Medicago sativa MsPYL9 gene and application of medicago sativa MsPYL9 gene in regulation and control of plant drought tolerance

Abstract

The invention discloses a medicago sativa MsPYL9 gene and application of the medicago sativa MsPYL9 gene in regulation and control of plant drought tolerance, and relates to the field of molecular biology. The amino acid sequence of the MsPYL9 protein has at least 80% identity with the sequence shown in SEQ ID NO: 1, and when the MsPYL9 protein is applied to construction of transgenic plants, plant varieties can be optimized and the tolerance of the plants to drought stress can be improved on the premise that the basic physiological structure and nutritional value of the plants are not changed, so that the plants can approach to normal growth under the drought condition. The MsPYL9 protein or the MsPYL9 gene has important significance on cultivation of drought-resistant plants, productivity can be effectively improved, and water resources are saved.

Description

Technical Field

[0001] The invention relates to the field of molecular biology, in particular to an alfalfa MsPYL9 gene and an application thereof in regulating plant drought resistance. Background Art

[0002] Alfalfa (Medicago sativa L.) is a perennial herb of the genus Alfalfa in the Leguminosae family. It originated in West Asia and has been widely introduced and cultivated in temperate regions of Europe, Asia and North America due to its strong adaptability and rapid growth. It is known as the "king of forage grasses". Alfalfa has rich nutritional value and comprehensive nutrition, and plays an important role in agricultural production.

[0003] Alfalfa is famous for its high crude protein content, which accounts for about 15% to 20% of dry matter, much higher than other feed crops. Crude protein contains a full range of amino acids, balanced proportions, and high conversion titers. It contains more than 20 essential amino acids for humans and animals, as well as some rare amino acids. Alfalfa is also rich in carbohydrates, vitamins, mineral elements, etc. These nutrients play an important role in the growth and development of animals, including providing important energy nutrients, promoting animal digestion, improving the quality of animal products, and enhancing the immune function of animals.

[0004] Alfalfa, which is distributed in northern regions, is limited by the low precipitation, soil salinization, and long and cold winters in the northern regions. The planting area and yield of alfalfa are seriously threatened. Alfalfa has a certain adaptability to drought conditions, but long-term or severe drought stress will have a significant impact on alfalfa. Through molecular breeding methods, screening and breeding of more drought-resistant alfalfa varieties can increase the stability and sustainability of forage production. The cultivation of drought-resistant alfalfa can also reduce the demand for water resources and help save water resources, especially in arid areas or places where water resources are scarce, and more effectively use limited water resources for agricultural and animal husbandry production. At present, the breeding of new stress-resistant alfalfa varieties is still not enough to meet the production needs of alfalfa.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The purpose of the present invention is to provide an alfalfa MsPYL9 gene and its application in regulating plant drought resistance.

[0007] The present invention is achieved in that:

[0008] In a first aspect, an embodiment of the present invention provides a use of a biological material in improving plant stress resistance or preparing a product for improving plant stress resistance, wherein the biological material comprises any one of the following: (1) MsPYL9 protein, whose amino acid sequence has at least 80% identity with the sequence shown in SEQ ID NO: 1; (2) an isolated nucleic acid molecule encoding the MsPYL9 protein; (3) a vector containing the isolated nucleic acid molecule; (4) a recombinant cell or recombinant bacteria containing the vector.

[0009] In a second aspect, an embodiment of the present invention provides a method for improving plant stress resistance, comprising: increasing the expression level of the MsPYL9 gene in a target plant; the amino acid sequence of the protein encoded by the MsPYL9 gene has at least 80% identity with the sequence shown in SEQ ID NO:1.

[0010] The present invention has the following beneficial effects:

[0011] The MsPYL9 gene screened and obtained in the embodiment of the present invention can optimize plant varieties and improve the tolerance of plants to drought stress without changing the basic physiological structure and nutritional value of the plants, so that the plants can grow close to normal under drought conditions. The MsPYL9 gene is of great significance for cultivating drought-resistant plants, and can effectively improve productivity and save water resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0013] Figure 1 The diagram is a phylogenetic analysis result of the amino acid sequences encoded by the MsPYL9 and PYL genes in Arabidopsis, wheat and Medicago truncatula in Example 1;

[0014] Figure 2 The diagram is a Real-time PCR expression pattern diagram of the MsPYL9 gene in Example 2 when it is induced by stress; wherein A is the expression of the MsPYL9 gene in the aboveground part and the underground part at each time point under the condition that the final concentration of mannitol is 400 mM; B is the expression of the MsPYL9 gene in the aboveground part and the underground part at each time point under the condition that the final concentration of the plant hormone abscisic acid is 80 μM;

[0015] Figure 3 This is a diagram showing the subcellular localization results of MsPYL9 in tobacco leaves in Example 3;

[0016] Figure 4 The result diagram of the molecular detection of the target gene in transgenic Arabidopsis thaliana in Example 4; wherein A is the electrophoresis diagram, plasmid is the positive control, blank is the water control, wild-type is the wild-type plant control, 1-19 is T 3 B is the result of qRT-PCR; WT is wild type, OE1~OE19 are T 3 Generation of homozygous overexpression lines;

[0017] Figure 5 Comparison of germination of wild type and overexpression strains in MS medium, MS medium containing 400 mM and 500 mM mannitol in Example 4; A is seed germination phenotype, B is germination rate statistics;

[0018] Figure 6 is T in Example 4 3 Comparison of the growth of the homozygous strains OE3, OE11, OE12 and the wild-type strain WT during the dehydration treatment and three days after rehydration;

[0019] Figure 7 The comparison of the water loss rate of the detached leaves between the alfalfa OE and the wild type in Example 5; wherein A is the leaf water loss phenotype, and B is the leaf water loss rate statistics;

[0020] Figure 8 The figure is a comparison result of soil drought phenotype of overexpressed and wild-type alfalfa in Example 5. DETAILED DESCRIPTION

[0021] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0022] In one aspect, an embodiment of the present invention provides a use of a biomaterial in improving plant stress resistance or preparing a product for improving plant stress resistance, wherein the biomaterial comprises any one of the following:

[0023] (1) MsPYL9 protein, the amino acid sequence of which is at least 80% identical to the sequence shown in SEQ ID NO:1;

[0024] (2) an isolated nucleic acid molecule encoding the MsPYL9 protein;

[0025] (3) a vector containing the isolated nucleic acid molecule;

[0026] (4) A recombinant cell or recombinant bacterium containing the vector.

[0027] In some embodiments, the stress resistance includes drought resistance. "Drought resistance" refers to the ability to resist water loss adversity. Alternatively, the water loss adversity can be a natural adversity that is the same or equivalent to the simulated adversity with a final concentration of mannitol of 400-500mM.

[0028] In some embodiments, the nucleic acid molecule can be a gene encoding MsPYL9 protein or its CDS region.

[0029] In some embodiments, said increasing the stress resistance of a plant comprises breeding plants with enhanced stress resistance.

[0030] In some embodiments, the vector includes a cloning vector and an expression vector. A plant expression vector can be used to construct a recombinant vector containing the isolated nucleic acid molecule encoding the MsPYL9 protein. The plant expression vector can be a Gateway system vector or a binary Agrobacterium vector, such as pGWB411, pGWB412, pGWB405, pBin438, pCAMBIA1300, pCAMBIA1302, pCAMBIA2300, pCAMBIA2301, pCAMBIA1301, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb.

[0031] In some embodiments, the recombinant bacteria may be bacteria or fungi. The bacteria may be Agrobacterium and Escherichia coli; the fungi may be yeast. In some embodiments, the recombinant cells include transgenic cell lines.

[0032] In some embodiments, the plant comprises any one or more of alfalfa and Arabidopsis thaliana.

[0033] In some embodiments, the amino acid sequence of the MsPYL9 protein is as shown in SEQ ID NO: 1, which is derived from alfalfa (Medicago sativa L.) and consists of 190 amino acids.

[0034] In some embodiments, the nucleic acid molecule encoding the MsPYL9 protein is the MsPYL9 gene or its CDS region.

[0035] In some embodiments, the nucleotide sequence of the isolated nucleic acid molecule is at least 80% identical to the sequence shown in SEQ ID NO:2.

[0036] In some embodiments, the nucleotide sequence of the isolated nucleic acid molecule is shown in SEQ ID NO:2.

[0037] In some embodiments, the at least 80% identity may specifically be 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 100% or any two of the above. Alternatively, one or more amino acids may be substituted, deleted or added to form an amino acid sequence with a non-100% identity.

[0038] On the other hand, an embodiment of the present invention further provides a method for improving plant stress resistance, which comprises: increasing the expression level of the MsPYL9 gene in the target plant.

[0039] The protein encoded by the MsPYL9 gene is the MsPYL9 protein. It should be noted that the MsPYL9 protein, the plant and the stress resistance are the same as those described in any of the above embodiments and will not be described in detail.

[0040] In some embodiments, the expression level includes protein expression level and / or gene expression level.

[0041] In some embodiments, the step of increasing the expression level of the MsPYL9 gene in the target plant comprises: inserting a nucleic acid molecule encoding the MsPYL9 protein into the genome of the target plant. There is no specific limitation on the method of inserting the exogenous gene into the genome of the target plant, and it can be obtained and implemented based on the conventional technical knowledge in the art.

[0042] In some embodiments, after inserting the nucleic acid molecule encoding the MsPYL9 protein into the genome of the target plant, transgenic plant seeds are obtained; the method further comprises: artificially cultivating the transgenic plant seeds or allowing the transgenic plant seeds to grow naturally.

[0043] In some embodiments, the nucleotide sequence of the nucleic acid molecule encoding the MsPYL9 protein has at least 80% identity with the sequence shown in SEQ ID NO: 2. The at least 80% identity may specifically be any one of 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98%, 100%, or any two of the identities.

[0044] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0045] Example 1: Cloning and sequencing of the MsPYL9 gene

[0046] Plant material: Alfalfa Zhongmu No. 1.

[0047] Under normal conditions, healthy and plump seeds were germinated in a culture dish covered with double-layer filter paper for 5 days. When the cotyledons of the seedlings unfolded, they were transferred to the prepared MS nutrient solution with a pH of 5.8. After 7 days of cultivation, NaCl was added to the MS nutrient solution to a final concentration of 150 mM, treated for 24 hours, and quickly sampled, frozen in liquid nitrogen, and stored at -80°C for later use.

[0048] The RNA of the samples was extracted by Trizol extraction method and then reverse transcribed into cDNA using cDNA first-strand synthesis kit.

[0049] The total volume of the PCR detection system was 50 μL, and the system was 5×Phusion HF Buffer 10 μL, cDNA 1 μL, 2.5 mM dNTP 4 μL, Phusion DNA Polymerase 0.5 μL, ddH 2 O 32.5μL, primer MsPYL9-F (5'-3'): GCGGATCCATGAACAACGGTTGTGAACAA (SEQ ID No: 3) 1μL and primer MsPYL9-R (5'-3'): GCGAGCTCTTATGGGTTGATATTGATAGG (SEQ ID No: 4) 1μL. The reaction procedure was as follows: first round: 98℃ pre-denaturation for 30s; second round: 98℃ denaturation for 10s, 54℃ annealing for 30s, 72℃ extension for 10s, second round cycle 35 times; third round: 72℃ extension for 5min; 4℃ termination, the reaction was completed.

[0050] The result of electrophoresis in 1.5% agarose gel was 589 bp in length. The DNA fragment of the gene was recovered and double-digested with the expression vector pBI121. The restriction sites were BamH I and Sac I. The result of restriction digestion was confirmed by gel electrophoresis. Then, the product was recovered using EasyPure Gel Recovery Kit (EG101, Beijing Quanshijin Biotechnology Co., Ltd.). Finally, T 4 DNA ligase (M0202, New England Biolabs Beijing Co., Ltd.) was used to connect the target fragment after enzyme digestion with the expression vector, and the fragment was transferred into Escherichia coli DH5α competent cells, evenly spread on LB resistance plates containing kanamycin (Kan), and cultured in a 37°C incubator overnight. Appropriate positive clone plaques were detected and selected, and then placed in liquid culture medium containing Kan resistance, and cultured overnight in a shaker at 37°C at 200 rpm.

[0051] After the bacterial solution was tested, it was sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results showed that the colony had the nucleotide sequence in SEQ ID No: 2, which was named MsPYL9 gene, and the protein encoded by the gene was named MsPYL9 protein, and the protein sequence was shown in SEQ ID No: 1. The phylogenetic analysis results of MsPYL9 and the amino acid sequences encoded by PYL genes in Arabidopsis, wheat and Medicago truncatula are shown in Figure 1. Figure 1 .

[0052] Example 2: Real-time fluorescence quantitative PCR analysis of the expression characteristics of the MsPYL9 gene

[0053] The germination and hydroponic culture of alfalfa seeds were the same as in Example 1. The stress treatment was performed on 12-day-old alfalfa seedlings:

[0054] Drought treatment: Mannitol was added to the MS hydroponic nutrient solution to a final concentration of 400 mM, and the treatment time was 0, 1, 3, 6, 12 and 24 h. The samples were quickly sampled, frozen in liquid nitrogen, and stored at -80 °C for later use.

[0055] Plant hormone abscisic acid treatment: plant hormone abscisic acid was added to the MS hydroponic nutrient solution to a final concentration of 80 μM, and the treatment time was 0, 1, 3, 6, 12 and 24 h. The samples were quickly sampled, frozen in liquid nitrogen, and stored at -80°C for later use.

[0056] The sample RNA extraction and reverse transcription cDNA method are the same as in Example 1. The cDNA is diluted to 50 ng / μL. The sample is amplified and the target gene is detected using qRTMsPYL9-F (5'-3'): GACACAGTACATAAGAAGACATCAC (SEQ ID No: 5) and qRTMsPYL9-R (5'-3'): CTAGAGACCAAACAAGATG AACTG (SEQ ID No: 6), and MsACTIN-F (5'-3'): GACAATGGAACTGGAATGG and MsACTIN-R (5'-3'): CAATACCGT GCTCAATGG are used as internal references.

[0057] The total volume of the qRT-PCR detection system was 10 μL, and the system was 2×SYBR qPCR Mix 5 μL, cDNA 1 μL, primer qRTMsPYL9-F 0.2 μL, primer qRTMsPYL9-R 0.2 μL, RNase-Free ddH 2 O 3.6μL. The reaction procedure is: first round: 94℃ pre-denaturation for 3min; second round: 94℃ denaturation for 10s, 60℃ annealing for 30s, second round cycle 40 times, the reaction is completed.

[0058] The instrument was Bio-Rad CFX96 real-time fluorescence quantitative PCR instrument, and the plotting software was Origin 2022. The method for calculating relative expression was 2 -△△Ct Method. △△Ct=(Ct 目的基因 -Ct 内参基因 )Time x-(Ct 目的基因 -Ct 内参基因 )Time 0; Timex represents the adversity treatment time, where x represents 1, 3, 6, 12 or 24 hours. Time 0 means no adversity treatment.

[0059] The experimental results are as follows Figure 2 shown.

[0060] The above results showed that the MsPYL9 gene was induced by mannitol and abscisic acid in both the aboveground and underground parts of alfalfa, indicating that the gene level of MsPYL9 was affected under adverse conditions, but the degree of influence aboveground and underground was different.

[0061] Example 3: Analysis of subcellular localization of MsPYL9 protein

[0062] 1. Material Preparation

[0063] The plant material in this example is Nicotiana benthamiana. Under normal conditions, healthy and plump seeds are soaked in distilled water in a centrifuge tube for 2 hours, and 2-3 seeds are scattered in each hole in the plug tray. After 6-7 weeks, the tobacco can be infected.

[0064] 2. Construction of subcellular vectors

[0065] Primers MsPYL9-GFP-F and MsPYL9-GFP-R were designed according to the sequence of the MsPYL9 gene, and Xho I and Spe I restriction sites were introduced at the 5' end of the primers, respectively: MsPYL9-GFP-F (5'-3'): CCCTCGAGATGAACAACGGTTGTGAACAA (SEQ ID No: 7), MsPYL9-GFP-R (5'-3'): GGACTAGTCCTGGGTTGATATTGATAGGATC (SEQ ID No: 8).

[0066] The cDNA of alfalfa in Example 1 was used as a template and PCR amplification was performed using MsPYL9-GFP-F and MsPYL9-GFP-R. The total volume of the PCR amplification system was 50 μL, including 10 μL of 5×Phusion HF Buffer, 1 μL of cDNA, 4 μL of 2.5 mM dNTP, 0.5 μL of Phusion DNA Polymerase, and ddH2 O 32.5μL, primer MsPYL9-GFP-F 1μL and primer MsPYL9-GFP-R 1μL. The reaction procedure is as follows: first round: 98℃ pre-denaturation for 30s; second round: 98℃ denaturation for 10s, 54℃ annealing for 30s, 72℃ extension for 10s, 35 cycles of the second round; third round: 72℃ extension for 5min; 4℃ termination, the reaction is complete.

[0067] The result of electrophoresis in 1.5% agarose gel was 588 bp in length. The PCR amplification product was recovered and purified: the PCR product was digested with restriction endonucleases Xho I and Spe I, and the size of the digested product was 577 bp; similarly, the pBI121-GFP expression vector was digested with restriction endonucleases Xho I and Spe I, and the size of the digested product was 14 kb.

[0068] The digested product of the target gene and the digested product of the pBI121-GFP expression vector were connected with DNA ligase (Takara, catalog number: 6022). The heat shock ligation product was transferred into E. coli DH5α competent cells and cultured overnight in a 37°C incubator. The appropriate positive clone plaques were detected and selected for sequencing. The positive clone colony with the MsPYL9 sequencing sequence completely consistent with its CDS sequence was selected to extract the plasmid and transferred into Agrobacterium EHA105 to obtain recombinant Agrobacterium EHA105 / pBI121-Pro35S:MsPYL9:GFP. The bacterial solution was evenly mixed with 50% glycerol in a volume ratio of 1:1, quick-frozen in liquid nitrogen, and stored at -80°C for later use.

[0069] Take the recombinant Agrobacterium EHA105 / pBI121-Pro35S:MsPYL9:GFP from -80°C and place it on ice. Pick out some frozen bacterial blocks and add them to 3 mL LB liquid. The resistance is rifampicin (Rif) and Kan. Shake in a shaker at 28°C and 200 rpm for 24 h.

[0070] Take 50 μL of bacterial solution and add it to 100 mL of LB liquid, with resistance to Rif and Kan, shake it in a shaker at 28°C and 200 rpm for 16-20 hours until OD 600 =0.5-1.

[0071] Take part of the bacterial solution and centrifuge it at 4500g for 15 min. Pour away the LB liquid and resuspend and dilute it with MS resuspension solution to OD 600 =0.4-0.6, resuscitated at 28°C and 120rpm for 2-3h, then injected into tobacco leaves.

[0072] Transform tobacco leaves by injection: Water the tobacco leaves with plenty of water the day before injection and culture them under light for 2-3 hours to keep them healthy and plump. Use a 1mL syringe to inject the bacteria into the leaves from the back of the tobacco leaves without veins. Do not have too many injection holes on the leaves. After injection, keep them in the dark for 24 hours, then grow them under light for 24-48 hours before slicing and observing. Use a fluorescence microscope or a laser confocal microscope.

[0073] Observation method: Take a small piece of healthy leaf near the injection hole and place it on a slide. Observe it under a fluorescence microscope first. If it is expressed, take a picture with a confocal microscope. Use tobacco transfected with plasma membrane marker (PM, RFP) as a positive control.

[0074] The results are as follows Figure 3 As shown, from left to right are the GFP fluorescence image of MsPYL9, the fluorescence image of the plasma membrane marker, the bright field image, and the overlap image.

[0075] The above results showed that the MsPYL9 gene was located in the cytoplasm and cell membrane.

[0076] Example 4: Application of MsPYL9 in improving stress resistance of Arabidopsis

[0077] It should be noted that Arabidopsis thaliana was used as a model plant to conduct functional analysis and verification of the MsPYL9 gene, and the conclusions can be considered equivalent to the molecular mechanism by which MsPYL9 in alfalfa regulates plant response to drought.

[0078] The experimental operation includes the following steps:

[0079] 1. Preparation of MsPYL9-overexpressing Arabidopsis

[0080] 1. Construction of recombinant vector

[0081] (1) Cloning of MsPYL9 gene

[0082] Primers MsPYL9-F and MsPYL9-R were designed according to the sequence of the MsPYL9 gene, and BamH I and Sac I restriction sites were introduced at the 5' end of the primers, respectively: MsPYL9-F (5'-3'): GCGGATCCATGAACAACGGTTGTGAACAA (SEQ ID No: 3), MsPYL9-R (5'-3'): GCGAGCTCTTATGGGTTGATATTGATAGG (SEQ ID No: 4).

[0083] The cDNA of alfalfa in Example 1 was used as a template and PCR amplification was performed using MsPYL9-F and MsPYL9-R. The total volume of the PCR amplification system was 50 μL, including 10 μL of 5×Phusion HF Buffer, 1 μL of cDNA, 4 μL of 2.5 mM dNTP, 0.5 μL of Phusion DNA Polymerase, and ddH 2 O 32.5μL, primer MsPYL9-F 1μL and primer MsPYL9-R 1μL. Amplification conditions were as follows: first round: 98℃ pre-denaturation for 30s; second round: 98℃ denaturation for 10s, 54℃ annealing for 30s, 72℃ extension for 10s, 35 cycles in the second round; third round: 72℃ extension for 5min; 4℃ termination, the reaction was complete.

[0084] (2) Enzyme digestion of MsPYL9 gene and expression vector

[0085] The results of electrophoresis in 1.5% agarose gel were used to detect the length of the target gene, which was 589 bp. The DNA fragment of the gene was recovered and double-digested with the expression vector pBI121. The restriction sites were BamH I and Sac I. The restriction results were confirmed by gel electrophoresis, and the product was then recovered using the EasyPure gel recovery kit (EG101, Beijing Quanshijin Biotechnology Co., Ltd.).

[0086] (3) Ligation of MsPYL9 gene and expression vector

[0087] Using T 4 DNA ligase (M0202, New England Biolabs Beijing Co., Ltd.), the target fragment after enzyme digestion was connected to the expression vector, transferred into Escherichia coli DH5α competent cells, evenly coated on LB resistance plates containing Kan, cultured overnight in a 37°C incubator, detected and selected appropriate positive clone plaques, picked into liquid culture medium containing Kan resistance, and cultured overnight in a 37°C shaker at 200rpm. After the bacterial liquid was detected to be appropriate, it was sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. The positive clone colony with a completely consistent CDS sequence of the MsPYL9 gene was obtained to extract the plasmid.

[0088] (4) Obtaining recombinant Agrobacterium

[0089] The recombinant pBI121-Pro35S:MsPYL9 vector was used to transform Agrobacterium tumefaciens EHA105 to obtain recombinant Agrobacterium tumefaciens EHA105 / pBI121-Pro35S:MsPYL9. The bacterial solution was mixed with 50% glycerol at a volume ratio of 1:1, quick-frozen in liquid nitrogen, and stored at -80°C for later use.

[0090] 2. MsPYL9 overexpression in Arabidopsis

[0091] The recombinant Agrobacterium was taken out from -80°C and placed on ice. Some of the frozen bacterial blocks were picked and placed in 3 mL of LB liquid with resistance to Rif and Kan, and shaken at 28°C and 200 rpm for 24 h.

[0092] Take 2 mL of bacterial solution and add it to 200 mL of LB liquid, with resistance to Rif and Kan, shake at 28°C and 200 rpm for 20-24 hours until OD 600 =1.2-2.0.

[0093] Take part of the bacterial solution and centrifuge it at 4500g for 15 min. Pour away the LB liquid, resuspend it with 5% sucrose and dilute it to OD 600 =0.8 flowers are soaked in the infection liquid.

[0094] Soak the inflorescence of Arabidopsis thaliana (Colombia ecotype Col-0) (the fruit pods can be cut off two days before to improve transfection efficiency) in the invasion dye solution for 3-5 seconds; after soaking, take out the flower pot, keep it in the dark for 24 hours, and continue to culture in the greenhouse. Infect for the second time one week later.

[0095] Harvest T 1 The positive plants were screened with Kan (50 mg / mL) and subcultured until T 3 The homozygous strains were generated. 2 Representative T 1 The seeds produced by self-pollination and the plants grown from the seeds, T 3 Representative T 2 The seeds produced by self-pollination and the plants grown from the seeds.

[0096] T 3 The whole plant DNA of the regenerated plant was used as a template for PCR amplification using the target gene primers 35S-F (5'-3'): CTATCCTTCGCAAGACCCTT (SEQ ID No: 9) and MsPYL9-R (5'-3'): GCGAGCTCTTATGGGTTGATATTGATAGG (SEQ ID No: 4), and Kan primers NPTII-F (5'-3'): CAATCCACATCGGCCAGAT (SEQ ID No: 10) and NPTII-R (5'-3'): AGCTGCCTGTTCCAAAGG (SEQ ID No: 11). The PCR detection system and amplification conditions of the target gene and Kan gene were the same. The PCR detection system was as follows: the total volume of PCR was 20 μL, including 2×F8 PCR MasterMix 10 μL, upstream primer 1 μL, downstream primer 1 μL, ddH2 O 6μL and DNA template (50ng / μL) 2μL; amplification conditions were: (1) 94℃ pre-denaturation for 4min; (2) 94℃ denaturation for 30s; (3) 52℃ annealing for 30s; (4) 72℃ extension for 10s; (5) 2-4 steps for 35 cycles; (6) 72℃ extension for 5min.

[0097] The results are as follows Figure 4 As shown in A. The results of this figure show that: T 3 The homozygous strains of the first generation amplified a single band at 658bp, and the amplified resistance gene Kan also had bands.

[0098] Randomly select strains to extract T 3 The whole plant RNA of the regenerated plants was reverse transcribed into cDNA as a template, and qRT-PCR amplification was performed using the target gene partial fragment primer pairs qRTMsPYL9-F and qRTMsPYL9-R, as well as the internal reference gene pair AtACTIN-F (5'-3') TTGTGCCAATCTACGAGGGTTT and AtACTIN-R (5'-3') TTTCCCGCTCTGCTGTTGT.

[0099] The qRT-PCR system included 2×SG Fast qPCR Master Mix 10 μL, primer qRTMsPYL9-F 0.5 μL, primer qRTMsPYL9-R 0.5 μL, DNF buffer 2 μL, ddH 2 O5μL and cDNA 2μL, the total volume is 20μL. The qRT-PCR amplification conditions are: (1) 95℃ pre-denaturation for 10min; (2) 95℃ denaturation for 15s; (3) 60℃ annealing for 1min; (4) steps (2) to (3) are cycled 40 times.

[0100] The results are as follows Figure 4 As shown in B. The results showed that MsPYL9 was not expressed in the wild-type strain (Col-0), but was expressed to varying degrees in the overexpression homozygous strains. Three high-expression strains were selected from the homozygous strains for subsequent physiological analysis.

[0101] 2. Evaluation of stress resistance of transgenic plants

[0102] 1. Evaluation of the water loss resistance of transgenic plants

[0103] (1) Effect of drought stress on germination rate

[0104] T 3After disinfection, 50 seeds of each of three representative homozygous lines of MsPYL9-overexpressing Arabidopsis thaliana, OE3, OE11, OE12, and wild type Col-0, were evenly spotted on MS medium and MS medium containing 400mM and 500mM mannitol using a 10μL pipette tip, sealed with a sealing film, and treated at 4℃ for 3d. They were then moved into an incubator at 22℃, 16h light / 8h dark, and 60% relative humidity for 7d. The germination rate was counted every day, and three biological replicates were set for each treatment. The results were averaged and the standard deviation was calculated.

[0105] The results are as follows Figure 5 As shown: This figure compares the germination of wild-type and overexpression strains in MS medium and MS medium containing 400mM and 500mM mannitol. The results show that on MS plates, the germination rate and germination speed of wild-type and overexpression strains are basically the same; while on 400mM and 500mM mannitol plates, the germination rate and germination speed of MsPYL9 overexpression Arabidopsis strains are significantly greater than those of wild-type.

[0106] (2) Effect of soil dehydration on resistance of transgenic plants

[0107] Plant material is T 3 Three representative homozygous strains of Arabidopsis thaliana overexpressing MsPYL9, OE3, OE11, OE12 and wild type Col-0, were generated. After the seeds of each strain were sterilized, healthy and plump seeds were selected and evenly dotted on the culture medium with a 10 μL pipette tip, sealed with a sealing film, and moved into an incubator at 22°C, 16 h light / 8 h dark, and 60% relative humidity for 14 days after vernalization. The seedlings were moved to small square pots, with 6 seedlings in each pot. The soil in each pot had the same weight and absorbed water to saturation and then cut off the water. The dehydration treatment was carried out for 35 days, and then rehydrated. During this period, the plant phenotype was continuously observed and photographed.

[0108] Figure 6 T 3 The growth of the homozygous strains OE3, OE11, OE12 and the wild-type strain WT during the dehydration treatment and three days after rehydration was compared. The results showed that as the degree of dehydration increased, the growth of the wild type was significantly weaker than that of the overexpression strain; after rehydration, the survival rate of the wild type was lower than that of the overexpression strain. Therefore, the method provided in this application can enhance the drought resistance of Arabidopsis, which can also be extended to the method being able to enhance the drought resistance of alfalfa.

[0109] Example 5: Application of MsPYL9 in improving stress resistance of alfalfa

[0110] 1. Preparation of MsPYL9-overexpressing alfalfa

[0111] 1. Construction of recombinant vector

[0112] The recombinant vector is the same as that used in the preparation of MsPYL9 overexpression Arabidopsis.

[0113] 2. Obtaining MsPYL9-overexpressing alfalfa

[0114] Take out the recombinant Agrobacterium from -80℃ and place it on ice. The recombinant Agrobacterium is EHA105 / pBI121-Pro35S:MsPYL9. Pick out some frozen bacterial blocks and put them in 3mL LB liquid. The resistance is Rif and Kan. Shake at 28℃ and 200rpm for 24h.

[0115] Take 0.5mL of bacterial solution and add it to 200mL LB liquid, with resistance to Rif and Kan, shake at 28℃ and 200rpm for 15h until OD 600 =0.6-0.8.

[0116] Take part of the bacterial solution and centrifuge it at 4500g for 15 min. Pour away the LB liquid and resuspend and dilute it with SM4 liquid to OD 600 =0.2-0.4 infection solution. Wash and disinfect the alfalfa leaves, soak them in the infection solution, vacuum for 10 minutes, ultrasonically clean for 3-5 minutes, and vacuum again for 10 minutes.

[0117] After infection, the leaves were aired until there was no obvious moisture on the surface, placed in SM4 solid culture medium for dark culture for 2-3 days, transferred to SM4 selective culture medium containing cephalosporin (Cef, 200 mg / mL), ticarcillin disodium / clavulanate potassium (Tim, 200 mg / mL) and kanamycin (Kan, 50 mg / mL), subcultured every 14 days, and selectively cultured for 4-6 weeks.

[0118] The resistant callus was transferred to MSBK medium containing cephalosporin (Cef, 200 mg / mL), ticarcillin disodium / clavulanate potassium (Tim, 200 mg / mL) and kanamycin (Kan, 50 mg / mL), subcultured every 14 days and cultured for about 4 weeks, with the appearance of obvious resistant buds as the standard.

[0119] The embryonic callus with differentiated buds was transferred to SH9 medium containing cefotaxime (Cef, 200 mg / mL), ticarcillin disodium / clavulanate potassium (Tim, 200 mg / mL) and kanamycin (Kan, 50 mg / mL), subcultured every 3-4 weeks, and cultured for 8-12 weeks, with the differentiated buds growing normal three leaves and partial rooting as the standard. The rooted seedlings were transferred to MS0 medium and cultured for 6-8 weeks. After strong roots grew, they could be transplanted.

[0120] The regenerated plants were screened positively and the expression level was identified. The specific method was the same as the screening and identification method for Arabidopsis plants. Positive plants with higher expression levels were selected for subsequent experiments.

[0121] 2. Evaluation of water loss rate of detached leaves of transgenic alfalfa

[0122] Five to six three-leaf leaves of similar size and tenderness were collected from alfalfa plants growing in the same vigor, weighed immediately, and then placed on a laboratory bench and weighed every 1 hour for a total of 8 hours. At least 3 biological replicates were set for each strain. The relative water loss was calculated based on the initial weight of the leaf, and the leaf Time x water loss rate = (leaf Time 0 weight - leaf Time x weight) / leaf initial weight × 100%, Time x represents the in vitro time 1-8 hours, and the Time 0 water loss rate of each leaf is set to 0.

[0123] Figure 7 Comparison of water loss rate of detached leaves between overexpressed (OE) and wild type (WT) alfalfa. The results showed that after the leaves were placed in vitro for 8 hours, the OE strain retained more water than the WT, indicating that overexpression of the MsPYL9 gene changed the epidermal permeability of alfalfa leaves and enhanced the water retention capacity of alfalfa under adverse conditions.

[0124] 3. Evaluation of soil drought phenotype of transgenic alfalfa

[0125] The drought tolerance of transgenic alfalfa in the late developmental seedling stage was evaluated. Peat soil and vermiculite (volume ratio 3:1) were mixed evenly, placed in seedling pots of the same size and weighed to ensure that the weight of the soil matrix in each pot was consistent. Two-month-old overexpression and wild-type cuttings were selected and moved to separate seedling pots. Six pots were repeated for each strain. After 5 days of normal growth, the soil was absorbed to saturation with water and drought treatment was started. During the drought process, the phenotype was recorded by taking photos; when the leaves of the plants were severely wilted, water was re-watered, and the survival rate of the plants was counted 7 days after re-watering.

[0126] The results are as follows Figure 8 As shown in the figure, before drought treatment, there was no significant difference in the growth status of OE strains and WT plants; after 28 days of drought treatment, most of the leaves of WT plants turned yellow and dried up, while only a few leaves of OE plants turned yellow. After 5 days of rehydration, the leaves of the overexpression strains resumed growth, while the leaves of WT plants remained yellow or even died.

[0127] In continuation of the above, the present application provides a MsPYL9 protein with drought tolerance function. First, the expression of the MsPYL9 gene is determined by qRT-PCR experiments to be induced by drought stress. Then, after the MsPYL9 gene is overexpressed in Arabidopsis, it is found that the overexpressed Arabidopsis has stronger drought resistance than the wild-type Arabidopsis; the water loss rate of detached leaves is analyzed in alfalfa, and it is found that the leaves of overexpressed alfalfa retain more water than the leaves of wild-type plants under drought conditions; the soil drought phenotype is evaluated in alfalfa, and it is found that the overexpressed alfalfa grows better than the wild-type plants under drought conditions, and can recover to a good state after rehydration. Therefore, the study of drought resistance of the MsPYL9 gene provides a new gene resource for the molecular design breeding of drought resistance in alfalfa, which has reference and reference significance for the cultivation and acquisition of drought-resistant plants and new varieties with enhanced functions.

[0128] In summary, the coding gene cloned from the legume plant alfalfa in this application increases in expression under the induction of drought and plant hormone abscisic acid, and the encoded protein is localized to the cytoplasm and cell membrane; after the coding gene is transferred into the plant, the drought resistance of the target plant can be improved. The drought-resistant protein obtained after encoding is conducive to the cultivation of plant varieties with stronger stress resistance or the transformation of stress resistance of other plants.

[0129] The stress resistance gene and drought-resistant protein provided in this application provide ideas and methods for studying related drought-resistant regulatory genes, and have important reference and reference significance for cultivating and obtaining drought-resistant plants (such as Arabidopsis, tobacco or legumes). The PYL9 gene mentioned in this application can improve the stress resistance of plants in species such as corn (Zea mays), rice (Oryza sativa), and wheat (Triticum aestivum). This application is conducive to cultivating or enhancing drought-tolerant alfalfa, expanding the scale of alfalfa production and planting, and accelerating the development of the animal husbandry industry.

[0130] The sequence information involved is as follows.

[0131]

[0132]

[0133] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Use of biological materials in improving plant stress resistance or preparing products for improving plant stress resistance, characterized in that: The biological material includes any one of the following: (1) MsPYL9 protein, the amino acid sequence of which is at least 80% identical to the sequence shown in SEQ ID NO:1; (2) an isolated nucleic acid molecule encoding the MsPYL9 protein; (3) a vector containing the isolated nucleic acid molecule; (4) A recombinant cell or recombinant bacterium containing the vector.

2. The use according to claim 1, characterized in that: The stress resistance includes drought resistance.

3. The use according to claim 1, characterized in that: The plants include: any one or more of Arabidopsis, tobacco and leguminous plants; Optionally, the legume comprises alfalfa.

4. The use according to claim 1, characterized in that: The nucleotide sequence of the isolated nucleic acid molecule has at least 80% identity with the sequence shown in SEQ ID NO:

2.

5. A method for improving plant stress resistance, characterized in that: It includes: Increase the expression level of MsPYL9 gene in target plants; The amino acid sequence of the protein encoded by the MsPYL9 gene has at least 80% identity with the sequence shown in SEQ ID NO:

1.

6. The method according to claim 5, characterized in that The stress resistance includes drought resistance.

7. The method according to claim 5, characterized in that The plants include: any one or more of Arabidopsis, tobacco and leguminous plants; Optionally, the legume comprises alfalfa.

8. The method according to any one of claims 5 to 7, characterized in that: The expression level includes protein expression level and / or gene expression level.

9. The method according to any one of claims 5 to 7, characterized in that: The step of increasing the protein activity and / or expression level of the MsPYL9 protein in the target plant comprises: inserting a nucleic acid molecule encoding the MsPYL9 protein into the genome of the target plant; Optionally, the method further comprises: artificially cultivating transgenic plant seeds obtained by inserting the nucleic acid molecule encoding the MsPYL9 protein into the genome of the target plant or allowing the transgenic plant seeds to grow naturally.

10. The method according to claim 9, characterized in that The nucleotide sequence of the nucleic acid molecule encoding the MsPYL9 protein has at least 80% identity with the sequence shown in SEQ ID NO:2.

Images