PCR detection primer, probe and detection kit for identifying PRRSV (Porcine Reproductive and Respiratory Syndrome Virus)

Abstract

The invention discloses a PCR (polymerase chain reaction) detection primer, a probe and a detection kit for identifying PRRSV (porcine reproductive and respiratory syndrome virus). According to the method, specific primers and probes are designed and screened for a PRRSV conserved gene ORF6, the primers are composed of two nucleotide sequences as shown in SEQ ID No.1-2, and the sequence of the probes is as shown in SEQ ID No.3; the invention further discloses a TaqMan fluorescent quantitative PCR detection kit for identifying the porcine reproductive and respiratory syndrome virus. The TaqMan fluorescent quantitative PCR detection kit comprises a specific primer, a TaqMan probe and a positive control. The specific primer and the probe provided by the invention can be used for rapidly and accurately identifying the PRRSV, have good sensitivity and specificity, effectively overcome the defect that the existing detection method is insufficient in detection coverage on a new variant or a recombinant strain of the PRRSV, and reduce the possibility of false negative leak detection.

Description

Technical Field

[0001] The present invention relates to a primer pair and a probe for PCR for identifying porcine reproductive and respiratory syndrome virus (PRRSV), and also relates to a PCR detection kit capable of identifying porcine reproductive and respiratory syndrome virus strains or recombinant porcine reproductive and respiratory syndrome virus strains, belonging to the field of porcine reproductive and respiratory syndrome virus detection. Background Art

[0002] Porcine reproductive and respiratory syndrome virus belongs to the genus Arterivirus of the family Arteriviridae of the order Nidovirales. It is a single-stranded positive-strand RNA virus with an envelope. The total length of PRRSV is about 15kb, containing 10 open reading frames. The protein encoded by the conserved gene ORF6 is the M protein (membrane protein, M protein), which is a glycosylated membrane protein and one of the conserved structural proteins in PRRSV. It is about 18-19kDa in length. The M protein of type I PRRSV and type II PRRSV consists of 173 and 174 amino acid residues, respectively, including a short N-terminal external domain consisting of 16 amino acid residues, three transmembrane domains and a C-terminal internal domain consisting of 84 amino acid residues.

[0003] PRRSV wild strains and recombinant strains have long been prevalent in China, seriously affecting the economic benefits of farms. Therefore, rapid, efficient, accurate and sensitive detection methods are urgently needed for the prevention and control of PRRSV. Summary of the invention

[0004] One of the purposes of the present invention is to provide a detection primer pair and a probe for identifying porcine reproductive and respiratory syndrome virus strains or recombinant porcine reproductive and respiratory syndrome virus strains;

[0005] The second object of the present invention is to provide a PCR detection kit for identifying porcine reproductive and respiratory syndrome virus strains or recombinant porcine reproductive and respiratory syndrome virus strains.

[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is:

[0007] One aspect of the present invention is to provide a detection primer pair and a probe for identifying a porcine reproductive and respiratory syndrome virus strain or a recombinant porcine reproductive and respiratory syndrome virus strain, wherein the detection primer pair is selected from any one of the following primer pairs (1) to (5):

[0008] (1) a primer pair 1 consisting of two nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 2;

[0009] (2) a primer pair 2 consisting of two nucleotide sequences shown in SEQ ID No. 4 and SEQ ID No. 5;

[0010] (3) Primer pair 3 consisting of two nucleotide sequences shown in SEQ ID No. 7 and SEQ ID No. 8;

[0011] (4) Primer pair 4 consisting of two nucleotide sequences shown in SEQ ID No. 10 and SEQ ID No. 11;

[0012] (5) Primer pair 5 consisting of two nucleotide sequences shown in SEQ ID No. 13 and SEQ ID No. 14;

[0013] The nucleotide sequence of the probe is selected from any one of the nucleotide sequences shown in SEQ ID No.3, SEQ ID No.6, SEQ ID No.9, SEQ ID No.12 or SEQ ID No.15.

[0014] In a preferred specific embodiment of the present invention, the 5′ end of the probe is labeled with a fluorescent reporter group, more preferably, the fluorescent reporter group is a FAM fluorescent reporter group; the 3′ end of the probe is labeled with a fluorescent quencher group; wherein the 3′ end of the probe shown in SEQ ID No.3, SEQ ID No.6, SEQ ID No.12 or SEQ ID No.15 is labeled with a TAMRA fluorescent quencher group, and the 3′ end of the probe shown in SEQ ID No.9 is labeled with a BHQ1 fluorescent quencher group.

[0015] The present invention optimizes different combinations of the above-mentioned primers and probes, and the results show that the combination of primer pair 1 consisting of the two nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.2 and the probe of the nucleotide sequence shown in SEQ ID No.3 has the lowest CT value, the strongest specificity and the highest sensitivity in identifying porcine reproductive and respiratory syndrome virus.

[0016] Another aspect of the present invention is to provide a PCR detection kit for identifying porcine reproductive and respiratory syndrome virus strains or recombinant porcine reproductive and respiratory syndrome virus strains, comprising: a detection primer pair, a probe, Premix Ex Taq and double distilled water; wherein the primer pair is preferably a primer pair 1 composed of two nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.2; and the probe is preferably a nucleotide sequence shown in SEQ ID No.3.

[0017] The present invention further provides a detection method for identifying porcine reproductive and respiratory syndrome virus strains or recombinant porcine reproductive and respiratory syndrome virus strains using the PCR detection kit for identifying porcine reproductive and respiratory syndrome virus strains or recombinant porcine reproductive and respiratory syndrome virus strains, comprising: extracting DNA of the sample to be detected; using the DNA of the sample to be detected as a template, and using primers and probes as PCR primers to establish a PCR reaction system for PCR amplification; analyzing the amplified product; if a 308bp band appears in the amplified product, it indicates that the sample to be detected contains porcine reproductive and respiratory syndrome virus; wherein the primers are primer pair 1 composed of two nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.2; and the probe is the nucleotide sequence shown in SEQ ID No.3.

[0018] Among them, the PCR reaction system for identifying porcine reproductive and respiratory syndrome virus strains or recombinant porcine reproductive and respiratory syndrome virus strains includes: 0.4 μL of upstream and downstream primers each, 0.8 μL of probe, 10 μL of Premix Ex Taq, 2 μL of template, and 6.4 μL of enzyme-free sterile water; the nucleotide sequences of the upstream and downstream primers are the nucleotide sequences shown in SEQ ID No.1 and SEQ ID No.2, respectively; the probe is the nucleotide sequence shown in SEQ ID No.3.

[0019] The PCR amplification conditions for identifying porcine reproductive and respiratory syndrome virus strains or recombinant porcine reproductive and respiratory syndrome virus strains include: 95°C for 3 minutes, 98°C for 15 seconds, 55°C for 15 seconds, 70°C for 1 minute, 72°C for 5 minutes, and 4°C for 10 minutes.

[0020] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0021] The present invention designs primers and detection probes based on the conserved regions of the genes of the American and European porcine reproductive and syndrome virus strains that have been reported and the latest reported. The detection primers and probes cover a wider range of strain sources, types and scopes, and can effectively solve the problem that the existing PRRSV test kit has insufficient coverage for the detection of new variants or recombinant strains of PRRSV, thereby reducing the possibility of false negative missed detections.

[0022] The positive detection rate of PRRSV in the detection reagent of the present invention is 7%, but the positive detection rate of PRRSV in the competing reagent is 4%. The method of the present invention is faster in detecting real samples, and the positive detection rate of real samples is higher. The kit of the present invention has a higher positive detection rate than the traditional detection kit, and has a significant advantage. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1The results of electrophoresis of primer and probe combination screening by common PCR method; 1 is primer and probe combination 1; 2 is primer and probe combination 3; 3 is primer and probe combination 4; 4 is primer and probe combination 2; 5 is primer and probe combination 5; 6 is negative control;

[0024] Figure 2 Amplification curves for screening the sensitivity and amplification efficiency of dye-based primers; 1 is primer and probe combination 1; 2 is primer and probe combination 3; 3 is primer and probe combination 4; 4 is primer and probe combination 2; 5 is primer and probe combination 5; 6 is a negative control;

[0025] Figure 3 This is a melting curve for primer dimer screening by the dye method; wherein 1 is primer and probe combination 1; 2 is primer and probe combination 2; 3 is primer and probe combination 3; 4 is primer and probe combination 4; 5 is primer and probe combination 5;

[0026] Figure 4 The bar graph shows the positive detection rate of different primer and probe combinations for five major domestic strains: CH-1R, VR2332, JXA1-R, HuN4-F112, and GD-r180;

[0027] Figure 5 The Ct value diagram of the combination of primers and probes 1 against five major strains currently prevalent in China;

[0028] Figure 6 To obtain the porcine reproductive and respiratory syndrome virus q PCR standard curve using primer and probe combination 1;

[0029] Figure 7 It is the amplification curve of the real-time fluorescence quantitative PCR specific test;

[0030] Figure 8 is the amplification curve of the real-time fluorescence quantitative PCR sensitivity test; 1-9 are the standard plasmid concentrations at 2×10 9 ~2×10 1 The amplification results of copies / μL were calculated and the concentration was diluted 10 times. DETAILED DESCRIPTION

[0031] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, it should be understood that the embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. It should be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or replaced without departing from the spirit and scope of the present invention, but these modifications or replacements all fall within the protection scope of the present invention.

[0032] Experimental Example 1 Screening of detection primer pairs and probes for identifying porcine reproductive and respiratory syndrome virus strains or recombinant porcine reproductive and respiratory syndrome virus strains

[0033] 1 Test method

[0034] According to the gene sequence of PRRSV registered on Gen Bank, after comparison and analysis, Oligo6.0 software was used to design 5 sets of probe and primer combinations based on its conserved gene ORF6. Demonstration of the operation of using Primer Premier 5.0 software for screening: call in the designed primer and probe sequence combination, analyze one by one according to the result display; check the secondary structure of the primer pair, and screen in turn. In this scheme, 5 sets of probe primer combinations are designed for screening, and any one of the following five pairs of combinations is determined:

[0035] Primer and probe combination 1:

[0036] Upstream primer: F1: 5'-CGCRGGCTTTCATCCGAT-3' (SEQ ID NO.1)

[0037] Downstream primer: R1: 5'-TGCCACCCAACACGAGGC-3' (SEQ ID NO.2)

[0038] Probe: P1: 5'-FAM-ACCACGCATTTGTCGTC-TAMRA-3' (SEQ ID NO. 3)

[0039] Primer and probe combination 2:

[0040] Upstream primer: F2: 5'-CGCTGTCTCGCATTAGTAGTT-3' (SEQ ID NO. 4) Downstream primer: R2: 5'-CGCAGGTTGTGTAGCAT-3' (SEQ ID NO. 5)

[0041] Probe:

[0042] P2: 5'-FAM-AGCATCTAGCCGCCATTGAAGCCGAGA-TAMRA-3' (SEQ ID NO.6)

[0043] Primer and probe combination 3:

[0044] Upstream primer: F3: 5'-GGTGTGTATTCAGCC-3' (SEQ ID NO.7)

[0045] Downstream primer: R3: 5'-ATGCGTGGTTATCAC-3' (SEQ ID NO.8)

[0046] Probe: P3: 5'-FAM-CCTCCAGATGCCGTTTG-BHQ1 3' (SEQ ID NO. 9)

[0047] Primer and probe combination 4:

[0048] Upstream primer:

[0049] F4: 5'-CAAGCTGGCTAGCATGGGGTCGTCTCTAGACGACT-3' (SEQ ID NO.10)

[0050] Downstream primer:

[0051] R4: 5'-CCTTGTAATCCTCGAGTTTGGCATATTTAACAAG-3' (SEQ ID NO.11)

[0052] Probe: P4: 5'-FAM-TCGTCTCTAGACGACTTC-TAMRA-3' (SEQ ID NO. 12)

[0053] Primer and probe combination 5:

[0054] Upstream primer: F5: 5'-CCAAGGGYAAACTCT-3' (SEQ ID NO.13)

[0055] Downstream primer: R5: 5'-CCYTCGACCTCAATYTT-3' (SEQ ID NO.14)

[0056] Probe: P5: 5'-FAM-CTYCTGTCATCATAGAG-TAMRA-3' (SEQ ID NO. 15)

[0057] Note: The base R in the primer and probe combination represents purine, i.e. A or G; the base Y represents pyrimidine, i.e. C or T.

[0058] The SYBR Green dye method was used to screen the superior primer and probe combinations. The designed primer and probe combinations were screened for the second time using the SYBR Green dye method and PRRSV-positive plasmid as template. The Ct values ​​and melting curves were analyzed to evaluate the primer applicability and primer dimer situation.

[0059] The combination of 5 sets of primers and probes designed according to the PRRSV virus is used to detect new variants or recombinant strains of PRRSV. The fluorescence quantitative PCR detection method established by the present invention is used to perform fluorescence quantitative PCR detection and repeatability experiments on five major domestic strains currently prevalent, CH-1R, VR2332, JXA1-R, HuN4-F112, and GD-r180. The positive detection rate calculation formula is: positive detection rate = number of positive samples / total number of samples × 100%.

[0060] 2 Test results

[0061] The results of the primer pair and probe selection test are as follows Figure 1 As shown, primer and probe combination 1 can better detect porcine reproductive and respiratory syndrome virus, without nonspecific band amplification, strong PCR specificity and highest sensitivity.

[0062] Amplification curve and dimer test results are shown in Figure 2 and Figure 3 As shown, primer and probe combination 1 is a typical "S"-shaped amplification curve, and no primer dimers and non-specific amplification are produced, the Ct value is smaller and the fluorescence value is higher.

[0063] The detection results of different primer and probe combinations for the main strains currently prevalent in China are as follows Figure 4 As shown, different primers and combinations are the horizontal axis, and the positive detection rate is the vertical axis to establish a bar graph. Among them, the positive detection rate of primer and probe combination 1 for the five major domestic strains CH-1R, VR2332, JXA1-R, HuN4-F112, and GD-r180 is 1 and p>0.05, and the positive detection rates of the other four groups are all less than 1.

[0064] The results of the Ct values ​​of the five sets of primers and probes for the five major strains currently prevalent in China, CH-1R, VR2332, JXA1-R, HuN4-F112, and GD-r180, are as follows. Except for primer and probe combination 1, the other four sets have no Ct value results. The Ct values ​​of primer and probe combination 1 for the five major strains currently prevalent in China, CH-1R, VR2332, JXA1-R, HuN4-F112, and GD-r180 are as follows. Figure 5As shown, the Ct values ​​of the five major domestic strains, CH-1R, VR2332, JXA1-R, HuN4-F112, and GD-r180, are all in the range of 10-15, indicating that the primer and probe combination 1 can detect the five major domestic strains, CH-1R, VR2332, JXA1-R, HuN4-F112, and GD-r180. It can be seen that the primer and probe combination 1 can specifically and accurately detect various new variants or recombinant strains of PRRSV, and the other four sets of primer and probe combinations have false negative detection results for at least one of the new variants or recombinant strains of PRRSV; therefore, the primer and probe combination 1 has the widest coverage and the strongest specificity for the detection of new variants or recombinant strains of PRRSV.

[0065] Therefore, the present invention uses the probes and primers in the primer and probe combination 1 for subsequent specificity, sensitivity and repeatability tests.

[0066] Experimental Example 2 Specificity, sensitivity and repeatability test of fluorescence quantitative PCR

[0067] 1 Test method

[0068] A positive control was designed based on the conservative fragment of the ORF6 gene sequence of the PRRSV virus, and a pair of primers was designed based on the positive control using software. The positive control was diluted 10 times in a gradient from 2×10 9 ~2×10 1 copies / μL to obtain a gradient concentration of positive control for amplification and preparation. The specific nucleotide sequence and primer sequence of the positive control are as follows:

[0069] Positive Control:

[0070] ATGGGGTCGTCTCTAGACGACTTCTGCAATGATAGCACAGCTCCAC

[0071] AGAAGGTGCTTTTGGCGTTTTCCATTACCTACACGCCAGTGATGATA

[0072] TATGCTCTAAAGGTAAGTCGCGGCCGACTGCTAGGGCTTCTGCACCT

[0073] TTTGATCTTTCTGAATTGTGCTTTTACCTTCGGGTACATGACATTCGT

[0074] GCACTTTGAGAGCACAAATAGGGTCGCGCTCACTATGGGAGCAGTA

[0075] GTTGCACTTCTTTGGGGAGTGTACTCAGCCATAGAAAACCTGGAAATT

[0076] CATCACCTCCAGATGCCGTTTGTGCTTGCTAGGCCGCAAGTACATTC

[0077] TGGCCCCTGCCCACCACGTCGAAAGTGCCGCGGGCTTTCATCCGATT

[0078] GCGGCAAATGATAACCACGCATTTGTCGTCCCGGCGTCCCGGCTCCA

[0079] CTACGGTCAACGGCACATTGGTGCCCGGGTTGAAAAGCCTCGTGTT

[0080] GGGTGGCAGAAAAGCTGTTAAGCAGGGAGTGGTAAACCTTGTTAAATATGCCAAATAA(SEQ IDNO.16)

[0081] Upstream primer: F6: 5'-AATTACGGCCGCATGGTTCTCG-3' (SEQ ID NO. 17) Downstream primer: R6: 5'-GTGGTGTTTGGCAATGTGTCAGG-3' (SEQ ID NO. 18)

[0082] PCV2, PPV, PEDV viruses and enzyme-free water were used as templates, and fluorescence quantitative PCR was performed simultaneously. The primers and probe combination 1 obtained by screening in Experimental Example 1 were used for fluorescence quantitative PCR detection. The repeatability experiment used 2×10 4 ~2×10 9 The positive control was used as a template to conduct repeatability experiments on different samples within and between groups. 1 copies / μL-2×10 8 The positive standard plasmid of 100 copies / μL was used as a template for detection, and the primer and probe combination 1 obtained by screening in Experimental Example 1 was used for fluorescence quantitative PCR detection.

[0083] 2 Test results

[0084] The results of the fluorescence quantitative PCR detection method established by the present invention are as follows: Figure 6The logarithm of the standard concentration is the horizontal axis, and the Ct value is the vertical axis to establish a fluorescence quantitative PCR standard curve. The results show that the matching primers are effective for the standard at 2×10 1 Up to 2×10 9 The relationship is linear within the range of 100 copies, and the regression equation is Y = -2.948*X + 36.07. The correlation coefficient is R 2 =0.9993.

[0085] Specificity test results such as Figure 7 As shown, only the PRRSV sample showed a specific amplification curve, while the other samples were negative.

[0086] The results of the repeatability test are shown in Tables 1 and 2, indicating that the intra-group coefficient of variation of the samples was between 0.28% and 1.8%, and the inter-group coefficient of variation was between 1.26% and 7.39%.

[0087] Table 1q PCR intra-group repeatability test results

[0088]

[0089] Table 2q PCR intergroup repeatability test results

[0090]

[0091] The results of sensitivity tests were as follows Figure 8 As shown in the fluorescence quantitative amplification curve, the sample concentration was greater than 2×10 1 It can be detected when the number of copies / μL is less than 1.

Claims

1. A detection primer pair and a probe for identifying porcine reproductive and respiratory syndrome virus strains or recombinant porcine reproductive and respiratory syndrome virus strains, characterized in that: The detection primer pair is selected from any one of the following primer pairs (1) to (5): (1) a primer pair 1 consisting of two nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 2; (2) Primer pair 2 consisting of two nucleotide sequences shown in SEQ ID No. 4 and SEQ ID No. 5; (3) Primer pair 3 consisting of two nucleotide sequences shown in SEQ ID No. 7 and SEQ ID No. 8; (4) Primer pair 4 consisting of two nucleotide sequences shown in SEQ ID No. 10 and SEQ ID No. 11; (5) Primer pair 5 consisting of two nucleotide sequences shown in SEQ ID No. 13 and SEQ ID No. 14; The probe comprises any one of the nucleotide sequences shown in SEQ ID No.3, SEQ ID No.6, SEQ ID No.9, SEQ ID No.12 or SEQ ID No.

15.

2. The test primer pair and probe according to claim 1, characterized in that: The primer pair is a primer pair 1 consisting of two nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 2; The nucleotide sequence of the probe is shown in SEQ ID No.

3.

3. The detection primer pair and probe according to claim 1, characterized in that: The 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end of the probe is labeled with a fluorescent quencher group.

4. The detection primer pair and probe according to claim 1, characterized in that: The fluorescent reporter group is a FAM fluorescent reporter group; the 3' end of the probe shown in SEQ ID No.3, SEQ ID No.6, SEQ ID No.12 or SEQ ID No.15 is labeled with a TAMRA fluorescent quenching group, and the 3' end of the probe shown in SEQ ID No.9 is labeled with a BHQ1 fluorescent quenching group.

5. Use of the detection primer pair and probe described in any one of claims 1 to 4 in the preparation of reagents or drugs for detecting or diagnosing porcine reproductive and respiratory syndrome virus strains or recombinant porcine reproductive and respiratory syndrome virus strains.

6. The use according to claim 5, characterized in that: The porcine reproductive and respiratory syndrome virus strain includes PRRSV NADC-30 strain or PRRSV NADC-34 strain; the recombinant porcine reproductive and respiratory syndrome virus strain includes: PRRSV NANDC-30 strain or PRRSV NADC-34 strain.

7. A PCR detection kit for identifying porcine reproductive and respiratory syndrome virus strains or recombinant porcine reproductive and respiratory syndrome virus strains, comprising: Detection primers and probes; characterized in that the detection primers and probes are the detection primers and probes described in any one of claims 1-4.

8. The PCR detection kit according to claim 7, characterized in that: The porcine reproductive and respiratory syndrome virus strain includes PRRSV NADC-30 strain or PRRSV NADC-34 strain; the recombinant porcine reproductive and respiratory syndrome virus strain includes: PRRSV NANDC-30 strain or PRRSV NADC-34 strain.

Images