Gene detection kit for phenytoin medication guidance and use method

Abstract

The invention belongs to the technical field of phenytoin medication guidance, and particularly relates to a gene detection kit for phenytoin medication guidance and a use method, the gene detection kit comprises a primer and a probe for detecting HLA and CYP2C9 genes, a primer and a probe for monitoring internal control genes, a PCR reaction liquid, a positive quality control product and a negative quality control product, gene polymorphism sites detected by the kit comprise rs3909184 and rs2844682 sites of an HLA (human leukocyte antigen) gene and rs1057910 sites of a CYP2C9 gene, and the use method comprises the following steps: 1) taking a blood sample containing an EDTA (ethylene diamine tetraacetic acid) anticoagulant, and carrying out nucleic acid extraction; (2) premixing and subpackaging the gene detection reagent to obtain a PCR reaction system; (3) adding the DNA obtained in the step (1) into the PCR reaction system in the step (2), uniformly mixing, and carrying out PCR amplification; and 4) carrying out genotyping interpretation after the reaction is ended. The kit has the characteristics of high sensitivity, low cost, simplicity and convenience in operation, short detection period, intuitive interpretation and the like, and can be used for rapidly and accurately detecting the phenytoin individualized medication gene polymorphism.

Description

Technical Field

[0001] The invention belongs to the technical field of phenytoin medication guidance, and specifically relates to a gene detection kit for phenytoin medication guidance and a use method. Background Art

[0002] Phenytoin is the first choice drug for the treatment of major and partial seizures. It is suitable for the treatment of generalized tonic-clonic seizures, complex partial seizures (psychomotor seizures, temporal lobe epilepsy), simple partial seizures (localized seizures) and status epilepticus. It has high efficacy, no hypnotic effect, and no effect on normal activities. It is often used as the first choice drug. It is second to psychomotor seizures, ineffective for absence seizures (minor seizures), and sometimes even worsens the condition. It also has the effects of anti-arrhythmia, treatment of peripheral neuropathy and lowering blood pressure. However, phenytoin has obvious use dependence, and the therapeutic dose and toxic dose of blood drug concentration are very close. In clinical application, toxic side effects are large and adverse reactions are many. Because its blood drug concentration is 10mg / L, it can control epileptic seizures, and toxic reactions occur at 20mg / L. Therefore, its therapeutic window is very narrow, the safety range is small, and toxic reactions caused by excessive blood drug concentration are prone to occur. Its conventional dose is used to prevent tonic-clonic epileptic seizures and focal epileptic seizures. Common side effects include nausea, stomach pain, loss of appetite, poor coordination, hair growth and swollen gums. Serious side effects include drowsiness, liver problems, low blood pressure, Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN).

[0003] Currently, there is no genetic testing kit specifically for phenytoin medication guidance on the market. Most of the kits in the published patents are used for full detection of anti-epileptic drug sites, with redundant detection sites, and most of them cover more than 30 sites. There are a large number of sites for which clinical evidence is not clear, and the multi-site detection method is limited to expensive time-of-flight mass spectrometry and NGS sequencing, which brings unnecessary expenses to clinical patients. As a result, the current application of genetic testing for phenytoin medication guidance in clinical practice is poor and has been unable to meet clinical testing needs. Summary of the invention

[0004] In order to solve the problems in the prior art, the present invention provides a phenytoin medication guidance gene detection kit and a method of use based on ARMS technology and TaqMan fluorescent probe technology in view of the current clinical needs and the deficiencies of the prior art. The kit has the characteristics of high sensitivity, low cost, simple operation, short detection cycle, intuitive interpretation, etc., and can quickly and accurately detect the gene polymorphism of phenytoin individualized medication.

[0005] The present invention solves the technical problem by adopting the following technical solutions:

[0006] The present invention aims to provide a gene detection kit for guiding the use of phenytoin, comprising primers and probes for detecting HLA and CYP2C9 genes.

[0007] HLA (Human Leukocyte Antigen) is a protein molecule that exists on the surface of antigen-presenting cells and is responsible for antigen presentation. It is a sign of mutual recognition between immune cells of different individuals, the main genetic marker of the body's "distinguishing between friend and foe, identifying oneself, and excluding others", participates in immune response, and has very important biological functions.

[0008] CYP2C9 is a member of the cytochrome P450 superfamily, the main enzyme that metabolizes drugs in the human body, and is mainly found in the liver and intestines. It is estimated that CYP2C9 metabolizes more than 90% of phenytoin in the body. Therefore, compared with normal carriers of the CYP2C9 gene, defective carriers have a decreased clearance rate of phenytoin, causing phenytoin accumulation in the body. Even at conventional doses, it is easy to produce adverse reactions such as neurotoxicity and hepatotoxicity. So far, it has been found that CYP2C9 has multiple mutant alleles from CYP2C9*2 to CYP2C9*35, with wild-type CYP2C9*1 and mutant CYP2C9*2 and CYP2C9*3 being the most common. The mutation frequencies of CYP2C9*2 and CYP2C9*3 genes in different populations are different, and the differences are obvious. Among them, the mutation frequencies of CYP2C9*2 and CYP2C9*3 in the Chinese population are 0 and 4.1%, respectively.

[0009] Clinical studies in many regions have shown that the HLA-B*1502 allele is closely related to phenytoin-induced Stevens-Johnson syndrome and toxic epidermal necrolysis. Other studies have shown that the frequency of HLA-B*1502 allele expression in the Chinese Han population exceeds 11%. Therefore, it is very necessary for epilepsy patients to undergo HLA-B*1502 allele screening before using phenytoin. The "Guidelines for the Detection of Drug Metabolizing Enzymes and Drug Target Genes in China (Trial)" also clearly points out the necessity of testing whether the HLA-B*1502 gene is carried before taking phenytoin. The phenytoin dosage guidelines issued by the Clinical Pharmacogenomics Implementation Consortium (CPIC) recommend: For HLA-B*1502-negative people, the CYP2C9 genotype should be further tested, and for intermediate metabolizers and slow metabolizers, the starting dose of phenytoin should be administered at 75% and 50% of the conventional dose, respectively.

[0010] Furthermore, the gene polymorphism sites detected by the kit include rs3909184 and rs2844682 sites of the HLA gene and rs1057910 site of the CYP2C9 gene.

[0011] Further, the primer and probe sequences used to detect the rs3909184 site are:

[0012] 9184-WP probe (FAM-5'-3'-MGB): SEQ IQ NO.1;

[0013] TCCCACGTGTGCC;

[0014] 9184-MP probe (VIC-5'-3'-MGB): SEQ IQ NO.2;

[0015] TCCCACCTGTGCC;

[0016] 9184-F2: SEQ IQ NO.5;

[0017] GGTTCCCTCCTGTCTGCTTG;

[0018] 9184-R2: SEQ IQ NO.6;

[0019] GCTCAGTGCCCTCAAGGTAT;

[0020] The primer and probe sequences used to detect rs2844682 locus are:

[0021] 4682-WP probe (FAM-5'-3'-MGB): SEQ IQ NO.11;

[0022] CCAAGGGATTGGC;

[0023] 4682-MP probe (VIC-5'-3'-MGB): SEQ IQ NO.12;

[0024] CCAAGGAATTGGC;

[0025] 4682-F1: SEQ IQ NO.13;

[0026] AAATGGGTCAGGATGGGCTT;

[0027] 4682-R1: SEQ IQ NO.14;

[0028] CTCCTCCAGAACCACTCCCT;

[0029] The primer and probe sequences used to detect rs1057910 are:

[0030] 7910-WP probe (FAM-5'-3'-MGB): SEQ IQ NO. 21;

[0031] AGATACATTGACC;

[0032] 7910-MP probe (VIC-5'-3'-MGB): SEQ IQ NO. 22;

[0033] AGATACCTTGACC;

[0034] 7910-F2: SEQ IQ NO.25;

[0035] CATGCAAGACAGGAGCCACA;

[0036] 7910-R2: SEQ IQ NO.26;

[0037] GAATTTAATGTCACAGGTCACTGC.

[0038] Furthermore, the kit also includes primers and probes for monitoring an internal control gene, and the internal control gene is GAPDH.

[0039] Furthermore, the primer and probe sequences used to detect the internal control gene GAPDH are:

[0040] GAPDH-F: SEQ IQ NO.31;

[0041] GGCCACTAGGCGCTC;

[0042] GAPDH-R: SEQ IQ NO.32;

[0043] GCCACCCGCGAACTCA;

[0044] GAPDH-P probe (CY5-5'-3'-BHQ2): SEQ IQ NO.33;

[0045] GCCACCCGCGAACTCA.

[0046] Furthermore, the fluorescent group at the 5' end of the probe is a FAM, VIC, HEX, CY5, Texas Red or ROX fluorescent reporter group suitable for fluorescent quantitative PCR analysis, and the quenching group at the 3' end is a TAMRA, BHQ1, BHQ2, MGB or Dabcy1 fluorescent quenching group suitable for fluorescent quantitative PCR.

[0047] Furthermore, the fluorescent groups at the 5' ends of the probes of the HLA gene, CYP2C9 gene and the internal control gene are all one of FAM, VIC and CY5, and the quenching groups at the 3' ends are all MGB or BHQ2.

[0048] Furthermore, the kit also includes a PCR reaction solution, a positive quality control product and a negative quality control product.

[0049] Furthermore, the PCR reaction solution contains hot-start Taq enzyme, UNG enzyme, buffer, magnesium ions, and dNTP substances required for the PCR reaction.

[0050] Furthermore, the method for obtaining the positive quality control product is as follows: according to the wild-type and mutant sequence information of the rs3909184, rs2844682 sites of the HLA-B*1502 gene and the rs1057910 site of the CYP2C9 gene published in the NCBI database, a plasmid is constructed to synthesize the sequence gene fragment, and then the fragment is inserted into the T vector, and the Escherichia coli DH5α strain is used to transform and extract the plasmid, and the plasmids are mixed in equal proportions to obtain the positive quality control product.

[0051] Furthermore, the negative control product is deionized water treated with DEPC.

[0052] A method for using a gene detection kit for guiding phenytoin medication, comprising the following steps:

[0053] 1) Take a blood sample containing EDTA anticoagulant for nucleic acid extraction;

[0054] 2) premixing and subpackaging the gene detection reagents to obtain PCR reaction solution 1, PCR reaction solution 2, and PCR reaction solution 3 to form a PCR reaction system;

[0055] 3) adding the DNA obtained in step 1) to the PCR reaction system in step 2), mixing and then performing PCR amplification;

[0056] 4) After the reaction is completed, genotyping is performed.

[0057] Furthermore, the conditions for PCR amplification in step 3) are: the conditions for UNG enzyme reaction are: 25°C, 10 minutes; the conditions for UNG enzyme inactivation are: 95°C, 2 minutes;

[0058] The amplification conditions of the system are a two-step method: denaturation: 95°C, 5 seconds; annealing and extension: 58°C, 30 seconds, set fluorescence signal collection; the number of cycles is set to 40.

[0059] The detection sites in the PCR reaction system are shown in the following table.

[0060] PCR reaction solution FAM signal VIC signal PCR reaction solution 1 HLA-B (rs<3909184>G) HLA-B (rs<3909184>C) PCR reaction solution 2 HLA-B (rs<2844682>G) HLA-B (rs<2844682>A) PCR reaction solution 3 CYP2C9 (rs<1057910>A) CYP2C9 (rs<1057910>C)

[0061] Genotyping interpretation: Under the above PCR reaction system and cycling program conditions, the FAM and VIC fluorescence detection signals of positive quality control products No. 1-3 should form a logarithmic amplification "S" curve; negative quality control products No. 1-3 should have no amplification curve or the Ct value is 0; observe whether the FAM and VIC fluorescence detection signals of No. 1-3 form a logarithmic amplification "S" curve.

[0062] When the above conditions are met, observe the amplification curve of the reaction tube of the sample to be tested. If a logarithmic amplification "S"-shaped curve is formed, the sample to be tested contains the corresponding base mutation; if there is no logarithmic amplification "S"-shaped curve or the Ct value is 0, there is no corresponding base mutation.

[0063] Compared with the prior art, the beneficial technical effects of the present invention are:

[0064] (1) The present invention packages three phenytoin medication guidance-related gene detection reagents into a 3-link PCR reaction strip, each reaction strip includes one test reagent, pre-mixed packaging, and is convenient for detection, thereby realizing multi-gene variation analysis in one reaction system, reducing costs while improving detection efficiency. At the same time, wild-type and mutant sites are detected in one tube, saving samples.

[0065] (2) Most existing detection technologies cover a large number of anti-epileptic drugs, and the detection points are too redundant and inconvenient for single-drug guidance. Compared with existing detection technologies, the present invention accurately guides the use of phenytoin, has the characteristics of high sensitivity, low cost, simple operation, short detection cycle, and intuitive interpretation, and can quickly and accurately detect the genetic polymorphism of individualized phenytoin medication.

[0066] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention, it can be implemented according to the contents of the specification. In order to make the above contents of the present invention and its objectives, features and advantages more obvious and easy to understand, the specific implementation methods of the present invention are listed below. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 It is the amplification curve diagram of the positive quality control product of the kit of the present invention.

[0068] Figure 2 It is the amplification curve diagram of the negative quality control product of the kit of the present invention. DETAILED DESCRIPTION

[0069] The technical solution of the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only exemplary illustrations and explanations of the present invention and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are included in the scope that the present invention is intended to protect.

[0070] In addition, unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0071] The inventors analyzed the individual differences in the efficacy of phenytoin in clinical practice, screened out three polymorphic sites of genes closely related to the action of phenytoin, prepared a composition for detecting the three polymorphic sites and a detection kit using the composition, and established an accurate detection method for effective medication guidance of antidepressants.

[0072] Example 1: Establishment and optimization of detection system

[0073] 1. Arrange the wild-type and mutant sequence information of rs3909184, rs2844682 of HLA-B*1502 gene and rs1057910 of CYP2C9 gene on NCBI, and send them to Shanghai Bio-Technology Co., Ltd. to synthesize wild-type and mutant plasmids. Dilute the six plasmids to 10 -4 ng / ul simulated wild-type and mutant samples, and 10 -4 ng / ul simulated wild-type and mutant plasmids were mixed in equal volumes to obtain heterozygous simulated samples.

[0074] 2 Based on the sequence characteristics of the genetic polymorphism sites, design the primers and probes used for sample testing and amplify the analysis results.

[0075] (1) According to the sequence characteristics of the genetic polymorphism site, the primers and probes used for sample detection are designed to obtain the mismatched MGB probe, forward primer, and reverse primer used in the following PCR detection system, including:

[0076] Design of primers and probes for detecting rs3909184 locus:

[0077] 9184-WP probe (FAM-5'-3'-MGB) sequence SEQ IQ NO.1:

[0078] TCCCACGTGTGCC

[0079] 9184-MP probe (VIC-5'-3'-MGB) sequence SEQ IQ NO.2:

[0080] TCCCACCTGTGCC

[0081] 9184-F1 sequence SEQ IQ NO.3:

[0082] AGGTGCATGAAGGTGGGTTC

[0083] 9184-R1 sequence SEQ IQ NO.4:

[0084] ATGTGCTCAGTGCCCTCAAG

[0085] 9184-F2 sequence SEQ IQ NO.5:

[0086] GGTTCCCTCCTGTCTGCTTG

[0087] 9184-R2 sequence SEQ IQ NO.6:

[0088] GCTCAGTGCCCTCAAGGTAT

[0089] 9184-F3 sequence SEQ IQ NO.7:

[0090] GTTCCCTCCTGTCTGCTTGG

[0091] 9184-R3 sequence SEQ IQ NO.8:

[0092] AGCAGAAAGCCAACATGTGC

[0093] 9184-F4 sequence SEQ IQ NO.9:

[0094] GTTTCTCTGATGAGCCCCCG

[0095] 9184-R4 sequence SEQ IQ NO.10:

[0096] GTTATCGCAGCAACAGTGGG

[0097] Design of primers and probes for detecting rs2844682 locus:

[0098] 4682-WP probe (FAM-5'-3'-MGB) sequence SEQ IQ NO.11:

[0099] CCAAGGGATTGGC

[0100] 4682-MP probe (VIC-5'-3'-MGB) sequence SEQ IQ NO.12:

[0101] CCAAGGAATTGGC4682-F1 sequence SEQ IQ NO.13:

[0102] AAATGGGTCAGGATGGGCTT

[0103] 4682-R1 sequence SEQ IQ NO.14:

[0104] CTCCTCCAGAACCACTCCCT

[0105] 4682-F2 sequence SEQ IQ NO.15:

[0106] CAGGATGGGCTTCTCTGAGG

[0107] 4682-R2 sequence SEQ IQ NO.16:

[0108] TTTCTGACTGTCCCGTTGGC

[0109] 4682-F3 sequence SEQ IQ NO.17:

[0110] TTGGGGAAGAAGGGGGATCA

[0111] 4682-R3 sequence SEQ IQ NO.18:

[0112] GCCAAACCCTCTGTGCTCT

[0113] 4682-F4 sequence SEQ IQ NO.19:

[0114] GGGTCAGGATGGGCTTCTCT

[0115] 4682-R4 sequence SEQ IQ NO.20:

[0116] AGGTCTCCTCCAGAACCACT

[0117] Design of primers and probes for detecting rs1057910 locus: 7910-WP probe (FAM-5'-3'-MGB) sequence SEQ IQ NO.21: AGATACATTGACC

[0118] 7910-MP probe (VIC-5'-3'-MGB) sequence SEQ IQ NO.22: AGATACCTTGACC

[0119] 7910-F1 sequence SEQ IQ NO.23:

[0120] ATGCAAGACAGGAGCCACAT

[0121] 7910-R1 sequence SEQ IQ NO.24:

[0122] AATTTAATGTCACAGGTCACTGC

[0123] 7910-F2 sequence SEQ IQ NO.25:

[0124] CATGCAAGACAGGAGCCACA

[0125] 7910-R2 sequence SEQ IQ NO.26:

[0126] GAATTTAATGTCACAGGTCACTGC

[0127] 7910-F3 sequence SEQ IQ NO.27:

[0128] TGTGATTGGCAGAAACCGGA

[0129] 7910-R3 sequence SEQ IQ NO.28:

[0130] TCTGAATTTAATGTCACAGGTCACT

[0131] 7910-F4 sequence SEQ IQ NO.29:

[0132] CGTGTGATTGGCAGAAACCG

[0133] 7910-R4 sequence SEQ IQ NO.30:

[0134] TGAATTTAATGTCACAGGTCACTG

[0135] Design primers and probes for detecting the internal control gene GAPDH:

[0136] GAPDH-F sequence SEQ IQ NO.31:

[0137] GGCCACTAGGCGCTC

[0138] GAPDH-R sequence SEQ IQ NO.32:

[0139] GCCACCCGCGAACTCA

[0140] GAPDH-P probe (CY5-5'-3'-BHQ2) sequence SEQ IQ NO.33:

[0141] GCCACCCGCGAACTCA

[0142] (2) Prepare two-plex PCR detection systems for detecting rs3909184 and rs2844682 of the HLA-B*1502 gene and rs1057910 of the CYP2C9 gene, respectively, with the wild-type and mutant systems sharing one tube. The detection systems are shown in Table 1.

[0143] Table 1: Wild-type single-plex detection system

[0144] Reagent name Volume (μL) TaKaRa Taq HS (5U / μL) 0.15 10×PCR Buffer (Mg2+ plus) 2.5 dU plus dNTP Mixture (12.5X) 4ul UNG (2U / μL) 0.1 Forward primer 0.5 Reverse primer 0.5 Wild-type MGB probe 0.3 Mutant MGB probe 0.3 DNA (template) 2 DEPC water Make up to 25 μL

[0145] The DNA templates are the wild-type and mutant simulation samples diluted in step 1, and the primers and probes are the primers and probes shown in step 2 (1), respectively.

[0146] In each point PCR mutant detection system, a pair of amplification primers is added to the wild-type and mutant probes each time until all primer and probe combinations in step 2 obtain detection results, thereby screening amplification primers. In each point PCR detection system, the DNA samples added are the corresponding wild-type and mutant plasmids, with a final concentration of 10 -4 ng / ul.

[0147] (3) The prepared detection system is subjected to PCR amplification. The PCR reaction procedure is as follows:

[0148] Stage 1: 25°C, 10 minutes;

[0149] Second stage: 95℃, 2 minutes;

[0150] The third stage: 95°C, 5 seconds; 58°C, 30 seconds, the number of cycles is set to 40; fluorescence is collected at 58°C.

[0151] (4) Experimental results: PCR was performed on the above primers and probes respectively, and the CT value of the detection system was directly read. The experimental results of each group are shown in the following table:

[0152] Table 2

[0153]

[0154] According to the CT results, first select the probes with wild-type detection system wild-type plasmids between 22-30, mutant plasmids without CT values ​​or greater than 37, select the probes with mutant detection system mutant plasmids between 22-30, wild-type plasmids without CT values ​​or greater than 37, and then select the probes with the difference of CT values ​​between wild-type probes and mutant probes within 2. The final selected primer probe combination is shown in the following table:

[0155] Table 3

[0156] Locus Forward primer Reverse primer Wild-type probe Mutant probe rs3909184 9184-F2 9184-R2 9184-WP 9184-MP rs2844682 4682-F1 4682-R1 4682-WP 4682-MP rs1057910 7910-F2 7910-R2 7910-WP 7910-MP

[0157] 3 Based on the specific primers screened by the PCR system, add the internal control to prepare the PCR reaction solution for each site, as shown in the following table:

[0158] Table 4

[0159] Reagent name Volume (μL) TaKaRa Taq HS (5U / μL) 0.15 10×PCR Buffer (Mg2+ plus) 2.5 dU plus dNTP Mixture (12.5X) 4ul UNG (2U / μL) 0.1 Forward primer 0.5 Reverse primer 0.5 Wild-type probe 0.3 Mutant probe 0.3 GAPDH-F 0.2 GAPDH-R 0.2 GAPDH-P 0.2 DNA (template) 2 DEPC water Make up to 25 μL

[0160] The DNA template is the diluted heterozygous simulation sample synthesized in step 1, and the primers and probes are the primers and probes screened in step 2.

[0161] Each reaction system adds a forward primer, reverse primer, wild-type probe, and mutant probe of one site. The DNA samples added to each site reaction system are the corresponding heterozygous plasmids, with a final concentration of 10 -4 ng / ul.

[0162] The prepared PCR reaction solution for each site is subjected to PCR amplification. The PCR reaction procedure is as follows:

[0163] Stage 1: 25°C, 10 minutes;

[0164] Second stage: 95℃, 2 minutes;

[0165] The third stage: 95°C, 5 seconds; 58°C, 30 seconds, the number of cycles is set to 40; fluorescence is collected at 58°C.

[0166] Experimental results: Read the CT value of FAM and VIC signals at each point and record the highest signal value at each point. The experimental results of each group are shown in the following table:

[0167] Table 5

[0168]

[0169]

[0170] 4 Based on the reaction results of step 3, adjust the amount of primers and probes at each site to make the CT value and signal value of each site closer. The final reaction system is as follows:

[0171] Table 6: PCR reaction solution 1

[0172] Reagent name Volume (μL) TaKaRa Taq HS (5U / μL) 0.15 10×PCR Buffer (Mg2+ plus) 2.5 dU plus dNTP Mixture (12.5X) 4ul UNG (2U / μL) 0.1 9184-F1 1 9184-R1 1 9184-WP 0.5 9184-MP 0.3 GAPDH-F 0.2 GAPDH-R 0.2 GAPDH-P 0.2 DNA (template) 2 DEPC water Make up to 25 μL

[0173] Table 7: PCR reaction solution 2

[0174] Reagent name Volume (μL) TaKaRa Taq HS (5U / μL) 0.15 10×PCR Buffer (Mg2+ plus) 2.5 dU plus dNTP Mixture (12.5X) 4ul UNG (2U / μL) 0.1 1331-F 0.5 1331-R 0.5 1331-WP1 0.3 1331-MP2 0.3 GAPDH-F 0.2 GAPDH-R 0.2 GAPDH-P 0.2 DNA (template) 2 DEPC water Make up to 25 μL

[0175] Table 8: PCR reaction solution 3

[0176]

[0177]

[0178] The above primers and probes can be used to specifically detect the types of antidepressant medication-related gene mutations in samples, as shown in the following table.

[0179] Table 9

[0180]

[0181] 5. Design of the kit: The kit of the present invention adopts a three-tube premix system design, which respectively indicates different genotypes of the rs3909184 and rs2844682 sites of the HLA-B*1502 gene and the rs1057910 site of the CYP2C9 gene.

[0182] 6. Obtaining positive quality control products

[0183] The wild-type and mutant sequences of the rs3909184 and rs2844682 sites of the HLA-B*1502 gene, the rs1057910 site of the CYP2C9 gene, and the sequence information of GAPDH were sorted out on NCBI and sent to Shanghai Bio-Technology Co., Ltd. to synthesize the wild-type, mutant, and internal control plasmids. The seven plasmids were diluted to 10 -4 ng / ul equal volumes were mixed to obtain the positive quality control product.

[0184] Example 2: Use of Gene Detection Kit

[0185] 1. Sample collection and processing

[0186] Peripheral blood was collected from patients using a vacuum tube containing EDTA anticoagulant to collect 5 ml of blood specimens. Nucleic acid was extracted using the nucleic acid extraction kit (magnetic bead method) produced by Chongqing Puji. The experimental steps were carried out according to the instructions.

[0187] 2. Preparation of reaction system

[0188] Preparation of the reaction system The reaction system was prepared according to the PCR reaction solutions 1-3 in Example 1.

[0189] 3. PCR reaction

[0190] Add the DNA extracted from the sample to the prepared reaction system, and add 1-200ng of template. When performing PCR reaction, the sample to be tested, the positive quality control product and the negative quality control product need to be tested in parallel on the machine, and each sample needs to be added to three reaction solutions at the same time for reaction.

[0191] 4. Instrument channel and reaction volume selection

[0192] ① Select the FAM channel (Reporter: FAM, Quencher: MGB), VIC channel (Reporter: VIC, Quencher: MGB) and CY5 channel (Reporter: CY5, Quencher: BHQ2) to detect amplification;

[0193] ②The reaction volume (Sample Volume) is 25μL.

[0194] ③ Reference Dye: If you are using an ABI series PCR instrument, please be sure to select "none" in the passive reference; for specific detection channel settings, please refer to the instructions for use of each instrument.

[0195] Stage 1: 25°C, 10 minutes;

[0196] Second stage: 95℃, 2 minutes;

[0197] The third stage: 95°C, 5 seconds; 58°C, 30 seconds, the number of cycles is set to 40; fluorescence is collected at 58°C.

[0198] 6. Experimental results

[0199] After the reaction program is completed, the results are saved and interpreted. If the amplification Ct value is ≤35, it is detected; otherwise, it is judged as not detected.

[0200] The fluorescence detection signals of FAM, VIC and CY5 in reaction tubes 1-3 of the positive control product form a logarithmic amplification "S" curve (see attached Figure 1 ); negative control tubes 1-3 have no amplification curve (see attached Figure 2 );

[0201] Example 3: Determination of the genotype determination criteria of the kit

[0202] According to the detection method in Example 2, the CT value of the PCR detection system is directly read, and the genotype is determined according to the CT value of the FAM and VIC signals of the PCR detection system. Based on the premise that the kit detects 35 of 120 human peripheral blood gDNA samples, the FAM signal ≤35 and the VIC signal >35 are wild type; the VIC signal ≤35 and the FAM signal >35 are mutant type; and the FAM and VIC signals are both less than 35 for heterozygous type.

[0203] Example 4 Accurate performance evaluation of the kit

[0204] 10 clinical samples were selected and tested according to the test method of Example 2 and the judgment criteria of Example 3, and the gold standard Sanger sequencing method was used for accuracy comparison. The test results are shown in the following table

[0205] Table 10: Accuracy test results

[0206]

[0207] The detection results of each sample in the accuracy test results are consistent with the comparison results, indicating that the detection system of the kit of Example 2 has good accuracy.

[0208] Example 5 Detection Limit Performance Evaluation of the Kit

[0209] Select three detection limit reference products L1, L2, L3, dilute them with TE buffer to 10 ng / μL, 5 ng / μL, 2.5 ng / μL and 1 ng / μL, 0.5 g / μL, and perform detection according to the method of Example 2 and the judgment standard of Example 3. Repeat the detection 10 times for each concentration reference product. The results are shown in the following table:

[0210] Table 11: Detection limit test results

[0211]

[0212] The detection limit of the kit of the present invention is calculated to be as low as 1 ng / μL using a detection rate of 95% as the minimum detection limit, and the invention has good sensitivity.

[0213] Example 6 Evaluation of Kit Precision

[0214] Three precision reference samples J1 (plasmids were mixed to make all sites heterozygous), J2 and J3 (J2 and J3 were clinical samples) were selected for testing according to the method of Example 2, two batches were tested every day, and each batch was tested 4 times for 5 days. The coefficient of variation (CV, %) was calculated using the Ct values ​​of the 40 test results of the precision experiment. The results are shown in the following table:

[0215] Table 12

[0216]

[0217]

[0218] The calculation results showed that the intra-batch and inter-batch precision results were both within 5%, indicating that the kit of the present invention has good repeatability.

[0219] The serial numbers of the above embodiments of the present invention are only for description and do not represent the advantages or disadvantages of the embodiments.

[0220] The embodiments of the present invention are described above in conjunction with the accompanying drawings, but the present invention is not limited to the above-mentioned specific implementation modes, which are merely illustrative rather than restrictive. Under the guidance of the present invention, ordinary technicians in this field can also make many forms without departing from the scope of protection of the present invention and the claims, all of which are within the protection of the present invention.

Claims

1. A gene detection kit for guiding phenytoin medication, characterized in that: Includes primers and probes for detecting HLA and CYP2C9 genes.

2. A gene detection kit for guiding phenytoin medication as claimed in claim 1, characterized in that: The genetic polymorphism sites detected by the kit include rs3909184 and rs2844682 sites of the HLA gene and rs1057910 site of the CYP2C9 gene.

3. A gene detection kit for guiding phenytoin medication as claimed in claim 2, characterized in that: The primer and probe sequences used to detect the rs3909184 site are: 9184-WP: SEQ IQ NO.1; 9184-MP: SEQ IQ NO.2; 9184-F2: SEQ IQ NO.5; 9184-R2: SEQ IQ NO.6; The primer and probe sequences used to detect rs2844682 locus are: 4682-WP: SEQ IQ NO.11; 4682-MP: SEQ IQ NO.12; 4682-F1: SEQ IQ NO.13; 4682-R1: SEQ IQ NO.14; The primer and probe sequences used to detect rs1057910 are: 7910-WP: SEQ IQ NO.21; 7910-MP: SEQ IQ NO.22; 7910-F2: SEQ IQ NO.25; 7910-R2: SEQ IQ NO.

26.

4. A gene detection kit for guiding phenytoin medication as claimed in claim 1 or 3, characterized in that: The kit also includes primers and probes for an internal control gene to be monitored, and the internal control gene is GAPDH.

5. A gene detection kit for guiding phenytoin medication as claimed in claim 4, characterized in that: The primer and probe sequences used to detect the internal control gene GAPDH are: GAPDH-F: SEQ IQ NO.31; GAPDH-R: SEQ IQ NO.32; GAPDH-P: SEQ IQ NO.

33.

6. A gene detection kit for guiding phenytoin medication as claimed in claim 5, characterized in that: The 5'-end fluorescent groups of the probes of HLA gene, CYP2C9 gene and internal control gene are all one of FAM, VIC and CY5, and the quenching groups at the 3'-end are all MGB or BHQ2.

7. A gene detection kit for guiding phenytoin medication as claimed in claim 1, characterized in that: The kit also includes PCR reaction solution, positive quality control product and negative quality control product.

8. A gene detection kit for guiding phenytoin medication as claimed in claim 7, characterized in that: The PCR reaction solution contains Taq enzyme, UNG enzyme, buffer, magnesium ions, and dNTP substances.

9. A method for using a gene detection kit for guiding phenytoin medication according to any one of claims 1 to 8, characterized in that: The following steps are involved: 1) Take a blood sample containing EDTA anticoagulant for nucleic acid extraction; 2) premixing and subpackaging the gene detection reagents to obtain PCR reaction solution 1, PCR reaction solution 2, and PCR reaction solution 3 to form a PCR reaction system; 3) adding the DNA obtained in step 1) to the PCR reaction system in step 2), mixing and then performing PCR amplification; 4) After the reaction is completed, genotyping is performed.

10. The method for using the gene detection kit for guiding phenytoin medication as claimed in claim 9, characterized in that: The conditions for PCR amplification in step 3) are: the conditions for UNG enzyme reaction are: 25°C, 10 minutes; the conditions for UNG enzyme inactivation are: 95°C, 2 minutes; The amplification conditions of the system are a two-step method: denaturation: 95°C, 5 seconds; annealing and extension: 58°C, 30 seconds, set fluorescence signal collection; the number of cycles is set to 40.

Images