Method for synthesizing ulcerative colitis relieving medicine cholesterol sulfate through enzymatic sulfonation

Abstract

The invention discloses a method for synthesizing ulcerative colitis relieving medicine cholesterol sulfate through enzymatic sulfonation, and belongs to the technical field of biology. Escherichia coli BL21 (DE3) is used as host bacteria, hydroxysteroid sulfotransferase 2B1 from B. thetaotaomicron is expressed and purified, then cholesterol sulfate is catalytically synthesized in vitro by using a substrate cholesterol, and green and efficient sulfonation modification of the cholesterol sulfate is realized, so that the hydroxysteroid sulfotransferase 2B1 is used for producing medicines for relieving ulcerative colitis.

Description

Technical Field

[0001] The invention relates to a method for synthesizing cholesterol sulfate, a drug for alleviating ulcerative colitis, by enzymatic sulfonation, and belongs to the field of biotechnology. Background Art

[0002] Ulcerative colitis (UC) is one of the most common forms of inflammatory bowel disease and is a chronic, relapsing-remitting inflammatory disease that affects the colon, causes disability, and requires lifelong treatment. Over the past few decades, the incidence of UC has been increasing worldwide. UC patients present with mucosal inflammation that begins in the rectum and extends to the proximal colon. Defects in the colonic epithelial barrier are closely associated with the pathogenesis of UC. Therefore, the goal of treating UC is to induce and maintain remission, including relief of clinical symptoms and endoscopic mucosal healing. Currently, the main treatment options for UC are 5-aminosalicylic acid drugs, steroids, immunosuppressants, and biologic drugs.

[0003] Cholesterol sulfate (CS) is an important steroid sulfate in the human body. It is synthesized by cytoplasmic sulfotransferase (SULT) 2B1 and plays a variety of important physiological roles. It is widely distributed in the human body, such as the skin, adrenal glands, liver, lungs, brain, and endometrium. CS participates in the formation of the cornified mantle of the stratum corneum and the expression of keratinocyte differentiation markers in the epidermis, thereby regulating epidermal desquamation and barrier function; in addition, CS also participates in the occurrence and development of various diseases by regulating the activity of functional proteins. Dietary supplementation of cholesterol sulfate can improve acute and chronic ulcerative colitis.

[0004] Enzymatic synthesis of cholesterol sulfate uses cholesterol and sulfate as substrates, and cholesterol sulfate is synthesized by steroid sulfotransferase 2B1.

[0005] Currently, the synthesis method of cholesterol sulfate is mostly chemical synthesis, which has a complicated production process and many by-products, resulting in the lack of application of cholesterol sulfate drugs. Summary of the invention

[0006] The invention provides a recombinant bacterium for expressing hydroxysteroid sulfotransferase 2B1. The recombinant bacterium uses Escherichia coli BL21 (DE3) as a host and expresses hydroxysteroid sulfotransferase 2B1 derived from B. thetaiotaomicron.

[0007] In one embodiment, the amino acid sequence of the hydroxysteroid sulfotransferase 2B1 is shown in SEQ ID NO.2.

[0008] In one embodiment, the nucleotide sequence of the hydroxysteroid sulfotransferase 2B1 is shown in SEQ ID NO.1.

[0009] In one embodiment, pET-28a(+) is used as the expression vector.

[0010] The present invention also provides a method for constructing the recombinant bacteria, which comprises connecting the hydroxysteroid sulfotransferase 2B1 gene with the nucleotide sequence of SEQ ID NO.1 to the expression vector pET-28a(+), then transforming it into Escherichia coli E.Coli BL21(DE3), and screening the correct transformants to obtain the recombinant Escherichia coli E.coli BL21(DE3) / pET-28a—SULT2B1.

[0011] In one embodiment, a histidine tag is added to the N-terminus of the hydroxysteroid sulfotransferase 2B1.

[0012] The present invention also provides a method for preparing hydroxysteroid sulfotransferase 2B1, which comprises culturing the recombinant Escherichia coli in a culture medium and inducing the production of hydroxysteroid sulfotransferase 2B1 with IPTG.

[0013] In one embodiment, the fermentation is specifically:

[0014] The recombinant Escherichia coli was cultured in LB medium containing kanamycin at 37° C. and 220 rpm for 6-8 hours to prepare a seed solution;

[0015] The seed liquid was inoculated into the fermentation medium at an inoculation rate of 10%, and cultured at 37° C. and 220 rpm until the OD reached 0.8-1.0, and then induced with IPTG at a final concentration of 0.5 mM, and cultured at 30° C. and 220 rpm for 20 h.

[0016] In one embodiment, the method further comprises collecting hydroxysteroid sulfotransferase 2B1 in the fermentation broth.

[0017] In one embodiment, the method further comprises isolating and purifying the hydroxysteroid sulfotransferase 2B1, and the specific steps are as follows: centrifuging the fermentation broth, collecting the bacteria, resuspending them with phosphate buffer and breaking the cell wall, centrifuging, collecting the supernatant, and loading the sample; using a Ni column, balancing the column with phosphate buffer for 10 column volumes; using imidazole gradient elution, imidazole is prepared with the above phosphate buffer at 10 mmol·L -1 ,40mmol·L -1 , 100mmol·L -1 Gradient elution.

[0018] The present invention also provides a method for efficiently synthesizing cholesterol sulfate, wherein the method comprises using the hydroxysteroid sulfotransferase 2B1 to catalyze the production in a reaction system containing a sulfate donor, which can be appropriately added during the reaction.

[0019] In one embodiment, the sulfate donor is PAPS.

[0020] In one embodiment, the buffer solution in the reaction system is 10-50 mM Tris-HCl, pH 7.5, 50 mM ATP, and 0.5-1.0 mg / mL hydroxysteroid sulfotransferase 2B1 are added.

[0021] In one embodiment, the catalytic reaction temperature is 30-35° C., and the catalytic time is ≥4 h.

[0022] In one embodiment, the catalytic reaction temperature is 35° C. and the catalytic time is 12 hours.

[0023] In one embodiment, the catalytic system is added with one or more of the protective agents glycerol, BSA, and DTT.

[0024] In one embodiment, the concentration of the protective agent in the reaction system is ≥10 mg / mL.

[0025] The present invention also provides the use of the recombinant bacteria or the method in preparing cholesterol sulfate or products containing cholesterol sulfate.

[0026] In one embodiment, the product includes, but is not limited to, a drug for relieving ulcerative colitis.

[0027] Beneficial effects of the present invention:

[0028] (1) The genetically engineered bacteria constructed by the method of the present invention are expressed in Escherichia coli, which is a method for rapidly producing hydroxysteroid sulfotransferase 2B1. The purification is performed using a nickel column, and the method is simple.

[0029] (2) Escherichia coli has the advantages of high expression level, easy genetic manipulation, simple culture conditions and low cost.

[0030] (3) The hydroxysteroid sulfotransferase 2B1 secreted and expressed by Escherichia coli has a high expression level, stable enzymatic properties, and is resistant to pH and a wide temperature range.

[0031] (4) The present invention can maintain high enzyme activity for a long time by adding stabilizers to the reaction system and optimizing the catalytic system;

[0032] (5) The in vitro enzymatic method of the present invention can efficiently synthesize cholesterol sulfate, the substrate catalytic efficiency can reach 62%, and the purity is relatively high, so cholesterol sulfate can be effectively synthesized. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Plasmid map for the construction of hydroxysteroid sulfotransferase 2B1 in Escherichia coli.

[0034] Figure 2 Schematic diagram of the sulfonation modification of cholesterol sulfate.

[0035] Figure 3 The conversion rates of cholesterol sulfate catalyzed by hydroxysteroid sulfotransferases from different sources.

[0036] Figure 4 The specific enzyme activity and conversion efficiency of hydroxysteroid sulfotransferase 2B1 in Escherichia coli.

[0037] Figure 5 The SDS-PAFE electrophoresis results of steroid sulfotransferase 2B1 constructed in Escherichia coli.

[0038] Figure 6 The relative activity of hydroxysteroid sulfotransferase 2B1 after adding different stabilizers for 12 hours. DETAILED DESCRIPTION

[0039] LB medium: Tryptone 10 g / L, Yeast extract 5 g / L; Sodium chloride (NaCl) 10 g / L

[0040] TB medium: Tryptone 12g / L, Yeast extract 24g / L; Glycerol 10g / L, Potassium dihydrogen phosphate: 2.31g / L, Potassium dihydrogen phosphate: 12.54g / L.

[0041] Enzyme activity assay: In the substrate conversion assay, cholesterol at a concentration of 30 μM was incubated with 1 μM SULT and 100 μM PAPS in 50 mM Tris-HCl / 150 mM NaCl (pH 7.2) at 37°C for 0.5 and 4 hours. Samples were taken at 4 hours and overnight time points, and the production of cholesterol sulfate was detected by HPLC.

[0042] Cholesterol sulfate detection method: Agilent 1600 HPLC system, Polyamine II column (4.6×250 mm, 12 nm), mobile phase: 50 mM KH2PO4 and 0.1% triethylamine solution, flow rate: 0.6 mL·min-1, injection volume: 5 μL, detection time: 35 min, detector: UV 254 nm.

[0043] Cholesterol sulfate conversion rate: the molar ratio of the product cholesterol sulfate to the substrate cholesterol.

[0044] Example 1: Construction of Escherichia coli producing hydroxysteroid sulfotransferase

[0045] Using pET-28a as a vector, hydroxysteroid sulfotransferase genes from different sources were cloned; among them, the nucleotide sequence of sult2b1(Bt) is shown in SEQ ID NO.1; the nucleotide sequence of sult(mus) is shown in SEQ ID NO.3; the nucleotide sequence of sult(Da) is shown in SEQ ID NO.5; and the nucleotide sequence of sult(Tm) is shown in SEQ ID NO.7.

[0046] The primer sequences are shown in Table 1. The upstream primer was used to introduce the BamHI restriction site; the downstream primer was used to introduce the HindⅢ restriction site; the hydroxysteroid sulfotransferase from different sources was linearized with the plasmid pET-28a by primers and then connected. The connected recombinant plasmids pET28-sult2b1(Bt), pET28-sult(mus), pET28-sult(Da), and pET28-sult(Tm) were respectively transferred into E.coli BL21(DE3), and the transformants were selected and sequenced to verify that the correct ones were the recombinant E. coli that were successfully constructed.

[0047] Table 1 Primers and sequences

[0048] Primer name Sequence (5'-3') 28a-f AAGCTTGCGGCCGCACTCGAGCACCA 28a-r TGACTGGTGGACAGCAAATGGGTCGCGGATCC Sult2b1(Bt)-f GCAAATGGGTCGCGGATCCATGGGGCTTCTTGAATTT Sult2b1(Bt)-r AAGCAATGGAACTACAACCTGTAAAAGCTTGCGG Sult(mus)-f AGCAAATGGGTCGCGGATCCATGATGAGCGACTA Sult(mus)-r GAGCACCACCACCACCACCACTGAGATCCGGCTGC Sult(Da)-f ATGGGTCGCGGATCCAATGGGCATCATCAACTT Sult(Da)-r CGAGACCAACGGTGAGCGTGAACAGCTTGCGGCCGC Sult(Tm)-f GGGTCGCGGATCCAATGAACGACACCGAGGTGACCAA Sult(Tm)-r AGATCATGAAGCTGTTCGAGATCAGCTTGCGGCCGCACTCG

[0049] Example 2: Production of Hydroxysteroid Sulfotransferase at Shake Flask Level

[0050] The recombinant Escherichia coli containing the recombinant hydroxysteroid sulfotransferase gene constructed in Example 1 was used as the production strain. A single colony was inoculated in an LB medium containing kanamycin and cultured overnight at 37°C and 220 rpm to obtain a seed culture solution; the seed culture solution was inoculated into a TB medium containing 50 mL of kanamycin at an inoculum amount of 1% by mass, and when OD600 grew to 0.6, 0.1 MIPTG was added to the culture medium, the induction temperature was 30°C, and the expression was induced for 20 hours. A fermentation broth with an OD of 15 was obtained, and then centrifuged at 8000-12000 rpm for 15 minutes at 4°C. The bacterial cells were resuspended to the initial volume with 20 mM Tris-HCl buffer (pH 7.5) and ultrasonically disrupted. The cell precipitate was removed by centrifugation, and the supernatant was collected as a crude enzyme solution.

[0051] The enzymatic activity of hydroxysteroid sulfotransferase is determined by measuring the absorbance of PNP formed during the reaction at 400nm. The reaction system is 1.5mL, including 50mM PNPS, 0.5mM PAP, 100U / mL arylsulfotransferase (AST IV), 20% (v / v) glycerol, 2.mg / mL cholesterol, and an appropriate amount of crude enzyme supernatant. The reaction is carried out at 37°C for 2h. Boil in a boiling water bath for 10min to terminate the reaction. After centrifugation at 10000×g for 10min, the supernatant is removed and the absorbance at 400-nm wavelength is measured. The enzyme activity unit of C4ST is defined as the amount of enzyme required to produce 1:μmol ePNP per hour under specific reaction conditions (37°C, pH 7.4). The PNPS, PAP and other reagents involved in this example were purchased from Sinopharm Group.

[0052] The results showed that the enzyme production in the fermentation broth after 20 hours of induction was strain pET28-sult(mus): 34U / mL, strain pET28-sult2b1(Bt): 47U / mL, strain pET28-sult(Da): 44U / mL and strain pET28-sult(Tm): 40U / mL.

[0053] Example 3: In vitro synthesis of cholesterol sulfate catalyzed by hydroxysteroid sulfotransferase

[0054] The crude enzyme solution was prepared by referring to the method of Example 2, except that the crude enzyme solution was concentrated to 50 U / mL for standby use. The crude enzyme solution of hydroxysteroid sulfotransferase was added to the catalytic system, the catalytic system comprising: 10 mL of crude enzyme solution, 50 mM Tris-HCl buffer (pH 7.0-8.5), 5 mM PAPS, catalyzed at 35-40°C for 12 h, and the formation of cholesterol sulfate was detected by high performance liquid chromatography. The results are shown in FIG. Figure 3 As shown in Table 2, the conversion efficiency of the hydroxysteroid sulfotransferase sult2b1 (Bt) from B. thetaiotaomicron to cholesterol sulfate was the highest, reaching 62.8%. The conversion rates of the enzymes from other sources are shown in Table 2.

[0055] Table 2 Conversion rates of enzymes from different sources

[0056] Enzyme name Conversion rate sult2b1(Bt) 62.8％ sult(mus) 33.2％ sult(Da) 41％ result(Tm) 12.7％

[0057] Example 3: Purification and preparation of recombinant SULT2B1

[0058] The fermentation broth in Example 2 was collected and then centrifuged at 8000-12,000 for 15 minutes at 4°C. The cells were ultrasonically disrupted in 20 mM Tris-HCl buffer pH 7.5. The cell precipitate was removed by centrifugation and the supernatant was collected. The protein purifier AKTAstart25 (GE Healthcare, USA) was used for purification. The specific steps were as follows: a 5 mL Ni column was used and a phosphate buffer (50 mmol / L -l The column was equilibrated with 10 column volumes of pH 7.4. The fermentation supernatant was collected by centrifugation at 4°C and 20 mL was loaded. Imidazole gradient elution was performed. Imidazole was prepared with the above phosphate buffer at 10 mmol / L -1 ,30mmol·L -1 ,200mmol·L -1 Gradient elution, the target protein is eluted at the end. The eluted target protein is desalted and deimidazole-free and stored at 4℃. Figure 5 As shown, as shown in SDS-PAGE, lane 1 represents the band of purified SULT2B1.

[0059] Example 4: In vitro synthesis of cholesterol sulfate catalyzed by hydroxysteroid sulfotransferase 2B1

[0060] After obtaining the target protein, 0.1 mM of the hydroxysteroid sulfotransferase 2B1 protein prepared in Example 3 was added to the catalytic system, the catalytic system was 50 mM Tris-HCl buffer (pH 7.0), 5 mM PAPS was added, catalyzed at 35°C for 4 h, and the formation of cholesterol sulfate was detected by high performance liquid chromatography. The results showed that the cholesterol sulfate content after 4 h of reaction was 480 mM. The cholesterol sulfate content after 12 h of reaction was 624 mM.

[0061] Example 5: Effect of the addition of protective agent on the enzyme stability of hydroxysteroid sulfotransferase 2B1

[0062] Different protective agents, glycerol, BSA or DTT, were added to the catalytic reaction system, respectively, so that the final concentration of the protective agent in the reaction system was 10 mg / mL, and the mixture was incubated at 37°C for 48 hours. After that, the activity of hydroxysteroid sulfotransferase 2B1 was measured, and the relative enzyme activity (with the initial enzyme activity as 100%) was calculated to characterize its stability. Figure 6 As shown, the addition of glycerol, BSA and DTT improved the enzyme stability to varying degrees. SULT 2B1 with BSA still had 78% enzyme activity, which was 29% higher than the control.

[0063] Table 3 Conversion rate of adding different protective agents

[0064] Protective agent Relative enzyme activity No Addition 49％ glycerin 68％ BSA 78％ DTT 59％

[0065] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A recombinant bacterium expressing hydroxysteroid sulfotransferase 2B1, characterized in that: Escherichia coli BL21 (DE3) was used as a host to express hydroxysteroid sulfotransferase 2B1 derived from B. thetaiotaomicron; the amino acid sequence of the hydroxysteroid sulfotransferase 2B1 was shown in SEQ ID NO.

2.

2. The recombinant bacterium according to claim 1, characterized in that pET-28a(+) was used as an expression vector to express the gene with a nucleotide sequence as shown in SEQ ID NO.

1.

3. A method for preparing hydroxysteroid sulfotransferase 2B1, characterized in that: The recombinant bacterium according to claim 1 or 2 is cultured in a culture medium and induced with IPTG to prepare hydroxysteroid sulfotransferase 2B1.

4. The method according to claim 3, characterized in that The method further comprises collecting the hydroxysteroid sulfotransferase 2B1 in the fermentation broth; optionally, it further comprises separating and purifying the hydroxysteroid sulfotransferase 2B1.

5. A method for synthesizing cholesterol sulfate, characterized in that: In a reaction system containing a sulfate donor, the reaction is catalyzed by hydroxysteroid sulfotransferase 2B1 shown in SEQ ID NO.

2.

6. The method according to claim 5, characterized in that The sulfate donor includes, but is not limited to, 3'-phosphoadenosine-5'phosphosulfate.

7. The method according to claim 6, characterized in that The reaction system contains 20-80 mM ATP and 0.5-1.0 mg / mL hydroxysteroid sulfotransferase 2B1.

8. The method according to any one of claims 5 to 7, characterized in that: The temperature of the catalytic reaction is 30-35° C., and the catalytic time is ≥4h.

9. The method according to claim 8, characterized in that The catalytic system contains a protective agent; the protective agent includes but is not limited to one or more of glycerol, BSA, and DTT.

10. Use of the recombinant bacterium according to claim 1 or 2, or the method according to any one of claims 3 to 9 in the preparation of cholesterol sulfate or a product containing cholesterol sulfate.

Images