Wheat blue light receptor TaPHOT2 gene and application thereof

Abstract

The invention discloses a wheat blue light receptor TaPHOT2 gene and application thereof, and belongs to the technical field of gene engineering. The function of the wheat blue light receptor TaPHOT2 gene as shown in SEQ ID NO: 1 is studied through a reverse genetics means, it is found that the resistance of wheat to stripe rust is improved by knocking out the TaPHOT2 gene, and it is indicated that the TaPHOT2 gene plays a negative regulation role in wheat stripe rust resistance. Therefore, the TaPHOT2 gene is knocked out through a gene editing means, so that the stripe rust resistance of the wheat can be improved, and a new material is provided for cultivation of stripe rust resistant wheat varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and relates to a wheat blue light receptor TaPHOT2 gene and an application thereof. Background Art

[0002] Wheat is a major food crop, and its production safety is related to the national economy and the healthy development of the people's livelihood. Three types of wheat rust - stripe rust, leaf rust and stem rust are all important fungal diseases that threaten wheat production. Among them, wheat stripe rust caused by Puccinia striiformis f.sp tritici (Pst) is one of the most serious fungal diseases in wheat production. The fundamental reason for the frequent outbreaks of stripe rust is the frequent variation of the toxicity of stripe rust, and the resistance of existing varieties is easily overcome, resulting in a large outbreak of the disease. Therefore, creating broad-spectrum and long-lasting disease-resistant materials is an important way to prevent and control wheat stripe rust.

[0003] Blue light receptor proteins are an important class of photosensitive proteins in plant cells that can sense blue light signals in the environment and regulate the physiological responses of plants, including cryptochromes and phototropins, which affect plant growth, development and photomorphogenesis by regulating light signal transduction pathways. In recent years, studies have found that blue light receptor proteins also play an important role in plant immunity. Therefore, studying the functions and mechanisms of blue light receptor proteins has important practical value for improving plant disease resistance, helping to develop new plant protection strategies and improve crop varieties, and enhancing the stability and efficiency of agricultural production. Summary of the invention

[0004] In view of the above prior art, the present invention provides a wheat blue light receptor TaPHOT2 gene and its application. Knocking out the gene can improve wheat resistance to stripe rust, and has important application value in the breeding of wheat stripe rust-resistant varieties.

[0005] In a first aspect, the present invention provides a wheat blue light receptor TaPHOT2 gene, the nucleotide sequence of the wheat blue light receptor TaPHOT2 gene is shown in SEQ ID NO:1.

[0006] Furthermore, the wheat blue light receptor TaPHOT2 gene described in the present invention is induced to express by stripe rust, and the wheat blue light receptor TaPHOT2 gene described in the present invention is knocked out to improve the resistance of wheat to stripe rust.

[0007] In a second aspect, the present invention provides a wheat blue light receptor TaPHOT2 protein, which is encoded by the wheat blue light receptor TaPHOT2 gene and has an amino acid sequence as shown in SEQ ID NO:2.

[0008] In a third aspect, the present invention provides a method for cultivating wheat stripe rust-resistant plants, taking the wheat blue light receptor TaPHOT2 gene as an editing target; constructing a gene editing recombinant vector targeting the editing target so that the protein encoded by the edited wheat blue light receptor TaPHOT2 gene is not expressed; constructing wheat mutant plants through the gene editing recombinant vector; and screening and identifying the wheat mutant plants to obtain wheat stripe rust-resistant plants.

[0009] Furthermore, the recombinant vector is selected from a CRISPR / Cas9 vector.

[0010] Furthermore, the nucleotide sequence of the sgRNA target edited by the recombinant vector is shown in SEQ ID NOs: 3-4.

[0011] Furthermore, the wheat mutant plant is constructed by transferring the gene editing recombinant vector into Agrobacterium and then transfecting wheat with the obtained Agrobacterium.

[0012] Furthermore, the background material of the wheat mutant plant is wild-type wheat Fielder.

[0013] In a fourth aspect, the present invention provides the use of the wheat blue light receptor TaPHOT2 gene and its encoded protein in the breeding of wheat resistant to stripe rust.

[0014] Furthermore, in the application of the wheat blue light receptor TaPHOT2 gene and its encoded protein provided by the present invention in the cultivation of wheat resistant to stripe rust, the resistance of wheat to stripe rust is improved by knocking out the wheat blue light receptor TaPHOT2 gene.

[0015] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0016] (1) The present invention analyzes the expression pattern of the TaPHOT2 gene and determines that the TaPHOT2 gene is induced to express by the stripe rust infection during the interaction between wheat and stripe rust.

[0017] (2) The present invention created TaPHOT2 gene editing materials and clarified that knocking out the TaPHOT2 gene enhanced wheat resistance to stripe rust, indicating that the TaPHOT2 gene plays a negative regulatory role in the wheat resistance to stripe rust.

[0018] (3) Compared with traditional disease-resistant breeding technology, plant disease-resistant genetic engineering technology based on molecular biology has opened up a new path for plant disease-resistant breeding. It has made certain breakthroughs in reproductive isolation between species and incompatibility in distant hybridization, and can efficiently achieve targeted improvement of target traits in a relatively short period of time, providing theoretical guidance for the cultivation of stable genetic disease-resistant materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The expression profile of TaPHOT2 gene in the interaction between wheat and stripe rust. Among them, * is P < 0.05, ** is P < 0.01, the non-compatible one is stripe rust CYR23, and the compatible one is stripe rust CYR32.

[0020] Figure 2 This is a map of the TaPHOT2 gene editing vector. Target1 and Target2 are the two targets of the TaPHOT2 gene; TaU6 is the promoter of sgRNA; Cas9 is the core component of the gene editing system, the Cas9 protein; and ZmUbi is the maize ubiquitin promoter that initiates Cas9 expression.

[0021] Figure 3 The PCR test results of transgenic wheat TaPHOT2KO are shown in Figure 1. Among them, L1, L2, L3, L4, L5, L6 and L7 are transgenic wheat TaPHOT2KO lines Line1, Line2, Line3, Line4, Line5, Line6 and Line7; M is a DNA marker.

[0022] Figure 4 The results of the detection of the editing site of the transgenic wheat TaPHOT2KO gene. Among them, Target2 is the target sequence of the TaPHOT2 gene; WT-2A, WT-2B and WT-2D are three copy sequence fragments on the wild-type wheat Fielder; L8-2A, L8-2B and L8-2D are three copy sequence fragments on the mutant plant TaPHOT2KO-L8, L20-2A, L20-2B and L20-2D are three copy sequence fragments on the mutant plant TaPHOT2KO-L20; 1I indicates that there is a 1bp base insertion in the target region.

[0023] Figure 5 Schematic diagram of the phenotypic results of transgenic wheat TaPHOT2KO inoculated with stripe rust CYR32. Among them, TaPHOT2KO-L8 and TaPHOT2KO-L20 are transgenic wheat TaPHOT2KO, Pst CYR32 is inoculated with stripe rust virulent race CYR32, and Fielder is a wild-type wheat variety. DETAILED DESCRIPTION

[0024] The technical scheme of the present invention is described below in conjunction with the embodiments, but the present invention is not limited to the following embodiments. The experimental methods and detection methods described in each embodiment are conventional methods unless otherwise specified; the reagents and materials described are all commercially available unless otherwise specified.

[0025] In order to fully and unambiguously understand the technical solution of the present invention, it should be noted that the non-italic font "TaPHOT2" in the present invention represents the TaPHOT2 protein, and the italic font "TaPHOT2" represents the TaPHOT2 gene. Of course, those of ordinary skill in the art can clearly and completely understand the meaning of the relevant genes and their encoded proteins based on the records of the present invention.

[0026] Example 1

[0027] This example provides the isolation and cloning of the wheat blue light receptor TaPHOT2 gene.

[0028] Total RNA from wheat leaves was extracted using the Huayueyang Plant RNA Extraction Kit, and cDNA was synthesized based on the thermo reverse transcription kit. The cDNA was used as a template to amplify the gene sequence. The amplified product was verified and sequenced, and the obtained nucleotide sequence was shown in SEQ ID NO: 1, named TaPHOT2. The amino acid sequence encoded by the wheat blue light receptor TaPHOT2 gene is shown in SEQ ID NO: 2.

[0029] According to the gene sequence of wheat TaPHOT2, primers for target gene amplification were designed using the software Primer Premier 5.0. The amplification system of the target gene is shown in Table 1:

[0030] Table 1 Amplification system of target gene

[0031] Reagents Dosage (μL) 2×Taq Mix 20.0 Plasmids 2.0 Primer-F 1.0 Primer-R 1.0 <![CDATA[ddH 2 The]]> 16.0

[0032] Amplification program: 95°C for 5 min; 95°C for 30 s, 56°C for 30 s, 72°C for 1 min, this process was performed for 35 cycles; 72°C for 10 min.

[0033] Prepare 1% agarose gel and check the PCR products by agarose gel electrophoresis. Cut the gel band corresponding to the size of the target gene under a gel imager, place it in a 2 mL centrifuge tube, and recover it using an agarose gel recovery kit according to the instructions provided by the kit.

[0034] Example 2

[0035] This example provides the expression of the wheat blue light receptor TaPHOT2 gene induced by stripe rust.

[0036] The stripe rust race CYR32 was inoculated into the second leaf stage of wild-type wheat Fielder, and samples were collected at 0, 6, 12, 24, 36, 48, and 72 hours after inoculation. The samples were placed in liquid nitrogen and stored in a -80°C refrigerator.

[0037] Take out the plant leaf samples from the -80℃ refrigerator, grind them with a crusher, extract RNA according to the instructions of the Huayueyang Plant RNA Extraction Kit, and place them for 30 minutes in the DNA digestion step. Add 18μL DEPC water to the 2μL RNA sample obtained by extraction and use a nucleic acid OD detector to measure the concentration. After the concentration is determined, add 6× loading buffer and perform agarose gel electrophoresis to check for degradation. After confirming that there is no degradation, real-time quantitative PCR is used to detect the expression of the wheat blue light receptor TaPHOT2 gene induced by stripe rust.

[0038] qRT-PCR used the elongation factor gene TaEF1-α as an internal reference and specific primers of the wheat blue light receptor TaPHOT2 gene for real-time quantitative PCR. The quantitative primers and internal reference primers are as follows:

[0039] Quantitation primers:

[0040] Forward primer: TaPHOT2-qRT-F: CGGAGAACACTGAGATACAAA;

[0041] Reverse primer: TaPHOT2-qRT-R: TGCCTTCATCGCAAATAA.

[0042] Internal reference primer:

[0043] Forward primer: TaEF1α-F: TGGTGTCATCAAGCCTGGTATGGT;

[0044] Reverse primer: TaEF1α-R: ACTCATGGTGCATCTCAACGGACT.

[0045] A reverse transcription kit (Thermo Fisher Scientific) was used to prepare the reverse transcription reagent according to the reaction system described in Table 2, and reverse transcription was performed according to the PCR program described in Table 3. The product was precipitated with ddH 2 O was diluted 10-fold and stored at -20°C for qRT-PCR detection.

[0046] Table 2 Reverse transcription reaction system

[0047] Reagents volume RNA samples 2μg Reverse transcriptase 1μL 2×buffer 10μL <![CDATA[ddH 2 The]]> Add to 20 μL

[0048] Table 3 Reverse transcription PCR program settings

[0049] temperature time 42℃ 1h 95℃ 5min 4℃ ∞

[0050] TaPHOT2-specific quantitative primers were designed using Primer Premier 5.0 software. The real-time quantitative PCR reaction system is shown in Table 4, and the program settings are shown in Table 5:

[0051] Table 4 qRT-PCR reaction system

[0052] Reagents Volume (μL) 2×Taq Mix 10.0 Primer-F 0.5 Primer-R 0.5 cDNA 2.0 <![CDATA[ddH 2 The]]> 7.0

[0053] Table 5 qRT-PCR program settings

[0054] program temperature time Pre-denaturation 95℃ 5min transsexual 95℃ 30s annealing 58℃ 30s extend 72℃ 1min End filler 72℃ 10min

[0055] Among them, the denaturation-annealing step requires 35 cycles

[0056] Each of the above reactions was repeated 3 times, and the Ct value was averaged. –ΔΔCt Relative quantification algorithm. Results are the mean of 3 independent biological replicates.

[0057] The results of qRT-PCR detection of the induced expression of TaPHOT2 gene in wild-type wheat Fielder inoculated with stripe rust CYR23 (non-compatible) and stripe rust CYR32 (compatible) at different time points (0h, 6h, 12h, 24h, 48h, 72h of stripe rust infection) are shown in Figure 1 As shown. Within 24 hours after inoculation, the relative expression of the TaPHOT2 gene of both the compatible race CYR32 and the non-compatible race CYR23 of stripe rust decreased compared with the uninoculated wild-type wheat Fielder. After inoculation with the non-compatible race CYR23, the relative expression of the TaPHOT2 gene continued to decline until 48 hours; however, at 72 hours after inoculation, the relative expression of the TaPHOT2 gene began to increase. In contrast, after inoculation with the compatible race CYR32, the relative expression of the TaPHOT2 gene increased sharply at 48 hours; although the relative expression of the TaPHOT2 gene decreased at 72 hours after inoculation, it was still higher than the level of the uninoculated wild-type wheat Fielder.

[0058] Example 3

[0059] This example provides a method for preparing transgenic wheat TaPHOT2KO.

[0060] 1. Construction of recombinant vector

[0061] Design of gene editing targets. Design gene editing targets using the CRISPR gene editing target design website CRISPR-P 2.0. At the same time, align the selected target with the CDS sequence of the target gene to determine the location of the target. Synthesize the target sgRNA using OTC purification. Add 1×TE (50 μL), 10 μL each of the forward primer and reverse primer, and ddH 2 030μL, mix well, react in a water bath at 100℃ for 5min, the reaction temperature is 100℃, and after the reaction is completed, it is naturally cooled to room temperature and stored at -20℃ for use.

[0062] The intermediate vector was digested with BtgZI restriction endonuclease, and 3 μL 10×Cut Smart Buffer, 2 μL pENTR:gRNA(SgA+Vector), 2 μg BtgZI were added and ddH 2 O to make the volume 5μL. Digest at 60℃ for 4h to obtain the linearized vector Linearized pENTR:sgRNA. After the digestion of the intermediate vector, the intermediate vector was connected. The intermediate vector connection system was 4μL Annealed oligo duplex (sgRNA2), 2μL Linearized pENTR:gRNA (linearized vector), 1μL 10×T4Buffer, 1μL T4 DNA ligase, and ddH 2 O was added to make the volume equal to 10 μL, ligated overnight at 16°C, transformed into DH5α, plated for Amp resistance, positive plaques were picked for shake culture and the bacterial solution was sequenced (sequencing primer was ENTR4-R: TGGGTCTAGATATCTCGAGTG), the sequencing results were compared and the positive bacterial solution was returned to extract the plasmid.

[0063] The intermediate vector was digested with Bsal restriction endonuclease, and 3 μL 10×Cut Smart Buffer, 2 μg pENTR:gRNA (SgA+Vector), and 2 μL Bsal were added. 2 O to make the volume 5μL. Enzyme digestion was carried out at 37℃ for 4h to obtain the linearized vector Linearized pENTR:sgRNA. After the intermediate vector was digested, the intermediate vector was connected. The intermediate vector connection system was 4μL Annealed oligo duplex (sgRNA1), 2μL Linearized pENTR:gRNA (linearized vector), 1μL 10×T4Buffer, 1μL T4 DNA ligase, and ddH 2O was added to make the volume 10 μL, ligated at 16°C overnight, transformed into DH5α, plated with Amp resistance, picked positive plaques, cultured and sequenced the bacterial solution (sequencing primer ENTR4-F: GCGTTTCTACAACTCTTCCTG), compared the sequencing results and returned the positive bacterial solution, and extracted the plasmid.

[0064] The intermediate vector plasmid was constructed into the final vector Cas9-PCL1 by LR reaction. 1.5μL SgA+Vector, 1ng Cas9 final vector, 0.5μL LR Clonase TMII enzyme, 1×TE to make up the volume to 2.5μL, connect at 25℃ overnight, transform DH5α, plate Kan resistance, pick positive plaques, PCR amplification detection (NOS-F: AAGCACATACGTCAGAAACCATTAT; NOS-R: TGGGTG AGATTCCTTGAAGTTGAGTA), anneal at 58℃, extend for 1min, directly sequence the PCR product, compare the sequencing results, pick positive plaques, shake culture, and extract plasmids. Wheat gene editing material was created by Agrobacterium infection. The gene editing plasmid connected to the final vector was transformed into Agrobacterium strain EHA105. PCR detection of positive plaques was performed for transgenic.

[0065] like Figure 2 As shown, Target1 and Target2 are used to target the TaPHOT2 gene to achieve the knockout of the TaPHOT2 gene. Specifically, the promoter TaU6 is used to transcribe sgRNA1 and sgRNA2 that match Target1 and Target2. As the core component of the gene editing system, the Cas9 protein, after receiving the sgRNA1 and sgRNA2 transcribed by TaU6, accurately locates the Target1 and Target2 targets on the TaPHOT2 gene to knock out the TaPHOT2 gene. In addition, the maize ubiquitin promoter ZmUbi has a strong transcriptional activation ability, which can ensure that the Cas9 protein obtains sufficient expression in plant cells, thereby effectively supporting the gene editing process. Among them, the sequence of sgRNA2 is GTGTCGCTCATC CGCTACGA (SEQ ID NO: 3); the sequence of sgRNA1 is ACTCTCGGAGAACACT GAGA (SEQ ID NO: 4).

[0066] 2. Obtaining genetically modified wheat

[0067] Take 100μL of Agrobacterium competent EHA105 and place it in ice until it is completely melted; add the constructed TaPHOT2-PCL1-Cas9 vector to the Agrobacterium competent cells respectively, and shake gently to mix the two thoroughly. Preheat the water bath to 37℃, and perform the transformation in the following order: stand in the ice box at low temperature for 5min; stand in liquid nitrogen for 5min; 37℃ water bath for 5min; stand in the ice box at low temperature for 5min. Add 800μL of LB liquid culture medium without antibiotics, mix gently, and shake at 28℃, 160rpm for 2-3h; then culture at 5000rpm for 5min to collect the bacteria. Discard the supernatant in the ultra-clean workbench, reserve about 100 μL of the supernatant, transfer it to a flat plate containing Kan (50 mg / L) and Rif (25 mg / L), spread it evenly and let it stand for 2 to 3 minutes to dry the bacterial solution; seal the plate with a sealing film, invert it in a 28°C incubator, and culture it in the dark for 2 to 3 days. Using the Agrobacterium-mediated genetic transformation method, the recombinant vector TaPHOT2-PCL1-Cas9 was transferred into wheat callus tissue to obtain transgenic wheat TaPHOT2KO.

[0068] 3.PCR Verification

[0069] The genomic DNA of transgenic wheat TaPHOT2KO and control wheat (Fielder) were extracted using the CTAB method.

[0070] The stripe rust physiological race CYR32 was inoculated into the two-leaf stage of transgenic wheat TaPHOT2KO and control wheat. After the inoculation identification was completed, appropriate leaves of the gene-separated lines were placed in 2.0mL centrifuge tubes, marked and quickly placed in liquid nitrogen. The samples were crushed using a crushing grinder. 1 to 2 steel balls were placed in each sample before crushing. The crushing time was 30 to 60 seconds. After the crushing was completed, it was immediately placed on ice; 800 μL of CTAB (containing 0.2% thiol reducing agent) preheated at 65°C was added to each sample, and after vigorous shaking, it was placed in a water bath at 65°C for 1 hour. The sample was taken out and placed on ice. After cooling to room temperature, 800 μL of DNA extraction solution was added and mixed evenly. After vigorous shaking for 5 minutes, it was allowed to stand for 3 minutes and centrifuged at 12000rpm for 10 minutes. Transfer the supernatant to a 2.0 mL centrifuge tube, add chloroform (supernatant: chloroform = 1:1, v / v), mix well, let stand for 2 min, and centrifuge at 12000 rpm for 10 min. Transfer the supernatant to a 1.5 mL centrifuge tube, add pre-cooled isopropanol and sodium acetate (supernatant; isopropanol; sodium acetate = 10:10:1, v / v), mix gently to obtain DNA precipitation, and then store in a -20°C ultra-low temperature refrigerator overnight.

[0071] Centrifuge at 12000rpm for 10min, discard the supernatant, add 500μL 75% ethanol, suspend and wash the DNA precipitate. Centrifuge at 12000rpm for 5min, discard the supernatant, add 500μL anhydrous ethanol, suspend and wash the DNA precipitate. Centrifuge at 12000rpm for 5min, discard the supernatant, and let stand at room temperature for 10-30min (to allow the anhydrous ethanol to fully evaporate). Add 100μL preheated sterile ddH 2 O, fully dissolve the DNA precipitate. Take 1-5 μL DNA sample, add Loading buffer in proportion and mix thoroughly, then perform agarose nucleic acid electrophoresis (1% agarose gel, 160V, 20min) to detect whether the extracted DNA sample has tailing and degradation. After confirming that there is no tailing and degradation, take 1 μL DNA sample and use Nanodrop 2000 spectrophotometer to detect the concentration and quality of DNA. If the measured OD 260nm / 280nm The value is between 1.8 and 2.0, OD 260nm / 230nm If the value is greater than 2.0, the purity of the DNA sample is good. DNA samples with good concentration and quality are stored in a -20℃ ultra-low temperature refrigerator.

[0072] Primer5 software was used to design detection primers, and the extracted DNA samples were tested for Cas9 elements to determine whether the Cas9 elements were successfully introduced into the wheat mutant material. According to the reaction system described in Table 6, the reaction samples and reagents were added to the PCR tube in sequence:

[0073] Table 6 PCR reaction system

[0074]

[0075] Add the above samples and reagents to the PCR tube in sequence, centrifuge briefly to mix, and set the PCR reaction program as shown in Table 7:

[0076] Table 7 PCR reaction program

[0077] program Pre-denaturation transsexual annealing extend Final extension save temperature 95℃ 95℃ 58℃ 72℃ 72℃ 16℃ time 5min 30s 30s 30s 10min forever

[0078] Among them, the denaturation-annealing-extension cycle was repeated 35 times. After the reaction was completed, 5 to 10 μL of PCR product was taken for agarose nucleic acid electrophoresis detection (1% agarose gel, 160V, 20min), and the gel running was observed by a gel imager. If the band size was the same as the target position, the remaining PCR reaction product was sent to a biological company for sequencing, and the results were analyzed to detect the editing situation.

[0079] Figure 3The results of PCR verification of transgenic wheat TaPHOT2KO. M: DL2000 DNA Marker, 2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp; L1, L2, L3, L4, L5, L6 and L7 are the amplification products of TaPHOT2 gene T2 plant DNA respectively; the amplification length is 710bp.

[0080] 4. Detection of Gene Editing Sites in Transgenic Wheat

[0081] According to the gene sequence and target sgRNA sequence, specific detection primers were designed using Primer5 software, and the extracted DNA samples were used as templates to detect the gene editing at the ABD site of the wheat mutant material. The PCR reaction system, reaction procedure, and agarose nucleic acid electrophoresis detection are shown in Tables 6 and 7. If the band size is the same as the target position, the remaining PCR reaction product is sent to a biological company for Hi-Tom deep sequencing, and the editing situation of the sequencing results is analyzed to screen out the fully edited positive mutant material.

[0082] Figure 4 are the detection results of the editing sites of transgenic wheat TaPHOT2KO, Target2 is the target sequence of TaPHOT2 gene; WT-2A, WT-2B and WT-2D are three copy sequence fragments of wild-type wheat Fielder; L8-2A, L8-2B and L8-2D are three copy sequence fragments of transgenic wheat TaPHOT2KO-L8, L20-2A, L20-2B and L20-2D are three copy sequence fragments of transgenic wheat TaPHOT2KO-L20; mutation type 1I indicates that there is a 1bp base insertion in the target region.

[0083] Example 4

[0084] This example provides resistance analysis of transgenic wheat TaPHOT2KO.

[0085] The resistance of TaPHOT2 gene-edited plants to stripe rust was identified by artificial inoculation at the seedling stage. The amplification primers of the target gene TaPHOT2 are as follows:

[0086] Forward primer: TaPHOT2-ORF-F: ATGGCGGGCGCGGGC;

[0087] Reverse primer: TaPHOT2-ORF-R: AAATGTATCGATAACACCTTCCTCG.

[0088] Artificial inoculation identification at the seedling stage was mainly carried out in the cultivation room of the State Key Laboratory of Stress Biology of Arid Crops of Northwest Agriculture and Forestry University and the Southeast Kiln Greenhouse. Four strains were selected for wheat mutant materials, and 6 to 10 seeds with full grains were selected for each strain and numbered; at the same time, the wild-type Fielder wheat variety was used as a control. Seeds were soaked before planting, and 0.2% hydrogen peroxide solution was soaked for 18 to 24 hours to promote seed germination. After the seeds turned white, they were transplanted into 10×10cm plastic pots and planted in separate lines. One strain of one gene was planted in each pot. After recording the number, they were placed in a cultivation room with a temperature of 16°C and a light-dark cycle of 16 / 8 for 12 to 14 days. When planting, the seeds were placed as scattered and evenly as possible to facilitate subsequent inoculation identification. When the wheat mutant material grew to the two-leaf and one-heart stage, the stripe rust CYR32 was inoculated on the fully expanded second leaf. Before inoculation, mark the leaves to be inoculated, pour fresh summer spores of stripe rust CYR32 into the electronic incubation solution, mix gently, and make a 4mg / mL spore suspension. Use a pipette to absorb 20-30μL of spore suspension and slowly and evenly spread it on the inoculated leaves. After the inoculation is completed, spray a small amount of water on the wheat leaves, and place the inoculated wheat seedlings in an incubator with a temperature of 14°C and a relative humidity of 100% to keep them away from light and moisturize. Take them out after 24h, transfer them to a culture room with a temperature of 16°C and a light-dark cycle of 16 / 8 for continued cultivation. During the culture period, a small amount of water can be sprayed every day to keep them moist. About 14 days after inoculation, when the wild-type Fielder is fully diseased (the percentage of the lesion area on the leaves to the total leaf area reaches more than 80%), observe the disease conditions of the inoculated leaves of other mutant materials, take photos of the plant lines to record the disease conditions, and identify their reaction types according to the selected grading standards.

[0089] The L8 and L20 lines were used as test plants, and the wild-type Fielder wheat plants were used as controls to identify the resistance to stripe rust. The phenotypic results of transgenic wheat TaPHOT2KO-L8 and TaPHOT2KO-L20 after inoculation with stripe rust virus race CYR32 for 14 days are shown in Figure 2. Figure 5 As shown, a large number of spores were produced on the leaf surface of wild-type Fielder wheat plants, while almost no spores were produced on the leaf surface of transgenic wheat TaPHOT2KO-L8 and TaPHOT2KO-L20, indicating that transgenic wheat TaPHOT2KO-L8 and TaPHOT2KO-L20 were resistant to stripe rust virus race CYR32. The above results show that knocking out the TaPHOT2 gene helps to improve wheat resistance to stripe rust.

[0090] The embodiments described above are part of the embodiments of the present invention, but not all of them. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but only represents selected embodiments of the present invention. All other embodiments obtained without creative work and related deductions and substitutions made by ordinary technicians in the field under the conditions of the concept of the present invention belong to the scope of protection of the present invention.

Claims

1. A wheat blue light receptor TaPHOT2 gene, characterized in that: The nucleotide sequence of the wheat blue light receptor TaPHOT2 gene is shown in SEQ ID NO:

1.

2. The wheat blue light receptor TaPHOT2 gene according to claim 1, characterized in that Knocking out the wheat blue light receptor TaPHOT2 gene improves wheat resistance to stripe rust.

3. A wheat blue light receptor TaPHOT2 protein, characterized in that: The wheat blue light receptor TaPHOT2 protein is encoded by the wheat blue light receptor TaPHOT2 gene according to claim 1 and has an amino acid sequence as shown in SEQ ID NO:

2.

4. A method for cultivating wheat stripe rust resistant plants, characterized in that: The wheat blue light receptor TaPHOT2 gene described in claim 1 is used as an editing target; a gene editing recombinant vector targeting the editing target is constructed so that the protein encoded by the wheat blue light receptor TaPHOT2 gene after editing is not expressed; Wheat mutant plants are constructed by using the gene editing recombinant vector; and wheat stripe rust-resistant plants are obtained by screening and identifying the wheat mutant plants.

5. The method according to claim 4, characterized in that The recombinant vector is selected from CRISPR / Cas9 vector.

6. The method according to claim 4, characterized in that The nucleotide sequence of the sgRNA target edited by the recombinant vector is shown in SEQ ID NOs: 3-4.

7. The method according to claim 4, characterized in that The wheat mutant plant is constructed by transferring the gene editing recombinant vector into Agrobacterium and then transfecting wheat with the obtained Agrobacterium.

8. The method according to claim 4, characterized in that The background material of the wheat mutant plant is wild-type wheat Fielder.

9. Use of the wheat blue light receptor TaPHOT2 gene and its encoded protein as described in claim 1 in the cultivation of wheat resistant to stripe rust.

10. The use according to claim 9, characterized in that: Knocking out the wheat blue light receptor TaPHOT2 gene improves wheat resistance to stripe rust.

Images