Molecular marker for detecting pileus color of selfing population of flammulina velutipes and application of molecular marker

Abstract

The invention relates to the technical field of edible mushrooms, in particular to a molecular marker for detecting the pileus color of a selfing population of flammulina velutipes and application of the molecular marker. The molecular marker for detecting the pileus color of the needle mushroom selfing population can rapidly and accurately identify the pileus color of the brown needle mushroom selfing population, has the advantages of being accurate, efficient, good in typing effect and the like, can accelerate screening of target varieties, is used for assisting breeding of needle mushroom varieties, provides technical support for needle mushroom breeding work, and has wide application prospects. A theoretical basis is laid.

Description

Technical Field

[0001] The invention relates to the technical field of edible fungi, and in particular to a molecular marker for detecting the color of the cap of a self-fertilized population of Flammulina velutipes and an application thereof. Background Art

[0002] Flammulina velutipes Flammulina filiformis ) is one of the most common edible fungi. It has a unique taste and contains amino acids, vitamins, minerals, unsaturated fatty acids and other substances that are beneficial to the human body. It has medicinal properties such as enhancing immunity, anti-inflammation, anti-oxidation, and regulating intestinal flora, and is deeply loved by consumers. At present, the Flammulina velutipes sold on the market are mainly white, and yellow and brown Flammulina velutipes are less. Compared with white Flammulina velutipes, yellow Flammulina velutipes has a strong taste, tender meat, and a crisp taste, and is gradually regaining market share. However, the yellow Flammulina velutipes is prone to browning after harvesting, which is one of the main factors restricting its expansion of the market. Therefore, it is urgent to breed Flammulina velutipes varieties with delicious meat and not easy to brown. The development of a molecular marker technology that can quickly and accurately identify the color of the cap can accelerate breeding progress and provide technical support and theoretical basis for the selection of Flammulina velutipes varieties.

[0003] Single Nucleotide Polymorphism (SNP) is a type of DNA polymorphism caused by changes in a single nucleotide in the DNA sequence in the genome. It can be observed as differences between DNA sequences from different individuals, or differences between alleles from a single individual in diploid or polyploid organisms. SNP molecular markers have the advantages of wide distribution, high polymorphism, and high genetic stability. They are widely used in genetic diversity analysis of germplasm resources, marking and positioning of target trait genes, purity identification of crop varieties, and quality identification. Competitive allele specific PCR (KASP) is a new SNP-based genotyping technology that can accurately type SNPs and insertion-deletion polymorphisms (Indels) at the genomic level. This technology performs genotyping at specific sites through allele-specific oligo extension and fluorescence resonance, and has the advantages of low cost and high throughput.

[0004] At present, there are few studies on KASP-SNP molecular markers for the cap color of Flammulina velutipes. There is an urgent need for a rapid detection technology for the selection and breeding of Flammulina velutipes varieties to improve the accuracy of cap color identification of brown Flammulina velutipes self-pollinated populations, shorten the breeding cycle, and improve breeding efficiency. Summary of the invention

[0005] In view of this, the present invention provides a molecular marker for detecting the color of the cap of a self-pollinated population of Flammulina velutipes and its application, so as to solve the defects of the prior art.

[0006] The invention provides a KASP molecular marker for detecting the cap color of a self-pollinated population of Flammulina velutipes. The SNP site of the KASP molecular marker is located at 0.17 Mb at the end of chromosome 11 of the Flammulina velutipes cha01 reference genome PRJNA820294; and the polymorphism of the SNP of the molecular marker is A / G and / or C / T.

[0007] The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO: 1; Preferably, the SNP site of the molecular marker includes the 203rd bp or the 404th bp of the nucleotide sequence.

[0008] The brown color of the self-fertilized population of Flammulina velutipes is relatively dominant to the yellow color; The genotype of the Flammulina velutipes strain is Aa or AA, and the strain has a brown cap; The genotype of the Flammulina velutipes strain is aa, and the strain has a yellow cap.

[0009] The present invention also provides a primer set for detecting the color of the cap of a self-fertilized population of Flammulina velutipes, comprising the above-mentioned KASP molecular marker.

[0010] The primer set includes a forward primer F1, a forward primer F2 and a reverse primer R; the KASP molecular marker includes a KASP1 molecular marker or a KASP2 molecular marker; The primer set satisfies at least one of (1)-(2): (1) The nucleotide sequence of the primer set corresponding to the KASP1 molecular marker is as follows: Forward Primer F1: GAAGGTGACCAAGTTCATGCTCCGCACATGGTAAGCGTCA; Forward Primer F2: GAAGGTCGGAGTCAACGGATTCCGCACATGGTAAGCGTCG; Reverse Primer R: GCCTTCTCTCCAAATGACACCTAA; (2) The nucleotide sequence of the primer set corresponding to the KASP2 molecular marker is as follows: Forward Primer F1: GAAGGTGACCAAGTTCATGCTCGTCAGTTCGAGAAGAATAACATCG; Forward Primer F2: GAAGGTCGGAGTCAACGGATTCGTCAGTTCGAGAAGAATAACATCA; Reverse Primer R: CTTGGTGATTAATTGGGGGCTTTG.

[0011] The invention provides a kit for detecting the color of the cap of a self-fertilized population of Flammulina velutipes, comprising the KASP molecular marker or the primer set.

[0012] The kit also includes a PCR amplification reaction system; the PCR amplification reaction system: Template DNA, total amount 100 ng, 2 μL; Forward primer F1, (10 μM) 0.1 μL Forward primer F2, (10 μM) 0.1 μL Reverse primer R, (10 μM) 0.3 μL FLu-Arms 2× PCR Mix, 5 μL Water, 4.5 μL.

[0013] The present invention provides a method for detecting the color of the cap of a self-fertilized population of Flammulina velutipes, using the above-mentioned molecular marker, the above-mentioned primer set or the above-mentioned kit, comprising the following steps: (1) Extraction of Flammulina velutipes genomic DNA; (2) using the Flammulina velutipes genomic DNA as a template, and performing a PCR amplification reaction using the molecular marker described in any one of claims 1 to 3, the primer set described in any one of claims 4 to 5, or the kit described in any one of claims 6 to 7; (3) The PCR amplification products are detected to detect the brown cap and yellow cap of Flammulina velutipes.

[0014] The procedure of the PCR amplification reaction was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing at 61°C for 60 s, decreasing the temperature by 0.6°C in each cycle, for 10 cycles; denaturation at 95°C for 15 s, annealing at 55°C for 60 s, for 30 cycles; and plate reading at 30°C for 30 s.

[0015] Compared with the prior art, the technical solution of the present invention has the following advantages: 1. The molecular marker for detecting the color of the self-pollinated population of Flammulina velutipes provided by the present invention can quickly and accurately identify the color of the cap of the self-pollinated population of Flammulina velutipes, has the advantages of accuracy, high efficiency, and good typing effect, can accelerate the screening of target varieties, and is used to assist in the breeding of Flammulina velutipes varieties, provide technical support for the breeding of Flammulina velutipes, and lay a theoretical foundation. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0017] Figure 1 This is Example 1 of the present invention, using the KASP1 primer set to perform KASP genotyping on the cap color of the brown Flammulina velutipes self-fertilization population; Figure 2 This is Example 2 of the present invention, using the KASP2 primer set to perform KASP genotyping on the cap color of the brown Flammulina velutipes self-pollinated population. DETAILED DESCRIPTION

[0018] The following examples are provided for a better understanding of the present invention, but are not intended to limit the best mode of implementation, nor to limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts shall fall within the protection scope of the present invention.

[0019] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be obtained commercially.

[0020] It is difficult to quickly identify the color of the cap of Flammulina velutipes in the prior art, and for this purpose, the present invention provides the following technical solution.

[0021] In a first aspect, the present invention provides a KASP molecular marker for detecting the cap color of a self-pollinated population of Flammulina velutipes, wherein the SNP site of the KASP molecular marker is located at 0.17 Mb at the end of chromosome 11 of the Flammulina velutipes cha01 reference genome PRJNA820294.

[0022] Optionally, the nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO: 1; Preferably, the polymorphism of the SNP of the molecular marker is A / G and / or C / T.

[0023] The SNP site of the molecular marker includes the 203rd bp or the 404th bp of the nucleotide sequence.

[0024] The SNP site includes SNP1 or SNP2.

[0025] It should be noted that the definition of r in the sequence listing is: A / G, [A / G] is the SNP1 site, corresponding to the KASP1 molecular marker; the definition of y is: C / T, [C / T] is the SNP2 site, corresponding to the KASP2 molecular marker.

[0026] The brown color of the self-fertilized population of Flammulina velutipes is relatively dominant to the yellow color, which are marked as A and a respectively; The genotype of the Flammulina velutipes strain is Aa or AA, and the strain has a brown cap; The genotype of the Flammulina velutipes strain is aa, and the strain has a yellow cap.

[0027] In a second aspect, the present invention provides a primer set for detecting the color of the cap of a self-pollinated population of Flammulina velutipes, comprising the above-mentioned KASP molecular marker.

[0028] Optionally, the primer set includes a forward primer F1, a forward primer F2 and a reverse primer R; The KASP molecular marker includes the KASP1 molecular marker or the KASP2 molecular marker; Optionally, the primer set satisfies at least one of (1)-(2): (1) The nucleotide sequence of the primer set corresponding to the KASP1 molecular marker is as follows: Forward Primer F1: GAAGGTGACCAAGTTCATGCTCCGCACATGGTAAGCGTCA; Forward Primer F2: GAAGGTCGGAGTCAACGGATTCCGCACATGGTAAGCGTCG; Reverse Primer R: GCCTTCTCTCCAAATGACACCTAA; (2) The nucleotide sequence of the primer set corresponding to the KASP2 molecular marker is as follows: Forward Primer F1: GAAGGTGACCAAGTTCATGCTCGTCAGTTCGAGAAGAATAACATCG; Forward Primer F2: GAAGGTCGGAGTCAACGGATTCGTCAGTTCGAGAAGAATAACATCA; Reverse Primer R: CTTGGTGATTAATTGGGGGCTTTG.

[0029] The above primers are respectively for:KASP1-F1, KASP1-F2, KASP1-R; KASP2-F1, KASP2-F2, KASP2-R.

[0030] In a third aspect, the present invention provides a kit for detecting the color of the cap of a self-pollinated population of Flammulina velutipes, comprising the above-mentioned KASP molecular marker or the above-mentioned primer set.

[0031] Optionally, a PCR amplification reaction system is also included; Specifically, the PCR amplification reaction system: 2 μL of 100 ng DNA, 0.1 μL of forward primer F1 (10 μM), 0.1 μL of forward primer F2 (10 μM), 0.3 μL of reverse primer R (10 μM), 5 μL of FLu-Arms 2×PCR Mix, and 4.5 μL of ddH2O.

[0032] In a fourth aspect, the present invention provides a method for detecting the color of the cap of a self-fertilized population of Flammulina velutipes, using the above-mentioned molecular marker, the above-mentioned primer set or the above-mentioned kit, comprising the following steps: (1) Extraction of Flammulina velutipes genomic DNA; (2) using the Flammulina velutipes genomic DNA as a template, and performing a PCR amplification reaction using the above-mentioned molecular marker, the above-mentioned primer set or the above-mentioned kit; (3) The PCR amplification products are detected to detect the brown cap and yellow cap of Flammulina velutipes.

[0033] The procedure of the PCR amplification reaction was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing at 61°C for 60 s, decreasing the temperature by 0.6°C in each cycle, for 10 cycles; denaturation at 95°C for 15 s, annealing at 55°C for 60 s, for 30 cycles; and plate reading at 30°C for 30 s.

[0034] The present invention is further described in detail below in conjunction with specific embodiments. These embodiments should not be construed as limiting the scope of protection claimed by the present invention. Example

[0035] The present embodiment provides a KASP1 molecular marker for detecting the color of the self-pollinated cap of Flammulina velutipes. The SNP site of the main control gene of the cap color of the brown Flammulina velutipes self-pollinated population is screened to obtain the SNP1 site. The SNP1 site is located at 0.17 Mb at the end of chromosome 11 of the Flammulina velutipes cha01 reference genome PRJNA820294. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1. The SNP1 site is located at the 203 bp of the nucleotide sequence, and the polymorphism is A / G.

[0036] This embodiment also provides a primer set, including the above-mentioned KASP1 molecular marker, and the corresponding primer set includes a forward primer KASP1-F1, a forward primer KASP1-F2, and a reverse primer KASP1-R.

[0037] The SNP1 locus information and primer set nucleotide sequence of the molecular marker are shown in Table 1.

[0038] Table 1 SNP1 locus information and primer set nucleotide sequence

[0039] This embodiment provides a kit for detecting the color of the cap of a self-fertilized population of Flammulina velutipes, comprising the above primer set and a constructed PCR amplification reaction system: 2 μL of 100 ng DNA, Forward primer F1 (10 μM) 0.1 μL, Forward primer F2 (10 μM) 0.1 μL, Reverse primer R (10 μM) 0.3 μL, FLu-Arms 2× PCR Mix 5 μL, 4.5 μL ddHO.

[0040] This embodiment also provides a method for detecting the color of the cap of a self-fertilized population of Flammulina velutipes, comprising the following steps: S1, collecting brown Flammulina velutipes spores, performing multi-spore self-pollination or single hybridization to obtain a self-pollination population; S2, extracting genomic DNA from the brown Flammulina velutipes self-pollinated population to obtain genomic DNA of each Flammulina velutipes to be tested; S3, using the genomic DNA to be detected obtained in S1 as a template, using molecular markers to perform PCR amplification on the genomic DNA to be detected to obtain an amplified product, using the above-mentioned PCR amplification reaction system; using Quantstudio 5 real-time fluorescence quantitative PCR instrument for PCR amplification, the reaction program is: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 61℃ annealing for 60 s, reducing 0.6℃ for each cycle, for 10 cycles; 95℃ denaturation for 15 s, 55℃ annealing for 60 s, for 30 cycles; 30℃ plate reading for 30 s; S4. After the program is completed, QuantStudio™ Design & Analysis Software v1.5.3 software is used for genotyping analysis; S5. Compare the KASP genotyping results obtained in step S3 with the fruiting experiment phenotypes. Figure 1, thereby identifying the inheritance of brown and yellow caps in the self-pollinated population of brown Flammulina velutipes.

[0041] The experiment was conducted using a brown Flammulina velutipes (parent) and its offspring self-pollination population, a total of 13 Flammulina velutipes strains, of which 3 offspring strains had yellow caps and 10 strains had brown caps. Figure 1 As shown, the schematic diagram of the genotyping of the selfing population according to the KASP primer set of the SNP site, red represents the yellow cap, blue represents the brown cap, black represents the negative control, and the typing results are consistent with the color of the Flammulina velutipes cap. The results show that the KASP molecular marker using the KASP1 primer set can be used to quickly and accurately identify the cap color of the brown Flammulina velutipes selfing population. Example

[0042] The present embodiment provides a KASP2 molecular marker for detecting the color of the self-pollinated cap of Flammulina velutipes. The SNP site of the main control gene of the cap color of the brown Flammulina velutipes self-pollinated population is screened to obtain the SNP2 site. The SNP2 site is located at 0.17 Mb at the end of chromosome 11 of the Flammulina velutipes cha01 reference genome PRJNA820294. The nucleotide sequence of the molecular marker is shown in SEQ ID NO: 1, and the SNP site is located at the 404 bp of the nucleotide sequence, C / T.

[0043] This embodiment further provides a primer set, including the above-mentioned KASP2 molecular marker, and the corresponding primer set includes a forward primer KASP2-F1, a forward primer KASP2-F2, and a reverse primer KASP2-R.

[0044] The SNP2 locus information and primer set nucleotide sequence of the molecular marker are shown in Table 2.

[0045] Table 2 SNP2 locus information and primer set nucleotide sequence This embodiment provides a kit for detecting the color of the cap of a self-fertilized population of Flammulina velutipes, comprising the above primer set and a constructed PCR amplification reaction system: 2 μL of 100 ng DNA, Forward primer F1 (10 μM) 0.1 μL, Forward primer F2 (10 μM) 0.1 μL, Reverse primer R (10 μM) 0.3 μL, FLu-Arms 2× PCR Mix 5 μL, 4.5 μL ddHO.

[0046] This embodiment also provides a method for detecting the color of the cap of a self-fertilized population of Flammulina velutipes, comprising the following steps: S1, collecting brown Flammulina velutipes spores, performing multi-spore self-pollination or single hybridization to obtain a self-pollination population; S2, extracting genomic DNA from the brown Flammulina velutipes self-pollinated population to obtain genomic DNA of each Flammulina velutipes to be tested; S3, using the genomic DNA to be detected obtained in S1 as a template, using molecular markers to perform PCR amplification on the genomic DNA to be detected to obtain an amplified product, using the above-mentioned PCR amplification reaction system; using Quantstudio 5 real-time fluorescence quantitative PCR instrument for PCR amplification, the reaction program is: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 15 s, 61℃ annealing for 60 s, reducing 0.6℃ for each cycle, for 10 cycles; 95℃ denaturation for 15 s, 55℃ annealing for 60 s, for 30 cycles; 30℃ plate reading for 30 s; S4. After the program is completed, QuantStudio™ Design & Analysis Software v1.5.3 software is used for genotyping analysis; S5. Compare the KASP genotyping results obtained in step S3 with the fruiting experiment phenotypes. Figure 2 , thereby identifying the inheritance of brown and yellow caps in the self-pollinated population of brown Flammulina velutipes.

[0047] The experiment was conducted using a brown Flammulina velutipes (parent) and its offspring self-pollination population, a total of 13 Flammulina velutipes strains, of which 3 offspring strains had yellow caps and 10 strains had brown caps. Figure 2 As shown, the schematic diagram of the genotyping of the selfing population according to the KASP primer set of the SNP site, red represents the yellow cap, blue represents the brown cap, black represents the negative control, and the typing results are consistent with the color of the Flammulina velutipes cap. The results show that the KASP molecular marker using the KASP2 primer set can be used to quickly and accurately identify the cap color of the brown Flammulina velutipes selfing population.

Claims

1. A KASP molecular marker for detecting the color of the cap of a self-fertilized population of Flammulina velutipes, characterized in that: The SNP site of the KASP molecular marker is located at 0.17 Mb at the end of chromosome 11 of the Flammulina enoki cha01 reference genome PRJNA820294.

2. The KASP molecular marker according to claim 1, characterized in that The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO: 1; Preferably, the SNP site of the molecular marker includes the 203rd bp or the 404th bp of the nucleotide sequence; Preferably, the polymorphism of the SNP of the molecular marker is A / G and / or C / T.

3. The KASP molecular marker according to claim 1, characterized in that The brown color of the self-fertilized population of Flammulina velutipes is relatively dominant to the yellow color; The genotype of the Flammulina velutipes strain is Aa or AA, and the strain has a brown cap; The genotype of the Flammulina velutipes strain is aa, and the strain has a yellow cap.

4. A primer set for detecting the color of the cap of a self-fertilized population of Flammulina velutipes, characterized in that: The method comprises the KASP molecular marker according to any one of claims 1 to 3.

5. The primer set according to claim 4, characterized in that: The primer set includes a forward primer F1, a forward primer F2 and a reverse primer R; the KASP molecular marker includes a KASP1 molecular marker or a KASP2 molecular marker; The primer set satisfies at least one of (1)-(2): (1) The nucleotide sequence of the primer set corresponding to the KASP1 molecular marker is as follows: Forward Primer F1: GAAGGTGACCAAGTTCATGCTCCGCACATGGTAAGCGTCA; Forward Primer F2: GAAGGTCGGAGTCAACGGATTCCGCACATGGTAAGCGTCG; Reverse Primer R: GCCTTCTCTCCAAATGACACCTAA; (2) The nucleotide sequence of the primer set corresponding to the KASP2 molecular marker is as follows: Forward Primer F1: GAAGGTGACCAAGTTCATGCTCGTCAGTTCGAGAAGAATAACATCG; Forward Primer F2: GAAGGTCGGAGTCAACGGATTCGTCAGTTCGAGAAGAATAACATCA; Reverse Primer R: CTTGGTGATTAATTGGGGGCTTTG.

6. A kit for detecting the color of the cap of a self-fertilized population of Flammulina velutipes, characterized in that: The method comprises the KASP molecular marker according to any one of claims 1 to 3 or the primer set according to any one of claims 4 to 5.

7. The kit according to claim 6, characterized in that It also includes a PCR amplification reaction system; the PCR amplification reaction system: Template DNA, total amount 100 ng, 2 μL; Forward primer F1, (10 μM) 0.1 μL Forward primer F2, (10 μM) 0.1 μL Reverse primer R, (10 μM) 0.3 μL FLu-Arms 2× PCR Mix, 5 μL Water, 4.5 μL.

8. A method for detecting the color of the cap of a self-fertilized population of Flammulina velutipes, characterized in that: Using the molecular marker according to any one of claims 1 to 3, the primer set according to any one of claims 4 to 5, or the kit according to any one of claims 6 to 7, comprising the following steps: (1) Extraction of Flammulina velutipes genomic DNA; (2) using the Flammulina velutipes genomic DNA as a template, and performing a PCR amplification reaction using the molecular marker described in any one of claims 1 to 3, the primer set described in any one of claims 4 to 5, or the kit described in any one of claims 6 to 7; (3) The PCR amplification products are detected to detect the brown cap and yellow cap of Flammulina velutipes.

9. The method according to claim 8, characterized in that The procedure of the PCR amplification reaction was as follows: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing at 61°C for 60 s, decreasing the temperature by 0.6°C in each cycle, for 10 cycles; denaturation at 95°C for 15 s, annealing at 55°C for 60 s, for 30 cycles; and plate reading at 30°C for 30 s.

Images