveness, evolution, and distribution of races of Puccinia striiformis (the cause of stripe rust of wheat) in North America, 1968-87. Technical Bulletin-USDA). The resistance phenotype survey was conducted four times, once every seven days, and the most serious survey result was used as the final phenotype.

[0033] (3) The results of field stripe rust resistance identification showed that a segregation group consisting of 111 individuals showed resistance and susceptible segregation, with 77 plants resistant to stripe rust and 34 plants susceptible to stripe rust (chi-square value = 1.024, p = 0.312), which was consistent with the dominant single gene segregation ratio, indicating that the stripe rust resistance of the population was controlled by a dominant single gene, temporarily named YrZ41-2AL.

[0034] (4) BSR-Seq data analysis

[0035] ① Genomic DNA extraction: Wheat plant DNA was extracted using the CTAB (Cetyltrimethylammonium Bromide) method (Rogers and Bendich 1985, Plant Mol. Biol., 1985, 5: 69-76).

[0036] ② Screening of polymorphic markers between parents and mixed pools: Transcriptome sequencing combined with mixed group analysis was used to select 18 extremely resistant and susceptible plants from the resistant and susceptible segregation population of 111 individual plants, and construct disease-resistant RNA pools and disease-susceptible RNA pools, respectively. The samples were sent to Novogene (https: / / www.novogene.com / ) for transcriptome sequencing and BSR-Seq analysis to obtain SNP data. After removing heterozygous SNPs in the parents and SNPs with a quality of less than 10% in the parents and resistant and susceptible pools, a total of 61,000 high-quality SNPs were obtained. By calculating the allele differential variation frequency (ΔSNP-index) in the resistant and susceptible pools, a total of 793 differential SNPs with ΔSNP-index ≥ 0.6 were obtained. The chromosome number distribution and sliding window mapping of the 793 SNPs obtained showed that 170 of them were located on chromosome 2A and 133 were enriched at the end of chromosome 2AL.

[0037] ③KASP marker development: According to the BSR-Seq sequencing data, the differential SNPs between the parents and the mixed pool were selected and converted into KASP markers. According to the position information of the SNP on the wild emmer wheat reference genome version 2.0, the 100 base sequences before and after the SNP were extracted, and the bases about 18bp-22bp before the SNP site were designed as FAM and HEX forward primers (the difference lies in the last base of the primer), and the reverse primers were designed from the other end of the SNP site. The specificity of the primers was detected using the wheat family multi-omics data website (http: / / 202.194.139.32 / ). After the primer design was completed, FAM 5'-GAAGGTGACCAAGTTCATGCT-3' and HEX 5'-GAAGGTCGGAGTCAACGGATT-3' fluorescent labels were added to the 5' end of the forward primer sequence, and the universal primer was not modified.

[0038] (5) Genotyping analysis: Based on the designed KASP primers, marker polymorphism was verified using 'Langdon', 'Z41' and the parental and parental pools. Markers with polymorphism between the parental and parental pools were used for genotyping.

[0039] The nucleotide sequence of KASP-2AL-2 (SEQ ID NO. 1) is as follows: 5′-GCAATTACAAGTGCCATCCGCTTAATAATACTAGCAGATTTCTTGTTT CCTACCTACTACTGAACAATGTGG-3′;

[0040] The KASP molecular marker amplification primer set of KASP-2AL-2 includes three primers, namely: KASP-2AL-2F1 (SEQ ID NO.2), KASP-2AL-2F2 (SEQ ID NO.3) and KASP-2AL-2C (SEQ ID NO.4). As shown below:

[0041] KASP-2AL-2F1 primer: (the underlined part is the FAM tag sequence)

[0042] 5'- GAAGGTGACCAAGTTCATGCT GCAATTACAAGTGCCATCT-3'

[0043] (SEQ ID NO.2)

[0044] KASP-2AL-2F2 primer: (the underlined part is the HEX tag sequence)

[0045] 5'- GAAGGTCGGAGTCAACGGATT GCAATTACAAGTGCCATCC-3'

[0046] (SEQ ID NO.3)

[0047] KASP-2AL-2C Primers:

[0048] 5'-CCACATTGTTCAGTAGTAGG-3'(SEQ ID NO.4)

[0049] The KASP marker was used to perform quantitative PCR genotyping on the genomic DNA of the resistant parent 'Z41', the resistant pool, the susceptible parent 'Langdon', the susceptible pool and the offspring population. The resistant and susceptible materials were successfully typed (e.g. Figure 2 ). The typing results of parent Z41 and disease resistance pool are HEX (blue) fluorescence values, and the typing results of parent LDN and disease resistance pool are FAM (orange) fluorescence values. Among them, the genotype of plants with blue fluorescence consistent with the typing of parent Z41 is recorded as "C", which is a stripe rust resistant strain; the genotype of plants with orange fluorescence consistent with the typing of parent LDN is recorded as "T", which is a stripe rust susceptible strain; green fluorescence is a heterozygous strain, and the genotype is recorded as "C / T", which is a stripe rust resistant strain; missing ones are recorded as "-".

[0050] (6) Construction of linkage map: Based on the developed markers, a genetic map was constructed using JoinMap 4.0.

[0051] (7) Figure 1 :Among the 4 pairs of linkage markers designed, the molecular marker KASP-2AL-2 is closely linked to the stripe rust resistance gene YrZ41-2AL. The molecular marker and the wheat stripe rust resistance YrZ41-2AL are co-localized at the end of the long arm of wheat chromosome 2A. Genetic linkage analysis shows that KASP-2AL-2 is closely linked to the stripe rust resistance gene YrZ41-2AL, and the genetic distance between KASP-2AL-2 and YrZ41-2AL is 0.9 cM.

[0052] Example 2 Application of molecular marker KASP-2AL-2 in selecting and controlling stripe rust resistance gene YrZ41-2AL

[0053] (1) A resistance segregating population was constructed using tetraploid durum wheat 'Langdon' susceptible to stripe rust as the female parent and cultivated emmer wheat 'Z41' resistant to stripe rust as the male parent. 60 lines were randomly selected from the progeny lines.

[0054] (2) The 60 strains obtained were subjected to KASP-2AL-2 marker detection. The specific method was as follows: DNA of the 60 strains was extracted; the DNA was used as a template, and a specific primer pair of the molecular marker KASP-2AL-2 was used as a primer for PCR amplification and fluorescence reading. The marker KASP-2AL-2 primers were: KASP-2AL-2F1: (the underlined part is the FAM tag sequence)

[0055] 5'- GAAGGTGACCAAGTTCATGCT GCAATTACAAGTGCCATCT-3'

[0056] (SEQ ID NO.2)

[0057] KASP-2AL-2F2: (The underlined part is the HEX tag sequence)

[0058] 5'- GAAGGTCGGAGTCAACGGATT GCAATTACAAGTGCCATCC-3'

[0059] (SEQ ID NO.3)

[0060] KASP-2AL-2C:

[0061] 5'-CCACATTGTTCAGTAGTAGG-3'(SEQ ID NO.4)

[0062] The amplification reaction system of the above-mentioned fluorescent quantitative PCR is: 5 μL Master Mix, 1.4 μL mixed primers (0.168 μL upstream primer shown in SEQ ID NO.3, 0.168 μL upstream primer shown in SEQ ID NO.4, 0.42 μL downstream primer shown in SEQ ID NO.5 and 0.644 μL ddH2O), 0.8 μL template DNA, 3.8 μL ddH2O, and at least 3 independent blanks with ddH2O instead of DNA template need to be added.

[0063] The above fluorescence quantitative PCR program is shown in Table 1:

[0064] Table 1 Fluorescence quantitative PCR program

[0065]

[0066]

[0067] Fluorescence reading results (such as Figure 2 ), the plant genotype detected with HEX (blue) fluorescence consistent with the parent Z41 typing was recorded as "C", which was a line carrying the YrZ41-2AL homozygous locus, the plant genotype with FAM (orange) fluorescence consistent with the parent LDN typing was recorded as "T", which was a line susceptible to stripe rust without carrying YrZ41-2AL, and the green fluorescence was a line carrying the YrZ41-2AL heterozygous locus, and the genotype was recorded as "C / T". The genotypes and field phenotypic values ​​(disease resistance R, disease sensitivity S) of each line are shown in Table 2. According to the typing results of the marker KASP-2AL-2, the lines containing the homozygous or heterozygous stripe rust resistance gene YrZ41-2AL showed a stripe rust resistance phenotype (R), and the 'Langdon' type lines all showed disease sensitivity (S). The actual results are consistent with the expected results, indicating that the stripe rust resistance YrZ41-2AL of the present invention does have a significant effect of increasing resistance to stripe rust; and the molecular marker KASP-2AL-2 of the present invention can be used to track and identify the stripe rust resistance gene YrZ41-2AL.

[0068] Table 2 Correspondence between genotype and phenotype of the remaining heterozygous strain KASP-2AL-2 of 'Langdon'×'Z41'

[0069]

[0070]

[0071] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A molecular marker linked to the wheat stripe rust resistance gene YrZ41-2AL, characterized in that: The molecular marker is KASP-2AL-2, and its nucleotide sequence is shown in SEQ ID NO.

1. The 19th base polymorphism of the nucleotide sequence is T or C.

2. The molecular marker according to claim 1, characterized in that The KASP-2AL-2 is closely linked to the wheat stripe rust resistance gene YrZ41-2AL and is co-localized at the end of the long arm of wheat chromosome 2A.

3. A primer set for amplifying the molecular marker according to claim 1 or 2, characterized in that: The primer set comprises: a primer KASP-2AL-2F1 having a nucleotide sequence as shown in SEQ ID NO.2, a primer KASP-2AL-2F2 having a nucleotide sequence as shown in SEQ ID NO.3, and a primer KASP-2AL-2C having a nucleotide sequence as shown in SEQ ID NO.

4.

4. The primer set according to claim 3, characterized in that: The primers shown in SEQ ID NO. 2-3 are respectively connected with different fluorescent modification groups.

5. A method for identifying wheat resistance to stripe rust, characterized in that: The method comprises the following steps: using the genomic DNA of the wheat to be tested as a template, using the primer set described in claim 3 or 4 to perform fluorescent quantitative PCR amplification, and performing genotyping on the wheat to be tested according to the amplification result to determine whether the wheat to be tested has stripe rust resistance.

6. The method according to claim 5, characterized in that The determination criteria of the method are: if the base T corresponding to KASP-2AL-2F1 is detected, the wheat to be tested does not contain the YrZ41-2AL site; if the base C corresponding to KASP-2AL-2F2 is detected, the wheat to be tested contains the homozygous YrZ41-2AL site; if the base T corresponding to KASP-2AL-2F1 and the base C corresponding to KASP-2AL-2F2 are detected at the same time, it is judged that the wheat to be tested contains the heterozygous YrZ41-2AL site; wherein, the wheat to be tested containing the YrZ41-2AL site is resistant to stripe rust.

7. Use of the molecular marker according to claim 1 to 2 or the primer set according to claim 3 to 4, characterized in that: The application is any of the following: (1) Screening or identification of wheat stripe rust resistance; (2) Improvement of wheat germplasm resources; (3) Development of wheat stripe rust resistant materials; (4) Wheat molecular marker-assisted breeding.

Images