Construction method and application of salmonella enteritidis for improving CD8 + T cell immune response

Abstract

The invention discloses a construction method of salmonella enteritidis capable of improving CD8 + T cell immune response, the constructed salmonella enteritidis changes the intracellular survival mode of bacteria by introducing SteD effect protein coding gene deletion into an attenuated salmonella enteritidis rSC0152 chromosome, the number of bacteria escaping from SCVs to cytoplasm is increased, the number of bacteria escaping from SCVs to cytoplasm is increased, and the CD8 + T cell immune response is improved. The MHC class I molecular level on the surface of the antigen presenting cell is induced, and the CD8 + T cell immune response induced by the strain is remarkably improved; after asdA gene deletion is further introduced, a balanced lethal system is constructed, and heat shock P42 protein of mycoplasma hyopneumoniae Mhp is delivered, increased antigen-specific immune response can also be induced, particularly high-level CD8 + T cell immune response is induced, and the mouse weight can be improved and nasal symptoms and lung pathological tissue changes can be relieved after Mhp strain F66 challenge. The invention provides a new strategy for improving immune response of CD8 + T cells induced by salmonella vector vaccines, and has great market application potential and potential economic benefits.

Description

Technical Field

[0001] The present invention relates to a method for improving CD8 + The invention discloses a method for constructing enteritis salmonella with T cell immune response and its application, and belongs to the technical field of animal bacterial genetic engineering. Background Art

[0002] Due to its simple operation and low cost, Salmonella vector vaccines show good prospects compared to traditional vaccines. After oral immunization, Salmonella vector vaccines can induce local immune responses on the mucosal surface to prevent pathogens from colonizing or passing through the mucosal surface to cause infection. On the other hand, due to its invasiveness, Salmonella can enter the host's intestinal-related lymph node tissue, liver, spleen and other visceral organs, and express exogenous antigens in the corresponding positions, stimulating specific immunity against the vector and exogenous antigens, and also giving Salmonella the greatest potential to induce persistent immunity. However, studies have shown that the cellular immune response induced by Salmonella carrying exogenous antigen proteins is mainly CD4 + T cell immune response is dominant, but only limited CD8 + T cell immune response.

[0003] Studies have shown that after bacteria enter antigen-presenting cells through phagocytosis, if they can escape from the phagosome compartment and directly enter the cell cytosol, the protein delivered by the vector can be regarded as an endogenous antigen, which is presented on the cell surface after binding to MHC class I molecules and produces a strong CD8 + In contrast, proteins delivered by Salmonella lack phagosome escape mechanisms and are mainly present in Salmonella-containing vacuoles (SCVs), where they are viewed as exogenous antigens and presented by MHC class II molecules, mainly inducing CD4 + Different intracellular survival modes explain why Salmonella induces higher levels of CD4 T cell immune response as an antigen delivery vehicle + T cell immune response, which destroys the stability of SCVs and changes the survival mode of Salmonella in cells, which may help exogenous antigen proteins enter the cytoplasm, present on the cell surface after binding to MHC class I molecules as endogenous antigen proteins, and activate strong CD8 + T cell immune response.

[0004] T3SS-2 effector proteins play an important role in maintaining the stability of SCVs. As one of the important T3SS-2 effector proteins, SteD effector protein can hijack the substance transfer pathways between various parts of the intracellular membrane system and may play an important role in maintaining the stability of SCVs membrane components. However, there is no relevant research on whether the loss of SteD effector protein affects the stability of SCVs, nor has it explored the effect of its loss on CD8+ Effects of T cell immune response.

[0005] CD8 + T cells can recognize infected cells through an MHC I-dependent process and secrete perforins and granzymes to lyse cells carrying pathogens. + Death-inducing ligands expressed by T cells bind to death receptors on the surface of infected cells to eliminate pathogen-infected cells. + T cell immune responses play a key role in clearing acute infections, limiting persistent infections, and conferring lifelong protective immunity. Intracellular infections, especially those in the cytosol, are more likely to activate CD8 through antigenic peptide-MHC I complexes. + T cell immune response. However, some microorganisms that infect phagocytes cannot effectively form microbial antigen peptide-MHC I complexes due to low content in the cytosol. Therefore, the intracellular survival mode of pathogenic microorganisms can affect the type of immune response. A sufficient number of pathogens entering the cytosol can induce high levels of CD8 + As a new type of vaccine with good application prospects, attenuated Salmonella vector vaccine plays an important role in inducing CD8 + However, the deficiency of T cells limits its use. + T cell immune response may provide new ideas and directions for the development of vaccines against diseases such as mycoplasma, viruses or cancer. Summary of the invention

[0006] Purpose of the invention: The purpose of the present invention is to provide a method based on the deletion of the SteD effector protein of Salmonella enteritidis, which promotes the exogenous antigen protein carried by bacteria to enter the cytoplasm from SCVs and then present it to CD8 + T cells, inducing high levels of CD8 + Methods of T cell immune response.

[0007] Technical solution: The present invention provides a method for improving CD8 + The method for constructing a T cell immune response-inducing Salmonella enteritidis comprises the following steps: (1) mixing a pKD46 plasmid with the Salmonella enteritidis C50041 and then electroporating the mixture to obtain a C50041 (pKD46) strain;

[0008] (2) C50041 (pKD46) strain was cultured by inducing with L-arabinose, mixed with the Cat gene fragment containing the upstream and downstream homologous arms of the aroC gene and electrotransformed, and the pCP20 plasmid was transferred thereto to induce the expression of FLP recombinase and eliminate the Cat gene fragment to obtain the rSC0152 strain; the nucleotide sequence of the Cat gene fragment is shown in SEQ ID NO.1;

[0009] (3) The rSC0152 strain was transformed into the pKD46 plasmid, and after induction with L-arabinose, the Cat gene fragment containing the upstream and downstream homologous arms of the steD gene was electroporated, and the pCP20 plasmid was transferred into it to eliminate the targeting fragment of the Cm resistance box to obtain the rSC0156 strain, which is to improve CD8 + T cell immune response to Enteritidis Salmonella; the nucleotide sequence of the Cat gene fragment is shown in SEQ ID NO.2.

[0010] Furthermore, the primer sequences used to amplify the Cat gene fragment in step (2) are shown in SEQ ID NOs. 3 to 4.

[0011] Furthermore, the primer sequences used to amplify the Cat gene fragment in step (3) are shown in SEQ ID NOs. 5 to 6.

[0012] Furthermore, the PCR program for amplifying the Cat gene fragment was 98°C for 5 min; 94°C for 40 sec, 55°C for 15 sec, 72°C for 30 sec, 30 cycles; 72°C for 10 min, and stored at 4°C.

[0013] The present invention also provides the use of the Enteritidis Salmonella obtained by the construction method in preparing a vaccine.

[0014] Furthermore, the vaccine is used to induce high levels of CD8 + T cell immune response.

[0015] The present invention also provides a vaccine for preventing and / or treating Mycoplasma hyopneumoniae infection, wherein the vaccine is obtained by the following steps:

[0016] (1) knocking out the asdA gene fragment in the rSC0156 strain to obtain the rSC0159 strain; the nucleotide sequence of the asdA gene fragment is shown in SEQ ID NO.7; the rSC0156 strain and the Cat gene targeting fragment carrying the asdA gene homologous arm sequence were mixed and electroporated, and the mixture was transferred into the pCP20 plasmid to eliminate the Cat gene fragment; (2) the rSC0159 strain was transferred into the pS-P42 plasmid to obtain rSC0159 (pS-P42).

[0017] Furthermore, the sequence of the Cat gene targeting fragment carrying the asdA gene homology arm sequence in step (1) is shown in SEQ ID NO.11.

[0018] Furthermore, the primer sequences for amplifying the Cat gene targeting fragment carrying the asdA gene homology arm sequence are shown in SEQ ID NOs. 9 to 10.

[0019] Furthermore, the Mycoplasma hyopneumoniae infection is caused by the virulent Mycoplasma hyopneumoniae strain F66.

[0020] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: the Enteritidis Salmonella constructed by the present invention introduces a deletion of the SteD effector protein encoding gene into the attenuated Enteritidis Salmonella rSC0152 chromosome, thereby changing the intracellular survival mode of the bacteria, increasing the number of bacteria escaping from SCVs to the cytoplasm, inducing the level of MHC class I molecules on the surface of antigen-presenting cells, and significantly improving the CD8 + T cell immune response; further introduction of asdA gene deletion, construction of a balanced lethal system, and delivery of heat shock P42 protein of Mycoplasma hyopneumoniae Mhp also induced an elevated antigen-specific immune response, especially a high level of CD8 + The present invention is to improve the CD8 T cell immune response induced by Salmonella vector vaccine and improve the weight of mice after Mhp strain F66 challenge, reduce nasal symptoms and lung pathological tissue changes. + T cell immune response provides a new strategy with great market application potential and potential economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The results of identification of strains containing pKD46 plasmid, where M: DNA marker (2000 bp); Lane 1-10: positive strains containing pKD46 plasmid; +: pKD46 plasmid; -: ddH2O negative control.

[0022] Figure 2 This is the identification result of ΔaroC::Cat, where M: DNA marker (2000 bp); Lane 1-9: primary homologous recombinant bacteria ΔaroC::Cat; +: homology arm fragment; -: ddH2O negative control.

[0023] Figure 3 (A) pCP20 plasmid and (B) aroC gene deletion strain identification results, where M: DNA marker (2000bp); +: pCP20; Lane 10: C50041 strain; -: ddH2O negative control.

[0024] Figure 4 The results are the mouse survival rate.

[0025] Figure 5 Identification of steD gene deletion; (A): identification results of aroC gene deletion strain in rSC0156 strain, Lane 1: aroC gene deletion strain; Lane 2: C50041 wild strain; -: ddH2O negative control;

[0026] (B): Identification results of steD gene deletion strains in rSC0156 strain, where Lane 1: steD gene deletion strain; Lane 2: C50041 wild-type strain; -: ddH2O negative control.

[0027] Figure 6 (A) Construction results of recombinant plasmid pYA3337-SteD, where Lane 1: pYA3337-SteD positive result; Lane 2: pYA3337 empty vector; -: ddH2O negative control; (B) Construction results of complemented strain rSC156 (pYA3337-SteD), where Lane 1-8: pYA3337-SteD transferred into steD gene deletion strain positive result; Lane 2: pYA3337-SteD plasmid positive control; -: ddH2O negative control.

[0028] Figure 7 The results of SCVs escape ability, including (A): representative immunofluorescence images of SCVs escape at the 4th hour and statistical analysis of SCVs escape ability; (B): representative immunofluorescence images of SCVs escape at the 8th hour and statistical analysis of SCVs escape ability.

[0029] Figure 8 Flow cytometry to assess CD8 + T cell ratio results, where (A) CD8 was detected by flow cytometry 7 days after immunization + T cell proportion and statistical analysis; (B): Flow cytometry detection of CD8 14 days after immunization + T cell proportion and statistical analysis.

[0030] Fig. 9 The CCK-8 method was used to detect T cell proliferation, where (A) was the CD4 + T cell proliferation; (B): Mouse CD8 on days 7 and 14 after stimulation with outer membrane protein + T cell proliferation.

[0031] Fig.10 LDH method was used to detect cytotoxicity, where (A) is CD8 isolated on day 7.+ T cell toxicity; (B): CD8 isolated on day 14 + T cell toxicity.

[0032] Fig.11 The expression of MHC class I molecules on the surface of antigen presenting cells, wherein (A): flow cytometric analysis of MHC I levels on the surface of RAW264.7 cells; (B): bar graph showing the percentage of MHC I on the surface of RAW264.7 cells at different time points; (C): flow cytometric analysis of MHC I levels on the surface of BMDC cells; (D): bar graph showing the percentage of MHC I on the surface of BMDC cells at different time points.

[0033] Fig.12 PCR identification results of asdA gene deletion, (A): identification results of asdA gene deletion in rSC0152, Lane 1-8: positive results of asdA gene deletion strain successfully introduced into rSC0152; Lane 9: C50041 wild strain control; -: ddH2O negative control; (B): identification results of asdA gene deletion in rSC0156, Lane 1-9: positive results of asdA gene deletion strain successfully introduced into rSC0156; Lane 10: C50041 wild strain control; -: ddH2O negative control.

[0034] Fig.13 These are the PCR identification results of pYA3493 (A) and pS-P42 (B) plasmids, where A: pYA3493 was transferred into rSC0158 (Lane 1-2) and rSC0159 (Lane 3-4) strains; +: pYA3493 plasmid; -: ddH2O negative control; B: pS-P42 was transferred into rSC0158 (Lane 1-2) and rSC0159 (Lane 3-4) strains; +: pS-P42 plasmid; -: ddH2O negative control.

[0035] Fig.14 For the verification of P42 protein expression, (A): protein expression verification of rSC0158 (pYA3493) and rSC0158 (pS-P42), Lane 1: rSC0158 (pS-P42); Lane 2: rSC0158 (pYA3493); (B): protein expression verification of rSC0159 (pYA3493) and rSC0159 (pS-P42), Lane 1: rSC0159 (pS-P42); Lane 2: rSC0159 (pYA3493).

[0036] Fig.15The antibody immune response induced by the candidate vector vaccine, including A: P42-specific sIgA in BALs (left is after the first immunization; right is after the booster immunization); B: P42-specific IgG antibody response (left is after the first immunization; right is after the booster immunization); C: P42-specific IgG1 antibody response (left is after the first immunization; right is after the booster immunization); D: P42-specific IgG2a antibody response (left is after the first immunization; right is after the booster immunization).

[0037] Fig.16 For CD8 + T cell ratio detection and T cell proliferation test results, including (A): flow cytometry detection of CD8 + T cell proliferation; B: CD8 + Statistical analysis results of T cell ratio; C: CCK8 detection of CD4 + T cell proliferation; D: CCK8 detection of CD8 + T cell proliferation.

[0038] Fig.17 The cytotoxicity was detected by LDH method.

[0039] Fig.18 Figure 2 shows the changing trends of body weight and number of sneezes, where A: weight change before and after the infection; B: number of sneezes in the first week after the infection; C: number of sneezes in the second week after the infection; D: number of sneezes in the third week after the infection.

[0040] Fig.19 For histological analysis and pathological scoring of the lungs. DETAILED DESCRIPTION

[0041] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0042] Implementation 1 Construction and virulence evaluation of attenuated strain rSC0152

[0043] 1.1 PCR identification results of strain C50041 (pKD46)

[0044] Drug resistance testing showed that the wild-type Salmonella enteritidis C50041 (CMCC50041; purchased from the China Veterinary Drug Administration) could not grow normally on agar containing Amp or Cm, so the λ-Red homologous recombination method could be used to construct strains with corresponding gene deletions. Based on this, the pKD46 plasmid (#P0098; purchased from Miaoling Plasmid) was mixed with the competent state of the C50041 wild-type strain and then electroporated. The genome template of the colony that could grow normally on the agar plate containing Amp was selected and PCR identification was performed. The pKD46 plasmid was used as a positive control. The results showed that the Amp-resistant strains could successfully amplify a fragment of 417bp in size. The results are shown in Figure 2. Figure 1 It was shown that the pKD46 plasmid had been successfully transferred into the C50041 strain, and it was named C50041 (pKD46).

[0045] The pKD46 identification primers are:

[0046] pKD46-F: ATGGATATTAATACTGAAACTGAGATCAAG

[0047] pKD46-R:TTATAACCTCTGAATCAATATCAACCTG

[0048] The reaction system was 25 μL and was configured as follows: 12.5 μL of 2×Taq Master Mix (Dye Plus) enzyme (#P112-01; purchased from Nanjing Novozymes), 8.5 μL of ddH2O, 1 μL of each of the upstream and downstream primers, and 2 μL of the template.

[0049] The PCR reaction conditions of ordinary Taq Master Mix are as follows: 94℃5min; 94℃40sec, 55℃40sec, 72℃1min (time selected according to 1000bp / min), 35 cycles; 72℃10min, store at 4℃.

[0050] 1.2 Construction of aroC gene-deficient strain rSC0152

[0051] The correctly identified C50041 (pKD46) strain was expanded and cultured in LB liquid medium containing Amp antibiotic (#A610029; 50μg / mL; purchased from Shanghai Biotechnology) (30°C), and L-arabinose (final concentration 100mM) was added to induce for 4 hours when the OD600 was 0.2-0.3, so that the three λ phage recombinases Gam, Beta, and Exo were fully expressed and the electroporation competent state was prepared. The competent state was mixed with the Cat gene fragment (SEQ ID NO.1) containing the upstream and downstream homologous arms of the aroC gene and electroporated. The colonies that can grow normally on the agar plate containing Cm were selected and the genome template was prepared by boiling method, and PCR identification was performed. At the same time, the wild strain C50041 was used as a wild strain control. The homologous recombinant bacteria ΔaroC::Cat can successfully amplify a fragment of 960bp in size. The results are as follows Figure 2 The identified cells were expanded and cultured at 37°C, re-prepared into electroporation competent cells, and transformed into pCP20 plasmid (#P0099; purchased from Miaoling Plasmid). Figure 3Finally, the bacteria were cultured until OD600 was 0.2-0.3, and L-arabinose (final concentration 100 mM) was added for induction for 4 hours to fully express the FLP recombinase and eliminate the Cat gene. The correctly identified bacteria were named rSC0152. Figure 3 (B) shown.

[0052] The primers for amplifying the Cat gene fragment containing the upstream and downstream homologous arms of the aroC gene are shown in SEQ ID NOs. 3-4.

[0053] The fragments were amplified using a high-fidelity enzyme, and the reaction system was 50 μL, configured as follows: Prime 25 μL Max DNA Polymerase high-fidelity enzyme (#R010A; purchased from Beijing TAKARA), 18 μL ddH2O, 2 μL each of upstream and downstream primers, and 4 μL of template (pKD3 plasmid; #P0095; purchased from Miaoling Plasmid).

[0054] The high-fidelity enzyme PCR reaction conditions were as follows: 98°C for 5 min; 94°C for 40 sec, 55°C for 15 sec, 72°C for 30 sec (time was selected according to 1000 bp / 10 sec), 30 cycles; 72°C for 10 min, and stored at 4°C.

[0055] The primers for identifying the homologous recombinant bacteria ΔaroC::Cat are as follows:

[0056] aroCout-F:GATTGTCACTAACCCGCC

[0057] redJD:GGCACGTAAGAGGTTC

[0058] The aroC identification primers after elimination of the resistance cassette are as follows:

[0059] aroCout-F:GATTGTCACTAACCCGCC

[0060] aroCout-R:TATCCACATCAAGCCCG

[0061] The reaction system and PCR reaction conditions used for identification refer to 1.1.

[0062] 1.3 Results of toxicity test of rSC0152

[0063] Safety is an important basis for the successful application of attenuated Salmonella vector vaccines. To further evaluate the effect of aroC gene deletion on the virulence of C50041 strain, mice were orally inoculated with different strains and observed to see whether any mice died after inoculation. Among them, 6-week-old BALB / c mice (weight ≈ 20 g) were purchased from the Experimental Animal Center of our school (3 mice / group). Figure 4 As shown, mice were orally inoculated once with 2.3×10 9 After 21 days of oral administration, all mice survived, while all mice in the control group of wild C50041 bacteria with the same concentration died. This indicates that the deletion of aroC, a gene related to the aromatic amino acid synthesis pathway, can effectively reduce bacterial virulence and ensure vaccine safety.

[0064] Construction of 2SteD effector protein encoding gene deletion strain and complementation strain

[0065] 2.1 PCR identification results of the SteD effector protein encoding gene deletion

[0066] Referring to the deletion step of the aroC gene, the λ-Red homologous recombination method was used to introduce the SteD effector protein encoding gene deletion into the aroC single gene deletion attenuated Enteritidis Salmonella rSC0152. In short, the rSC0152 obtained in Example 1 was prepared into an electrotransfer competent state and then transferred into the pKD46 plasmid, and then prepared into electrotransfer competent cells again after inducing the expression of three λ phage recombinases of Gam, Beta, and Exo. The target fragment containing the Cat gene fragment amplified using the pKD3 plasmid as a template was electrotransferred, and the primary recombinant strain ΔsteD::Cat containing resistance was screened. The primers for amplifying the Cat gene fragment containing the upstream and downstream homologous arms of the steD gene are shown in SEQ ID NO.5-6, the reaction system and PCR reaction conditions used for amplification are shown in 1.2, and the amplified target fragment is shown in SEQ ID NO.2.

[0067] Finally, the pCP20 plasmid was transferred into the primary recombinant strain containing resistance to eliminate the resistance cassette and confirm that the steD gene was successfully deleted. The strain after successful deletion was named rSC0156. PCR identification was performed using C50041 as a control. The results are as follows Figure 5 As shown, the strain (rSC0156) in which the SteD effector protein encoding gene was successfully deleted identified a 657 bp band ( Figure 5 B), while the strain that did not lack the SteD effector protein encoding gene could identify a band of 1123 bp, proving that the steD gene of the rSC0156 strain had been successfully deleted. Finally, the reconfirmation of aroC deletion can be found in 1.2 Primers and reaction system ( Figure 5 B).

[0068] The primers for identifying the homologous recombinant bacteria ΔsteD::Cat are as follows:

[0069] steDout-F:AGCGCTTTTGCCATTGAGG

[0070] redJD:GGCACGTAAGAGGTTC

[0071] The steD identification primers after elimination of the resistance cassette are as follows:

[0072] steDout-F:AGCGCTTTTGCCATTGAGG

[0073] steDout-R: CCTATGACTTGCTGTGTTTGC

[0074] The reaction system and PCR reaction conditions used for identification refer to 1.1.

[0075] 2.2 PCR identification results of the SteD effector protein complementation strain construction

[0076] Using C50041 as a template, the SteD effector protein coding gene was amplified. The specific sequence is shown in SEQ ID NO.8, and it was ligated into the prokaryotic expression plasmid pYA3337 (gifted by Professor Roy Curtiss III of Arizona State University, USA). The results are as follows: Figure 6 As shown in (A), pYA3337-SteD has been successfully constructed and its size is in line with expectations. The successfully constructed plasmid (pYA3337-SteD) was transformed into a strain containing a deletion of the SteD effector protein encoding gene (rSC0156), and the complemented strain was named rSC156 (pYA3337-SteD). The PCR identification results are shown in Figure 6 (B) shown.

[0077] The amplification primers of the steD gene are as follows:

[0078] SteD-F:CGC GGATCC ATGAATGTCACTTCAGGCG (the underline represents the BamH I restriction site)

[0079] SteD-R: CCC AAGCTT TTATGGCCAGGCTGGCCG (the underline represents the Hind III restriction site)

[0080] The high-fidelity enzyme reaction system and PCR reaction conditions used for amplification refer to 1.2.

[0081] The identification primers for ligating pYA3337 and transferring into rSC0156 are as follows:

[0082] pYA3337-F:CTGTTGACAATTAATCATCCGG

[0083] pYA3337-R:AGTTCCCTACTCTCGCATG

[0084] The reaction system and PCR reaction conditions used for identification refer to 1.1.

[0085] Effect of deletion of 3SteD effector protein encoding gene on bacterial entry into the cytoplasm from SCVs

[0086] Deletion of the SteD effector protein enhances bacterial entry from SCVs into the cytoplasm

[0087] To further explore the effect of the loss of the SteD effector protein encoding gene on the entry of bacteria into the cytoplasm from SCVs, wild-type strains C50041, rSC0152, rSC0156, and complemented strain rSC0156 (pYA3337-SteD) were used to infect macrophages at an MOI of 10:1, and the proportion of bacteria in the cytoplasm to the total number of bacteria was evaluated at 4 and 8 hours after immunization. The results showed that at the 4th hour, rSC0156 showed a high level of SCVs escape ability, with about 7.8% of bacteria escaping to the cytoplasm, but there was no significant difference compared with other groups, such as Figure 7 (A) As shown. At 8 hours, Figure 7 As shown in (B), rSC0156 still showed a higher level of SCVs escape ability, with about 10.1% of bacteria escaping to the cytoplasm, significantly higher than the other groups. Moreover, after the SteD effector protein was replenished, the bacteria entering the cytoplasm from SCVs decreased, and at the 8th hour, it was significantly lower than the level of rSC0156 strain entering the cytoplasm.

[0088] Effect of 4SteD effector protein gene deletion on CD8 + Effects of T cell immune response

[0089] Mice (mice information is the same as 1.3; 6 mice / group) were orally immunized with rSC0152, rSC0156, and complemented strain rSC0156 (pYA3337-SteD) at a concentration of (1×10 9 CFU). In addition, PBS was used as a blank control group.

[0090] 4.1 Deletion of the gene encoding the SteD effector protein enhances CD8 in the spleen + T cell ratio

[0091] To further explore the effect of SteD effector protein encoding gene deletion on CD8 + The spleen of mice was collected aseptically on the 7th and 14th days after immunization. After the spleen was ground, CD3 positive cells were separated by magnetic beads and then added to the cell suspension at 10 μL / 10 6 APC anti-mouse CD3 (#ab239287; purchased from Abcam) and PE anti-mouse CD8 (#ab25498; purchased from Abcam) fluorescently labeled antibodies were added at a concentration of 10 cells per 10 cells and the cells were stained for 30 minutes at room temperature. After washing, the proportion of CD3 and CD8 double-positive cells was determined by flow cytometry, which was CD8 + The results are as follows Figure 8 (A) shows that at day 7, rSC0156-induced CD8 + The proportion of T cells was the highest and was significantly higher than that of the rSC0152 group and the blank control group. Figure 8 As shown in (B), rSC0156 also induced the highest CD8 + However, whether on the 7th day or the 14th day, after the SteD protein function was restored, the CD8 + The T cell percentages returned to levels similar to those in the rSC0152 strain immunization group.

[0092] 4.2 CD8 of the group immunized with the strain lacking the gene encoding the SteD effector protein + T cells proliferate more after stimulation with Salmonella enteritidis outer membrane proteins

[0093] To further explore the antigen-specific CD4 + T and CD8 + The T cell immune response level was measured by CCK-8 assay to detect T cell proliferation. Specifically, CD4 + T and CD8 + T cells and stimulated with extracted outer membrane proteins of Salmonella enteritidis. CD4 + T cell proliferation results Fig. 9 (A) As shown in Figure 1, on days 7 and 14, compared with the blank control group, the CD4 + T cells proliferated significantly. In addition, CD8 + T cell proliferation results Fig. 9 (B) shows that CD8 +T cells showed the highest level of cell proliferation on the 14th day after antigen protein stimulation. + The proliferation ability of T cells decreased.

[0094] 4.3 Deletion of the gene encoding the SteD effector protein increases CD8 + T cell-specific killing ability

[0095] The CD8 + T cells were co-incubated with RAW264.7 cells loaded with C50041 outer membrane protein (24-well plate; 37°C / 5% CO2; 24 hours). After the incubation, the release level of LDH was detected. Fig.10 As shown, CD8 + The specific killing effect of T cells was stronger on the 14th day, and after the SteD protein function was restored by prokaryotic expression plasmid, CD8 + The specific killing ability of T cells decreased to the same level as the rSC0152 strain immunization group.

[0096] Effects of 5SteD effector protein encoding gene deletion on MHC I of antigen presenting cells

[0097] Deletion of the gene encoding the SteD effector protein can increase the expression of MHC class I molecules on the surface of antigen-presenting cells

[0098] To further detect the level of MHC class I molecules on the surface of antigen-presenting cells, wild-type strains C50041, rSC0152, rSC0156, and complemented strain rSC0156 (pYA3337-SteD) were used to infect RAW264.7 and bone marrow-derived dendritic cells (BMDC) at an MOI of 10:1. Flow cytometry was used to detect the levels of MHC class I molecules on the surface of RAW264.7 cells and BMDC at 2, 4, 6, and 8 hours after the cells were infected with bacteria. Fig.11 ). The results showed that after the SteD effector protein-deficient strain rSC0156 infected RAW264.7 cells, the level of MHC class I molecules on its surface showed an upward trend, and was significantly higher than that of the wild-type strain C50041, rSC0152, and the SteD effector protein-complemented strain rSC0156 (pYA3337-SteD) at the 6th and 8th hours ( Fig.11A, B). For BMDC, infection with the SteD effector protein-deficient strain rSC0156 also induced an upward trend in the level of MHC class I molecules at different time points. At 8 hours after rSC0156 infected BMDC, the level of MHC class I molecules on its surface reached the highest level within the detection time point, and was significantly higher than that of the wild strain C50041, rSC0152, and the complemented strain rSC0156 (pYA3337-SteD) ( Fig.11 C, D).

[0099] Effect of 6SteD effector protein deletion on the delivery of Mycoplasma hyopneumoniae antigen protein P42 by Salmonella vector

[0100] 6.1 PCR identification results of the deletion of asdA, a key gene in the balanced lethal system

[0101] In order to verify the protective effect of Salmonella rSC0156, which has induced a high level of SteD effector protein deficiency, presenting exogenous antigens, the asdA deficiency was further introduced into rSC0156 and the control strain rSC0152 (by mixing and electroporating with the Cat gene fragment containing the upstream and downstream homologous arms of the asdA gene, obtaining a recombinant strain ΔasdA::Cat, and then transferring it into pCP20 again to eliminate the Cat gene fragment, that is, the asdA deficiency strain) to construct a balanced lethal system. The PCR identification results are shown in Figure 2. Fig.12 As shown in the figure, the gene size amplified from rSC0156 and the control strain rSC0152 after asdA deletion was 643 bp, while the gene of the wild strain C50041 was 1702 bp, and the fragment size was in line with expectations. This proved that the asdA gene in rSC0152 and rSC0156 had been successfully deleted. After identification, the rSC0152 and rSC0156 strains with asdA deletion were named rSC0158 (containing aroC and asdA gene deletions) and rSC0159 (containing aroC, steD and asdA gene deletions), respectively.

[0102] Among them, the nucleotide sequence of the asdA gene is shown in SEQ ID NO.7, the primers for amplifying the Cat gene fragment containing the upstream and downstream homologous arms of the asdA gene are shown in SEQ ID NO.9-10, the sequence of the target fragment after amplification is shown in SEQ ID NO.11, and the high-fidelity enzyme reaction system and PCR reaction conditions used for amplification are shown in 1.2.

[0103] The primers for identifying the homologous recombinant bacteria ΔasdA::Cat are as follows:

[0104] asdAout-F:GGATCAATAAAACAGCGACGG

[0105] redJD:GGCACGTAAGAGGTTC

[0106] The asdA identification primers after elimination of the resistance cassette are as follows:

[0107] asdAout-F:GGATCAATAAAACAGCGACGG

[0108] asdAout-R:CTATCGATACGACTGGACATG

[0109] The reaction system and PCR reaction conditions used for identification refer to 1.1.

[0110] 6.2 PCR Identification Results of the Plasmid Transfection Strain Carrying the P42 Protein Encoding Gene

[0111] To verify high levels of CD8 + Whether T cell-inducing Salmonella strains can be used as vectors to deliver the heat shock protein P42 of Mycoplasma hyopneumoniae to protect against Mycoplasma hyopneumoniae infection, after knocking out the asdA gene and introducing a balanced lethal system, rSC0158 and rSC0159 strains were prepared into electroporation competent cells, and the prokaryotic expression plasmid pS-P42 plasmid carrying the Mhp heat shock protein P42 (derived from pYA3493, constructed by previous studies, see the article Oral Immunization with Attenuated Salmonella Choleraesuis Expressing the P42 and P97 Antigens Protects Mice against Mycoplasma hyopneumoniae Challenge) was transferred by electroporation, and the pYA3493 plasmid (gifted by Professor Roy Curtiss III) was used as an empty vector control group. Strains that can grow normally on LB agar medium were selected for PCR identification, and the results are shown in the following table. Fig.13 As shown, pYA3493 and pS-P42 plasmids carrying P42 protein have been successfully transformed into rSC0158 and rSC0159 strains, and the band size is in line with expectations. Finally, the strains were named rSC0158 (pYA3493), rSC0158 (pS-P42), rSC0159 (pYA3493) and rSC0159 (pS-P42), respectively.

[0112] 6.3P42 protein can be successfully expressed in the vector strain

[0113] In order to verify whether the P42 protein can be successfully expressed in rSC0158 and rSC0159, the mouse anti-P42 protein polyclonal antibody prepared previously (for antibody preparation methods, see the article Oral Immunization with AttenuatedSalmonella Choleraesuis Expressing the P42 and P97 Antigens Protects Miceagainst Mycoplasma hyopneumoniae Challenge) was used as the primary antibody for incubation, and then HRP-conjugated goat anti-mouse antibody (#bs-0296G-HRP; purchased from Beijing Biosen Co., Ltd.) was used for rebinding, and ECL high-sensitive color development solution (#180-5001; purchased from Tianneng Co., Ltd.) was used for color development. The results are shown in Figure 2. Fig.14 As shown in the figure, both rSC0158(pS-P42) and rSC0159(pS-P42) successfully expressed P42 protein, and a band with a molecular weight of about 42Kda was detected, which was consistent with the expected size. However, no specific bands were detected in rSC0158(pYA3493) and rSC0159(pYA3493), which was consistent with expectations.

[0114] 6.4 rSC0158 (pS-P42) and rSC0159 (pS-P42) can induce antigen-specific humoral and mucosal immune responses in mice

[0115] In order to evaluate the specific immune response induced by the delivery of P42 protein by the candidate vaccine vector strain, different groups of mice (mice information is the same as 1.3; 6 mice / group) were orally immunized at a concentration of (1×10 9 CFU). A booster immunization was performed three weeks after the first immunization. Bronchoalveolar lavage fluid and blood were collected one week after the first and booster immunizations to detect antibody levels.

[0116] ELISA was performed to detect the specific secretory IgA (sIgA; #ab97235; purchased from Abcam) and IgG (#bs-0296G-HRP; purchased from Beijing Bioson) and its subtypes (IgG1: #ab97240, purchased from Abcam; IgG2a: #ab97245, purchased from Abcam) of P42 in bronchoalveolar lavage fluid and serum. The specific method is as follows: 96-well plates were coated with purified P42 protein (0.2 μg / well) and incubated at 4°C for 12 hours. The 96-well plates were then washed three times with PBST (PBS with 0.05% Tween 20). After patting dry, the plates were blocked with 340 μL of PBS containing 5% skim milk at 37°C for 3 hours. After washing again with PBST for 3 times, 100 μL of serially diluted serum or 100 μL of bronchoalveolar lavage fluid was added to each well and incubated at 37°C for 1.5 hours. After washing with PBST for 3 times, the wells were incubated with 100 μL of 1:5000 diluted goat anti-mouse IgG (or IgG1; or IgG2a) antibody and goat anti-mouse IgA antibody, respectively. After washing again with PBST for 3 times, 100 μL of TMB substrate (#PR1200, purchased from Beijing Solarbio Company) was added to each well. After incubation in the dark for 7–15 minutes, the reaction was terminated by adding 50 μL of 2 mol / L H2SO4 and read at 450 nm using a spectrophotometer microplate reader. The maximum sample dilution that was 2.1 times higher than the absorbance value of the negative control serum was defined as the final titer of sIgA antibody and antigen-specific IgG and its subtypes.

[0117] The results are as follows Fig.15 As shown in Figure 2, higher P42-specific IgG titers were detected in mice immunized with rSC0158(pS-P42) and rSC0159(pS-P42) compared with the blank control group and the empty vector group, and the IgG level increased again after booster immunization ( Fig.15 B). IgG1( Fig.15 C) and IgG2a ( Fig.15 Analysis of sIgA levels in BALs ( Fig.15A) showed that the recombinant vaccine strains rSC0158 (pS-P42) and rSC0159 (pS-P42) could induce mucosal immunity, and the sIgA levels produced by both the first and booster immunizations were significantly higher than those of the blank control group and the empty vector control group. The above results showed that after immunization with rSC0158 (pS-P42) and rSC0159 (pS-P42), P42 protein-specific humoral and mucosal immune responses could be successfully induced, but there was no significant difference in the production of antibodies between the two candidate vector strains.

[0118] 6.5 Salmonella vector rSC0159 carrying only the SteD effector protein deletion can deliver P42 protein to induce high levels of antigen-specific CD8 + T cell immune response

[0119] To further explore whether the candidate vaccine vector strain rSC0159 (pS-P42) with the SteD effector protein encoding gene deleted can induce P42-specific CD8 + The proportion of T cells increased. First, flow cytometry was used to detect the CD8 + The results are as follows Fig.16 As shown in A and B, after booster immunization, CD8 + The proportion of T cells increased significantly. However, the candidate vaccine strains with rSC0158 as the vector, whether carrying P42 protein or not, failed to induce CD8 + In order to evaluate the P42 protein-specific cellular immune response induced by vaccine immunization, the CD4 + T and CD8 + The results showed that P42 protein could stimulate CD4 T cells after immunization with rSC0158 (pS-P42) and rSC0159 (pS-P42). + T cells proliferated significantly, while the empty vector immunization group had no significant difference after stimulation with P42 protein compared with the blank control group ( Fig.16 C) P42 protein was used to stimulate CD8 + After T cells, only rSC0159(pS-P42) induced CD8 + T cell proliferation was significantly increased ( Fig.16 D) demonstrated that the candidate vaccine strain rSC0159 (pS-P42) with the SteD effector protein encoding gene deleted could induce P42-specific CD8 + T cell immune response.

[0120] 6.6 CD8 induced by immunization with candidate vaccine strains carrying the SteD effector protein deletion + T cell-specific killing effect is stronger

[0121] To further explore the CD8 + The specific killing effect of T cells was detected by separating CD8 + T cells (5×10 5 cells / well) and RAW264.7 cells loaded with antigen protein (5×10 3 After mixing, the cells were centrifuged at 1000 rpm for 5 min and then placed in a 37°C incubator containing 5% CO2 for 4 hours. After the incubation, the LDH release level was detected ( Fig.17 ), in which RAW264.7 cells loaded with antigen protein alone served as blank control. The results showed that 7 days after booster immunization, the CD8 + The LDH released by T cells after co-incubation with RAW264.7 cells loaded with P42 protein was significantly higher than that in other groups, indicating that the CD8 + The T cell-specific killing effect is stronger.

[0122] 6.7 Immunization with candidate vaccine strains carrying a deletion of the SteD effector protein improves the effects on body weight and respiratory tract after challenge

[0123] The challenge was carried out 21 days after the booster immunization, with 10 7 CCU Mycoplasma hyopneumoniae virulent strain F66 (CVCC354, purchased from China Food and Drug Administration). The infected control group was the PBS immunization group and the blank control group was the group that was neither immunized nor challenged. The mice were weighed before the first immunization, before the challenge, and 21 days after the challenge to evaluate the improvement of the production performance of mice after immunization with the recombinant attenuated Salmonella vector vaccine. The results are shown in Fig.18 As shown in (A), there was no significant difference in the body weight of mice in each group before the challenge compared with the blank control group, but the body weight of the empty vector immunization group and the PBS immunization group decreased significantly compared with the blank control group after the challenge, while the body weight of the rSC0159 (pS-P42) and rSC0158 (pS-P42) immunization groups showed an upward trend, indicating that rSC0159 (pS-P42) and rSC0158 (pS-P42) immunization can improve the effect of Mhp on body weight after the challenge. Among them, rSC0159 (pS-P42) has the most obvious effect on improving body weight.

[0124] After the infection, the mice were observed at a fixed time every day, 10 minutes per day for each group, and the number of sneezes of each mouse in each group was counted. Fig.18 As shown in (BD), compared with the empty vector group and PBS immunization group, the rSC0159 (pS-P42) and rSC0158 (pS-P42) immunization groups showed mild respiratory symptoms and delayed the progression of the disease, and the number of sneezes in the third week after the rSC0159 (pS-P42) group was significantly lower than that in the rSC0158 (pS-P42) group. In general, no obvious clinical symptoms were observed in rSC0159 (pS-P42) throughout the experiment, which was similar to the blank control group.

[0125] 6.8 Immunization with candidate vaccine strains carrying the missing SteD effector protein can improve lung tissue lesions and reduce lesion scores after challenge

[0126] The mice were euthanized 21 days after infection, and some of the mouse lung tissues were taken and made into paraffin sections for histopathological analysis and scoring. Fig.19 As shown in the figure, compared with the blank group, the lesions in the PBS immunization and empty vector immunization groups were more extensive, the alveolar septa were significantly widened, a large number of inflammatory cells infiltrated in the septa, and there was obvious congestion and hemorrhage. Compared with the PBS immunization and empty vector immunization groups, the rSC0159 (pS-P42) and rSC0158 (pS-P42) immunization groups, especially the rSC0159 (pS-P42) immunization group, had only a small amount of inflammatory cell infiltration. The lung tissue morphology of the blank group was normal, and no lesions occurred in the alveolar septa. In order to more intuitively compare the histopathological lesions of the mouse lungs, the histopathological lesions were evaluated with reference to the scoring criteria in Table 1. Among them, the pathological tissue damage of the empty vector immunization group and the PBS immunization group was the most serious, with the highest score, which was significantly different from the blank control group. Although the rSC0158 (pS-P42) immunization group played a good protective role, its score was still significantly higher than that of the blank group. The pathological tissue damage in the rSC0159(pS-P42) immunization group was mild, and its score was similar to that of the blank control group, with no significant difference.

[0127] Table 1 Lesion scoring criteria

[0128]

[0129]

[0130] In summary, this study confirmed that the introduction of SteD effector protein deletion into the attenuated strain rSC0152 of Enteritidis Salmonella can change the intracellular survival mode after infecting macrophages, increase the number of bacteria entering the cytoplasm, and increase the level of MHC class I molecules on the surface of antigen-presenting cells, thereby enhancing the CD8 + T cell immune response. Delivery of Mycoplasma hyopneumoniae heat shock protein P42 using a strain containing a deletion of the SteD effector protein as a vector can induce high levels of mucosal, humoral, and cellular immune responses, especially high levels of CD8 + T cell immune response. After immunization, it can also significantly improve the effects of Mycoplasma hyopneumoniae on the body weight and nasal symptoms of mice after infection, and reduce lung pathological changes. + T cell immune response provides new ideas and directions for the development of vaccines for diseases such as mycoplasma, viruses or cancer that are prevented and controlled.

Claims

1. A method to increase CD8 + A method for constructing a T cell immune response-resistant Salmonella enteritidis, characterized in that: The following steps are involved: (1) The pKD46 plasmid and the Salmonella enteritidis C50041 were mixed and electroporated to obtain the C50041 (pKD46) strain; (2) C50041 (pKD46) strain was cultured by inducing with L-arabinose, mixed with the Cat gene fragment containing the upstream and downstream homologous arms of the aroC gene and electrotransformed, and the pCP20 plasmid was transferred thereto to induce the expression of FLP recombinase and eliminate the Cat gene fragment to obtain the rSC0152 strain; the nucleotide sequence of the Cat gene fragment is shown in SEQ ID NO.1; (3) The rSC0152 strain was transferred into the pKD46 plasmid, and after induction with L-arabinose, the Cat gene fragment containing the upstream and downstream homologous arms of the steD gene was electroporated, and the pCP20 plasmid was transferred into it to eliminate the Cat gene fragment, thereby obtaining the rSC0156 strain, which is used to improve CD8 + T cell immune response to Enteritidis Salmonella; the nucleotide sequence of the Cat gene fragment is shown in SEQ ID NO.

2.

2. The construction method according to claim 1, characterized in that: The primer sequences used to amplify the Cat gene fragment in step (2) are shown in SEQ ID NOs. 3 to 4.

3. The construction method according to claim 1, characterized in that: The primer sequences used to amplify the Cat gene fragment in step (3) are shown in SEQ ID NOs. 5 to 6.

4. The construction method according to claim 1, characterized in that: The PCR program for amplifying the Cat gene fragment was 98°C for 5 min; 94°C for 40 sec, 55°C for 15 sec, 72°C for 30 sec, 30 cycles; 72°C for 10 min, and stored at 4°C.

5. Use of the Enteritidis Salmonella obtained by the construction method according to any one of claims 1 to 3 in the preparation of vaccines.

6. The use according to claim 4, characterized in that: The vaccine is used to induce high levels of CD8 + T cell immune response.

7. A vaccine for preventing and / or treating Mycoplasma hyopneumoniae infection, characterized in that: The vaccine is obtained by the following steps: (1) knocking out the asdA gene fragment in the rSC0156 strain to obtain the rSC0159 strain; the nucleotide sequence of the asdA gene fragment is shown in SEQ ID NO.7; the rSC0156 strain and the Cat gene targeting fragment carrying the asdA gene homologous arm sequence were mixed and electroporated, and the mixture was transferred into the pCP20 plasmid to eliminate the Cat gene fragment; (2) the rSC0159 strain was transferred into the pS-P42 plasmid to obtain rSC0159 (pS-P42).

8. The vaccine for preventing and / or treating Mycoplasma hyopneumoniae infection according to claim 7, characterized in that: The sequence of the Cat gene targeting fragment carrying the asdA gene homology arm sequence in step (1) is shown in SEQ ID NO.

11.

9. The vaccine for preventing and / or treating Mycoplasma hyopneumoniae infection according to claim 8, characterized in that: The primer sequences used to amplify the Cat gene targeting fragment carrying the asdA gene homology arm sequence are shown in SEQ ID NOs. 9-10.

10. The vaccine for preventing and / or treating Mycoplasma hyopneumoniae infection according to claim 7, characterized in that: The Mycoplasma hyopneumoniae infection is caused by the virulent Mycoplasma hyopneumoniae strain F66.

Images