Application of OsATS3 gene in regulation and control of rice flooding stress tolerance

Abstract

The invention discloses an application of an OsATS3 gene in regulation and control of rice flooding stress tolerance. According to the invention, an OsATS3 gene is constructed to edit a knockout vector, an agrobacterium tumefaciens-mediated method is adopted to transform rice calluses, and a knockout strain of the OsATS3 gene is obtained through screening, and the knockout strain of the OsATS3 gene shows a phenotype that after seeds germinate under a waterflooding condition, seedling root systems are developed, seedling growth of overground parts of seedlings is faster, the growth speed of first leaves is faster, and the seedling rate is high; the method has great significance in solving the problems of slow seedling growth, inhibited radicle development, low seedling rate and the like in the rice direct seeding process, and has a wide application prospect in plant breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to the application of OsATS3 gene in regulating rice waterlogging stress tolerance. Background Art

[0002] Rice is one of the most important food crops in the world. With the shortage of rural labor and rising labor costs, rice production is shifting from transplanting to direct seeding. The area of ​​direct seeding rice in Guangdong Province has exceeded 100,000 hm2 2 , and it has grown rapidly, gradually spreading from western Guangdong to all parts of the province. However, the main rice varieties now promoted are mostly transplanted varieties, and direct-seeding varieties are extremely scarce. Although varieties suitable for direct-seeding have been selected from transplanted varieties, there are limitations. These varieties are directly used for direct-seeding, resulting in unstable yields and perennial yield reductions. Seed germination is difficult under flooded and low-oxygen conditions, and low seedling rate is one of the important factors affecting rice yield. At present, not many hypoxia-resistant germination genes have been cloned, and excellent genes are even rarer, which limits the development of the rice industry. Summary of the invention

[0003] In order to overcome the above-mentioned defects and shortcomings of the prior art, the present invention provides an application of the OsATS3 gene in regulating the root growth, aboveground seedling length growth, first leaf growth rate and seedling rate of rice seedlings after germination under flooding conditions. The present invention obtains homozygous plants with OsATS3 gene knockout by gene knockout. Compared with the wild type, the seedlings after germination of OsATS3 gene knockout seeds show a phenotype of developed root system, faster growth of aboveground seedling length, faster growth rate of first leaf and higher seedling rate.

[0004] The first object of the present invention is to use the OsATS3 gene in regulating rice waterlogging stress tolerance, wherein the OsATS3 gene is a gene encoding a protein having an amino acid sequence as shown in SEQ ID NO.2.

[0005] Preferably, the nucleotide sequence of the OsATS3 gene is as shown in SEQ ID NO.1.

[0006] Preferably, the application is the application of knocking out the OsATS3 gene to promote root growth of rice seedlings under flooding conditions.

[0007] Preferably, the application is the use of knocking out the OsATS3 gene to promote the growth of the aboveground part of rice seedlings under flooding conditions.

[0008] Preferably, the application is the application of knocking out the OsATS3 gene to accelerate the growth of the first leaf of rice seedlings under flooding conditions.

[0009] Preferably, the application is the application of knocking out the OsATS3 gene to improve the rice seedling rate under flooding conditions.

[0010] Preferably, the knockout of OsATS3 gene is by knocking out OsATS3 gene through CRISPR / Cas9 technology, and the nucleotide sequence of its specific target is shown in SEQ ID NO.3 or SEQ ID NO.4.

[0011] The second object of the present invention is to provide a method for obtaining improved rice with developed seedling root system, fast growth of aboveground seedling length, fast growth rate of first leaf and high seedling rate under flooding conditions, comprising the step of knocking out the OsATS3 gene; the OsATS3 gene is a gene encoding a protein with an amino acid sequence as shown in SEQ ID NO.2.

[0012] Preferably, the nucleotide sequence of the OsATS3 gene is as shown in SEQ ID NO.1.

[0013] Preferably, the knockout of OsATS3 gene is to knock out OsATS3 gene by CRISPR / Cas9 technology, and the nucleotide sequence of its specific target is shown in SEQ ID NO.3 or SEQ ID NO.4.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The OsATS3 gene of the present invention and its encoded protein can be used to regulate the root development of seedlings, the growth of the aboveground length of seedlings, the growth of the first leaf and the seedling rate after germination of rice seeds under flooding conditions. The OsATS3 gene knockout strain exhibits a phenotype of a well-developed root system of seedlings, faster growth of the aboveground length of seedlings, faster growth of the first leaf and a high seedling rate under flooding conditions. Therefore, the present invention can provide genetic resources for solving the problems of slow seedling growth, inhibited radicle development and low seedling rate during direct seeding of rice seeds, as well as for cultivating new rice varieties. The present invention is of great significance for solving the problems of slow seedling growth, inhibited radicle development and low seedling rate during direct seeding of rice seeds, and has broad application prospects in plant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Shown are the mutation types and sequencing peak diagrams of OsATS3 gene knockout plants.

[0017] Figure 2 These are the actual pictures of WT, osats3-2, and osats3-3 rice seeds after germination for 4 days under 2 cm water flooding conditions.

[0018] Figure 3 These are the actual pictures of WT, osats3-2, and osats3-3 rice seeds after germination for 6 days under 2 cm water flooding conditions.

[0019] Figure 4 This is the biostatistical analysis result of the root length and aboveground seedling length of WT, osats3-2, and osats3-3 rice seeds after germination for 6 days under 2 cm water flooding conditions.

[0020] Figure 5 These are actual pictures of WT, osats3-2, and osats3-3 rice seeds after germination for 10 days under 7 cm water flooding conditions; among them, A is the state of representative rice seeds of WT, osats3-2, and osats3-3 after germination for 10 days under 7 cm water flooding conditions, and B is the overall state of WT, osats3-2, and osats3-3 rice seeds after germination for 10 days under 7 cm water flooding conditions.

[0021] Figure 6 This is a statistical graph of the seedling rate of WT, osats3-2, and osats3-3 rice seeds after germination for 10 days under 7 cm water flooding conditions; *** indicates that the seedling rate of the OsATS3 gene knockout strain is significantly different from that of the WT at the level of p<0.001. DETAILED DESCRIPTION

[0022] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0023] OsATS3 is an embryo-specific protein (Embryo-specific protein 3), but it is also expressed in other rice tissues. Its amino acid sequence contains PLAT (Polycystin-1, Lipoxygenase, Alpha-Toxin) DOMAIN, which has not been reported in the literature so far, and its function is still unclear. The following examples obtain homozygous plants with OsATS3 gene knockout by gene knockout. Compared with the wild type, the OsATS3 knockout plants show a phenotype of well-developed seedling root system, faster growth of the aboveground seedling length, faster growth of the first leaf, and high seedling rate when treated with flooding germination.

[0024] Example 1: Construction of OsATS3 gene knockout vector and acquisition of rice gene knockout plants

[0025] The CRISPR / Cas9 genome editing system was used to edit the OsATS3 gene in wild-type rice (Zhonghua 11) to obtain gene knockout plants. The specific method is as follows.

[0026] The exon sequence of the target gene OsATS3 (whose CDS sequence is shown in SEQ ID NO.1, with a total length of 543 bp, and the protein encoded by the amino acid sequence is shown in SEQ ID NO.2, with 180 amino acids) was analyzed using the CRISPR P v2.0 website (http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR / CRISPR), and two specific target sequences were selected, namely target 1: ACAATGTCGCCGTCCGCGCCGG (SEQ ID NO.3); target 2: GCGTACCGGAACGAGGCGTACGG (SEQ ID NO.4). Two expression cassettes connected to sgRNA were obtained by overlapping PCR, namely U6a-target 1-sgRNA and U3-target 2-sgRNA. The two expression cassettes were connected to the pYLCRISPR / Cas9Pubi-H vector by taking advantage of the non-overlapping cleavage site and recognition site of the BsaI enzyme to generate the pCRISPR-OsATS3 vector containing the OsATS3 specific target, and then transformed into Agrobacterium EHA105 competent cells. After the plasmids were extracted from the positive clones, they were sent to the company for sequencing, and the pCRISPR-OsATS3 plasmid with the correct result was selected to infect rice callus tissue with Agrobacterium to screen the tissues with successful knockout of the OsATS3 gene, and regenerate gene-edited plants.

[0027] 2. Obtaining homozygous strains of OsATS3 gene knockout

[0028] The total genomic DNA of a single T0 transgenic plant was extracted and used as a template to perform PCR amplification of the nucleotide sequence containing target sites 1 and 2 using primers located at both ends of the specific target site of the above-mentioned OsATS3 gene (07890-T12-F: GTGGGTGTTCGTTGCAGGAG, SEQ ID NO.5; 07890-T12-R: TAGAGGTAGCAGACGCCGTAC, SEQ ID NO.6). The amplified product with a single and clear target band was recovered and sent to the company for sequencing. After sequencing, the sequencing results were decoded and analyzed using the DSDecodeM website (http: / / skl.scau.edu.cn / dsdecode / ), and two homozygous OsATS3 gene knockout strains osats3-2 and osats3-3 with different independent mutation sites were selected (the sequencing results of the knockout strains are shown in the figure). Figure 1 The subsequent experiments were performed as shown.

[0029] Example 2: Germination analysis test of rice seeds of OsATS3 knockout strain in 2 cm deep water

[0030] The seeds of wild-type rice plants WT, OsATS3 knockout lines osats3-2, and osats3-3 were placed in transparent square germination boxes, 200 mL of distilled water was added, the water depth was 2 cm, and they were placed in a 28°C incubator with a light / dark setting of 12h / 12h, and the water was changed every 2 days. Thirty rice seeds were placed in each germination box, repeated 3 times, and the germination of the seeds was observed regularly. After germination for 4 days under flooding conditions, the root length of the seeds of the gene-edited lines was significantly longer than that of the wild type ( Figure 2 ). After germination for 6 days under flooding conditions, the first leaf of osats3-2 and osats3-3 had grown, and the average length of the aboveground seedlings was 8.0 cm and 9.0 cm, and the root length continued to elongate, with an average root length of 6.4 cm and 6.7 cm. The first leaf of the wild type had not grown, and the roots had just begun to sprout, with an average root length of 0.8 cm ( Figure 3 ). The statistical data of root length and aboveground length of osats3-2, osats3-3 and wild type WT at 6 days of germination under flooding conditions are shown in Figure 4 shown.

[0031] Example 3: Germination analysis test of rice seeds of OsATS3 knockout strain in 7 cm deep water

[0032] The seeds of wild-type rice plants WT, OsATS3 gene knockout strains osats3-2, and osats3-3 were placed in transparent culture bottles, 280 mL of distilled water was added, the water depth was 7 cm, and they were cultured in a 28°C incubator with a light / dark period of 12h / 12h, and the distilled water was changed every 2 days. 20 rice seeds were placed in each culture bottle, and the distilled water was changed every 3 days. After germination for 10 days under flooding conditions, the seedling rate was counted, and the calculation formula was: Seedling rate = number of seeds that can germinate and can normally seedling / total number of seeds. The experimental results showed that after germination for 10 days under 7 cm deep flooding conditions, the leaf and root development of OsATS3 gene knockout strains osats3-2 and osats3-3 were better than that of wild-type plants WT, while WT was mostly deformed seedlings with abnormal root development ( Figure 5 The seedling rate of the wild type was only 48%, while that of osats3-2 and osats3-3 reached 92% and 90%, respectively. The seedling rates of the OsATS3 gene knockout strains osats3-2 and osats3-3 were significantly higher than those of the wild type ( Figure 6 ).

Claims

1. Application of OsATS3 gene in regulating waterlogging stress tolerance in rice, characterized in that: The OsATS3 gene is a gene encoding a protein with an amino acid sequence as shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the OsATS3 gene is shown in SEQ ID NO.

1.

3. The use according to claim 1, characterized in that: To knock out the OsATS3 gene for application in promoting root growth of rice seedlings under flooding conditions.

4. The use according to claim 1, characterized in that: To knock out the OsATS3 gene for application in promoting the growth of aboveground seedling length of rice seedlings under flooding conditions.

5. The use according to claim 1, characterized in that: To knock out the OsATS3 gene for application in accelerating the growth of the first leaf of rice seedlings under flooding conditions.

6. The use according to claim 1, characterized in that: To knock out the OsATS3 gene for improving the rice seedling rate under flooding conditions.

7. The use according to claim 3, characterized in that: The knockout of OsATS3 gene is achieved by knocking out the OsATS3 gene through CRISPR / Cas9 technology, and the nucleotide sequence of the specific target is shown in SEQ ID NO.3 or SEQ ID NO.

4.

8. A method for obtaining improved rice with developed seedling root system, fast growth of aboveground seedling length, fast growth of first leaf and high seedling rate under flooding conditions, characterized in that: The method comprises the step of knocking out the OsATS3 gene; the OsATS3 gene is a gene encoding a protein having an amino acid sequence as shown in SEQ ID NO.

2.

9. The method according to claim 8, characterized in that The nucleotide sequence of the OsATS3 gene is shown in SEQ ID NO.

1.

10. The method according to claim 8, characterized in that The knockout of OsATS3 gene is to knock out OsATS3 gene by CRISPR / Cas9 technology, and the nucleotide sequence of its specific target is shown in SEQ ID NO.3 or SEQ ID NO.4.

Images