Anti-TPO monoclonal antibody as well as preparation method and application thereof

Abstract

The invention relates to the technical field of immunity, in particular to an anti-TPO monoclonal antibody as well as a preparation method and application thereof. The invention provides a human anti-TPO virus antibody obtained by screening by using a phage surface display technology, the anti-TPO fully human monoclonal antibodies TH507 and TH512 have the purity of more than 90% and the transient expression quantity of 150mg / L and 120mg / L respectively, can specifically recognize a TPO recombinant antigen, can generate a remarkable enzyme-linked immunosorbent assay reaction with the antigen, and can be used for detecting the TPO recombinant antigen. The accelerated stability at the temperature of 37 DEG C meets the use requirement of the kit, and the antibody can play an important role in TPO item detection as a quality control product.

Description

Technical Field

[0001] The present invention relates to the field of immunotechnology, and in particular to an anti-TPO monoclonal antibody and a preparation method and application thereof. Background Art

[0002] Thyroid peroxidase (TPO) is a type of macromolecular membrane-bound glycoprotein (103KD) composed of 933 amino acids. It is located in the apical membrane of thyroid follicle cells and is only expressed in thyroid cells. It is a key enzyme that catalyzes the synthesis of thyroid hormones. Its structure consists of three parts: the extracellular structural region, the transmembrane region, and the intracellular structural region.

[0003] TPO is involved in the synthesis of thyroid hormones at the top of follicular cells and plays an important role in the synthesis of thyroid hormones. Most TPO is degraded in thyroid cells. If the activity of thyroid peroxidase is inhibited or attacked by the immune system, it may lead to thyroid hormone synthesis disorders, which in turn cause thyroid diseases. When thyroid peroxidase antibodies are high, it means that the human immune system has already attacked the thyroid gland, which is usually associated with autoimmune thyroid diseases. For example, surgery, trauma, infection and other reasons can cause TPO to leak out, causing autoimmune reactions, and the body produces anti-TPO autoantibodies, namely thyroid peroxidase antibodies (TPO-Ab). And this enzyme can work synergistically with TG to iodinate L-tyrosine, and link monoiodotyrosine and diiodotyrosine to form thyroid hormones T4, T3 and rT3. The main indications for detecting this type of antibody are autoimmune thyroid diseases (including exophthalmos goiter and Hashimoto's thyroiditis, etc.), which is of great significance for the diagnosis of this type of disease.

[0004] TPO is a potential autoantigen. TPO antibodies are thyroid peroxidase antibodies, or TPO-Ab, which are autoantibodies produced by the body against TPO. At the same time, TPO-Ab is a glycoprotein containing a hemoglobin prosthetic group and is present on the microsomes of thyroid cells. It is significantly elevated in patients with Hashimoto's thyroiditis, Graves' disease, and idiopathic myxedema, especially in Hashimoto's thyroiditis. Elevated TPO-Ab levels can be detected in about 65% of patients with Graves' disease, 95% of patients with Hashimoto's thyroiditis or congenital mucinous adenomas, 19% of patients with differentiated thyroid cancer, and 11% of patients with other mixed non-autoimmune thyroid diseases. For patients with primary hypothyroidism, if TPO-Ab levels are elevated, combined with elevated TSH, it can be found that patients with early hypothyroidism have a 3% to 4% risk of developing hypothyroidism each year. For patients with suspected hypothyroidism, if TPO-Ab is elevated, it is helpful to distinguish between primary and secondary hypothyroidism. In HT patients, TPO-Ab exists throughout life. If the clinical manifestations are typical and TPO-Ab levels remain high, it can be used as a basis for diagnosis. Elevated TPO-Ab levels can also be seen in patients with postpartum thyroiditis, atrophic thyroid, some nodular goiters, and certain autoimmune diseases such as rheumatoid disease and systemic lupus erythematosus. Pregnant women with elevated TPO-Ab are prone to hypothyroidism. Elevated TPO-Ab levels have been detected in some healthy people, especially the elderly, and the positive rate in elderly women is significantly higher than that in elderly men.

[0005] In short, TPO-Ab is a major autoantibody in patients with autoimmune thyroid disease, and is of great significance for clinical diagnosis. It is the gold standard for diagnosing chronic autoimmune thyroid disease. And TPO-Ab can activate complement, which is considered to be the main cause of thyroid dysfunction and hypothyroidism. In addition, the accuracy of TPO test results is largely determined by the performance of the antibody. An antibody with strong reactivity and high stability will help to accurately and quickly detect TPO levels. The preparation process of monoclonal antibodies in the prior art is very cumbersome and time-consuming, and the resulting monoclonal antibodies have low titers and cannot meet clinical needs. Summary of the invention

[0006] In view of this, the present invention provides anti-TPO monoclonal antibodies and preparation methods and applications thereof. The present invention provides a human anti-TPO virus antibody obtained by screening using phage surface display technology, including a heavy chain and a light chain; the CDR1, CDR2 and CDR3 of the heavy chain have the amino acid sequences shown in SEQ ID NO.71, SEQ ID NO.72 and SEQ ID NO.73 respectively; the CDR1, CDR2 and CDR3 of the light chain have the amino acid sequences shown in SEQ ID NO.74, SEQ ID NO.75 and SEQ ID NO.76 respectively. Among them, the anti-TPO fully human monoclonal antibodies TH507 and TH512 have a purity of >90%, and the instantaneous expression levels are 150 mg / L and 120 mg / L respectively. They can specifically recognize TPO recombinant antigens, can have a significant enzyme-linked immunosorbent reaction with the antigen, and the 37°C accelerated stability meets the requirements for the use of the kit. As a quality control product, it can play an important role in the detection of thyroid function TPO projects.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides an anti-TPO monoclonal antibody, comprising a heavy chain and a light chain; the amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain are GXXFXXXDXX, XXXXXXXNXX, XXXXXXXAXDI in sequence; the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain are SGDXLPKQYAY, KDXERPS, QSADXSGXXXV in sequence; and X is any one of G, A, V, L, I, F, W, Y, D, H, N, E, K, Q, M, R, S, T, C, P, U and O.

[0009] In some specific embodiments of the present invention, the monoclonal antibody comprises any of the following:

[0010] (I), the CDR1 of the heavy chain has the amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO.17; and / or

[0011] The CDR2 of the heavy chain has an amino acid sequence as shown in SEQ ID NO.2 or SEQ ID NO.18; and / or

[0012] The CDR3 of the heavy chain has an amino acid sequence as shown in SEQ ID NO.3 or SEQ ID NO.19; and / or

[0013] (II), the CDR1 of the light chain has the amino acid sequence shown in SEQ ID NO.9 or SEQ ID NO.25; and / or

[0014] The CDR2 of the light chain has an amino acid sequence as shown in SEQ ID NO.10 or SEQ ID NO.26; and / or

[0015] The CDR3 of the light chain has an amino acid sequence as shown in SEQ ID NO.11 or SEQ ID NO.27; or

[0016] (III) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence described in (I) or (II), and having the same function as the amino acid sequence described in (I) or (II); or

[0017] (IV) An amino acid sequence having 90% or more identity with the amino acid sequence described in any one of (I) to (III).

[0018] In some specific embodiments of the present invention, the monoclonal antibody comprises any of the following:

[0019] (I), the CDR1, CDR2 and CDR3 of the heavy chain have the amino acid sequences shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively; and

[0020] The CDR1, CDR2 and CDR3 of the light chain have the amino acid sequences shown in SEQ ID NO.9, SEQ ID NO.10 and SEQ ID NO.11, respectively; or

[0021] (II), the CDR1, CDR2 and CDR3 of the heavy chain have the amino acid sequences shown in SEQ ID NO.17, SEQ ID NO.18 and SEQ ID NO.19 respectively; and

[0022] The CDR1, CDR2 and CDR3 of the light chain have the amino acid sequences shown in SEQ ID NO.25, SEQ ID NO.26 and SEQ ID NO.27, respectively; or

[0023] (III) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence described in (I) or (II), and having the same function as the amino acid sequence described in (I) or (II); or

[0024] (IV) An amino acid sequence having 90% or more identity with the amino acid sequence described in any one of (I) to (III).

[0025] In some specific embodiments of the present invention, the monoclonal antibody comprises any of the following:

[0026] (I), FR1 of the heavy chain has the amino acid sequence shown in SEQ ID NO.4 or SEQ ID NO.20; and / or

[0027] The FR2 of the heavy chain has an amino acid sequence as shown in SEQ ID NO.5 or SEQ ID NO.21; and / or

[0028] The FR3 of the heavy chain has an amino acid sequence as shown in SEQ ID NO.6 or SEQ ID NO.22; and / or

[0029] The FR4 of the heavy chain has an amino acid sequence as shown in SEQ ID NO.7 or SEQ ID NO.23; and / or

[0030] (II), FR1 of the light chain has an amino acid sequence as shown in SEQ ID NO.12 or SEQ ID NO.28; and / or

[0031] The FR2 of the light chain has an amino acid sequence as shown in SEQ ID NO.13 or SEQ ID NO.29; and / or

[0032] The FR3 of the light chain has an amino acid sequence as shown in SEQ ID NO.14 or SEQ ID NO.30; and / or

[0033] The FR4 of the light chain has an amino acid sequence as shown in SEQ ID NO.15 or SEQ ID NO.31; or

[0034] (III) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence described in (I) or (II), and having the same function as the amino acid sequence described in (I) or (II); or

[0035] (IV) An amino acid sequence having 90% or more identity with the amino acid sequence described in any one of (I) to (III).

[0036] In some specific embodiments of the present invention, the monoclonal antibody comprises any of the following:

[0037] (I), FR1, FR2, FR3 and FR4 of the heavy chain have the amino acid sequences shown in SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO.7, respectively; and

[0038] FR1, FR2, FR3 and FR4 of the light chain have the amino acid sequences shown in SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14 and SEQ ID NO.15, respectively; or

[0039] (II), FR1, FR2, FR3 and FR4 of the heavy chain have the amino acid sequences shown in SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22 and SEQ ID NO.23, respectively; and

[0040] FR1, FR2, FR3 and FR4 of the light chain have the amino acid sequences shown in SEQ ID NO.28, SEQ ID NO.29, SEQ ID NO.30 and SEQ ID NO.31, respectively; or

[0041] (III) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence described in (I) or (II), and having the same function as the amino acid sequence described in (I) or (II); or

[0042] (IV) An amino acid sequence having 90% or more identity with the amino acid sequence described in any one of (I) to (III).

[0043] In some specific embodiments of the present invention, the variable region of the heavy chain has an amino acid sequence as shown in SEQ ID NO.8 or SEQ ID NO.24; the variable region of the light chain has an amino acid sequence as shown in SEQ ID NO.16 or SEQ ID NO.32.

[0044] In some specific embodiments of the present invention, the variable region of the heavy chain has the amino acid sequence shown in SEQ ID NO.8, and the variable region of the light chain has the amino acid sequence shown in SEQ ID NO.16; or

[0045] The variable region of the heavy chain has an amino acid sequence as shown in SEQ ID NO.24, and the variable region of the light chain has an amino acid sequence as shown in SEQ ID NO.32.

[0046] In some specific embodiments of the present invention, the monoclonal antibody is a humanized antibody.

[0047] In some specific embodiments of the present invention, the constant region of the heavy chain comprises human IgG; and the constant region of the light chain comprises a kappa type or a lamuda type.

[0048] The present invention also provides a nucleic acid molecule encoding the monoclonal antibody.

[0049] The present invention also provides an expression vector, comprising the nucleic acid molecule.

[0050] In some specific embodiments of the present invention, the expression vector comprises pTT5.

[0051] The present invention also provides a host, comprising the expression vector.

[0052] In some specific embodiments of the present invention, the host comprises HEK 293F cells.

[0053] The present invention also provides a method for preparing the monoclonal antibody, which comprises culturing the host, harvesting the supernatant, and separating and purifying to obtain the monoclonal antibody.

[0054] The present invention also provides the use of any of the following items in the preparation of a product for detecting TPO:

[0055] (I), the monoclonal antibody; and / or

[0056] (II), the nucleic acid molecule; and / or

[0057] (III), the expression vector; and / or

[0058] (IV), the host; and / or

[0059] (V) The monoclonal antibody prepared by the preparation method.

[0060] The present invention also provides the use of any of the following items in the preparation of products for diagnosing, preventing and / or treating thyroid function:

[0061] (I), the monoclonal antibody; and / or

[0062] (II), the nucleic acid molecule; and / or

[0063] (III), the expression vector; and / or

[0064] (IV), the host; and / or

[0065] (V) The monoclonal antibody prepared by the preparation method.

[0066] In some specific embodiments of the present invention, the product includes one or more of a blocking agent, a quality control product, a standard product, a kit, an antibody drug, or a drug combination.

[0067] The present invention also provides a drug or drug combination comprising any of the following:

[0068] (I), the monoclonal antibody; and / or

[0069] (IV) The monoclonal antibody prepared by the preparation method.

[0070] The present invention also provides a reagent combination or a kit, comprising any of the following items:

[0071] (I), the monoclonal antibody; and / or

[0072] (IV) The monoclonal antibody prepared by the preparation method.

[0073] The present invention includes but is not limited to providing the following beneficial effects:

[0074] The present invention provides a human anti-TPO virus antibody obtained by screening using phage surface display technology, wherein the anti-TPO fully human monoclonal antibodies TH507 and TH512 have a purity of >90%, and the transient expression levels are 150 mg / L and 120 mg / L respectively. Both can specifically recognize TPO recombinant antigens, can undergo significant enzyme-linked immunosorbent assay with the antigen, and the accelerated stability at 37°C meets the requirements for the use of the kit. As quality control products, they can play an important role in the detection of thyroid function TPO items. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0076] Figure 1 Shown is the agarose gel electrophoresis of RNA extracted from peripheral blood lymphocytes;

[0077] Figure 2 Shows the agarose gel electrophoresis of VL and VH gene PCR products;

[0078] Figure 3 Shows the agarose gel electrophoresis of scFv gene PCR products;

[0079] Figure 4 Shown are SDS-PAGE and HPLC analysis diagrams; A: TH507 non-reduced (1) and reduced bands (treated with reducing agent / DTT) (3); B: TH512 non-reduced (2) and reduced bands (treated with reducing agent / DTT) (4); C: SEC-HPLC diagram, wherein the blue peak: Marker sizes from left to right are: 1340KDa, 670KDa, 300KDa, 150KDa, 45KDa, 17KDa; light green and red peaks: correspond to TH507 and TH512 HPLC peak diagrams, respectively. DETAILED DESCRIPTION

[0080] The present invention discloses anti-TPO monoclonal antibodies and preparation methods and applications thereof. Those skilled in the art can refer to the contents of this article and appropriately improve the process parameters to achieve the above. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0081] The present invention provides a method for preparing a fully humanized monoclonal antibody against TPO. The monoclonal antibody is used as a quality control product and a calibrator to produce a significant enzyme-linked immunosorbent assay with a TPO antigen, and the 37-degree accelerated stability meets the requirements for the use of a kit, and the preparation method is simple and suitable for mass production.

[0082] The present invention provides anti-TPO fully human IgG monoclonal antibodies TH507 and TH512, the amino acid sequences of the heavy chain variable regions are shown in SEQ ID NO.8 and SEQ ID NO.26, and the amino acid sequences of the light chain variable regions are shown in SEQ ID NO.17 and SEQ ID NO.35.

[0083] The anti-TPO fully human monoclonal antibody of the present invention further comprises a heavy chain constant region and a light chain constant region, wherein the heavy chain constant region is of human IgG subtype, and the light chain constant region is of Kappa type.

[0084] The present invention also provides a DNA molecule encoding the anti-TPO fully human monoclonal antibody.

[0085] The present invention also provides an expression vector containing a DNA molecule encoding the anti-TPO fully human monoclonal antibody.

[0086] In some specific embodiments, the backbone vector of the expression vector of the present invention is pTT5.

[0087] The present invention also provides a recombinant host containing the expression vector. In some specific embodiments, the host cell is a HEK 293F cell.

[0088] The present invention also provides a method for preparing an anti-TPO fully human monoclonal antibody, comprising:

[0089] (1) constructing an expression vector containing the DNA molecule;

[0090] (2) transforming host cells with the expression vector described in step (1);

[0091] (3) culturing the host cells obtained in step (2);

[0092] (4) Separating and purifying to obtain the monoclonal antibody.

[0093] The present invention also provides the use of the anti-TPO fully human monoclonal antibody in in vitro diagnostic reagents.

[0094] The anti-TPO fully human monoclonal antibodies TH507 and TH512 provided by the present invention have a purity of >90%, and the transient expression levels are 150 mg / L and 120 mg / L respectively. It has been identified that TH507 has a higher potency. The monoclonal antibody can be used as a positive quality control product, and its potency and stability meet the use requirements, providing a reliable basis for clinical diagnosis and treatment.

[0095] The specific sequence information of the anti-TPO fully human monoclonal antibody of the present invention is shown in Table 1.

[0096] Table 1 Sequence information

[0097]

[0098]

[0099] Unless otherwise specified, the anti-TPO monoclonal antibody provided by the present invention and the raw materials and reagents used in the preparation method and application thereof can all be purchased from the market.

[0100] The present invention will be further described below in conjunction with embodiments:

[0101] Example 1 Primer synthesis and gene acquisition

[0102] Lymphocytes were separated from anticoagulated blood of thyroid patients using human peripheral blood lymphocyte separation medium (Beijing Solebow, P8610), and total cellular RNA was extracted using RNA extraction kit (Shengang, B511311-0500). Figure 1 ), using Oligo-dT primers, the extracted RNA was used as a template to transcribe cDNA. The heavy chain and light chain gene fragments of scFv were amplified using the templates. The primer sequences used are as follows:

[0103] The heavy chain upstream primer is as follows:

[0104] VHF1(SEQ ID NO.33):CAGGTBCAGCTGGTRCAGTC

[0105] VHF2(SEQ ID NO.34):CAGGTCAACTTAAGGGAGTCTGG

[0106] VHF3(SEQ ID NO.35):CAGGTGCAGCTGGTGGAGTCTGG

[0107] VHF4 (SEQ ID NO.36): CAGGTGCAGCTGCAGGAGTCGGG

[0108] VHF5 (SEQ ID NO.37): CAGGTGCAGCTGTTGCAGTCTGC

[0109] VHF6 (SEQ ID NO.38): CAGGTACAGCTGCAGCAGTCAGG

[0110] VHF7 (SEQ ID NO.39): CAGGTCCAGCTKGTGCARTC

[0111] VHF8 (SEQ ID NO.40): CAGGTCCAGCTGGTGCAGTC

[0112] VHF9 (SEQ ID NO.41): CAGGTACAGCTGGTGGAGTC

[0113] Heavy chain downstream primer:

[0114] VHR1 (SEQ ID NO.42): TGAGGAGACGGTGACCTTTG

[0115] VHR2 (SEQ ID NO.43): TGAGGAGACGGTGACCAGGG

[0116] VHR3 (SEQ ID NO.44): TGAAGAGACGGTGACCATTG

[0117] VHR4 (SEQ ID NO.45): TGAGGAGACGGTGACCGTGG

[0118] Light chain kappa subtype upstream primer:

[0119] Kappa1F (SEQ ID NO.46): GACATCCAGATGACCCAGTCTCC

[0120] Kappa2F (SEQ ID NO.47): GATGTTGTGATGACTCAGTCTCC

[0121] Kappa3F (SEQ ID NO.48): GAAATTGTGTTGACGCAGTCTCC

[0122] Kappa4F (SEQ ID NO.49): GACATCGTGATGACCCAGTCTCC

[0123] Kappa5F(SEQ ID NO.50):GAAACGACACTCACGCAGTCTCC

[0124] Kappa6F(SEQ ID NO.51):GAAATTGTGCTGACTCAGTCTCC

[0125] Light chain kappa isoform downstream primer

[0126] KappaR1 (SEQ ID NO.52):TTTGATATCCACTTTGGTCC

[0127] KappaR2 (SEQ ID NO.53):TTTGATCTCCACCTTGGTCC

[0128] KappaR3 (SEQ ID NO.54):TTTGATTTCCAGCTTGGTCC

[0129] KappaR4 (SEQ ID NO.55):TTTAATCTCCAGTCGTGTCC

[0130] Light chain lamuda subtype upstream primer

[0131] λ1F(SEQ ID NO.56):CAGTTCTGTGTTGACGCAGCCGCC

[0132] λ2F(SEQ ID NO.57):CAGTCTGCCCTGACTCAGCCTGC

[0133] λ3F(SEQ ID NO.58):TCCTATGTGCTGACTCAGCCACC

[0134] λ4F(SEQ ID NO.59):TCTTCTGAGCTGACTCAGGACCC

[0135] λ5F(SEQ ID NO.60):CACGTTATACTGACTCAACCGCC

[0136] λ6F(SEQ ID NO.61):CAGGCTGTGCTCACTCAGCCGTC

[0137] λ7F(SEQ ID NO.62):AATTTTATGCTGACTCAGCCCCA

[0138] Light chain lamuda subtype downstream primer

[0139] λ1R (SEQ ID NO.63): TAGGACGGTCAGCTTGGTCC

[0140] λ2R (SEQ ID NO.64):GAGGACGGTCAGCTGGGTGC

[0141] The PCR reaction conditions were: 95℃ pre-denaturation for 5min; 95℃ denaturation for 30s, 56℃ annealing for 30s, 72℃ extension for 30s, for a total of 30 cycles; 72℃ extension for another 10min. The light and heavy chain variable regions were connected to the T vector after gel excision and purification, and then sent for testing to obtain the light and heavy chain variable region sequences. Then, through the SfiⅠ restriction site, the OverLap PCR technology was used to splice the two into the scFv gene fragment. The PCR products of the light chain, heavy chain and scFv gene fragments were detected by 1% agarose gel electrophoresis ( Figure 2 and Figure 3 The results showed that the variable region of the heavy and light chains was about 350 bp in size, and the size of the spliced ​​ScFV fragment was about 750 bp.

[0142] Example 2 ScFV phage library construction

[0143] The spliced ​​scFv gene fragments of Example 1 were connected to the phage vector pComb3XSS (Fenghui Bio, BR433) via the SfiⅠ restriction site, and the ligation product was electrotransformed into E. coli TG1 competent cells, and 2YT-AG medium (2×YT medium containing 2% glucose and 100 μg / mL AMP) was added, and cultured at 37°C for 1 hour; 10 μL of bacterial solution was taken and inoculated into 2YT-AG medium for overnight culture; plaque formation was observed and the antibody library titer was calculated. 10 to 20 positive colonies were randomly selected and sent to Biotech Technology Co., Ltd. for sequencing, and colony PCR identification was performed to analyze the diversity of the antibody library. The remaining bacterial liquid was added with helper phage-M13K07 (addgene, 37468), incubated at 37°C for 30 min, and then centrifuged to collect the bacteria, added to 100 mL 2YT medium (containing 1 μM IPTG, 100 μg / mL AMP) and resuspended, and cultured in a shaking incubator at 30°C overnight; the supernatant was collected by centrifugation, and one-fourth volume of 20% PEG / 2.5M NaCl was added, and the phages were precipitated in an ice bath for 50 min, the precipitate was collected by centrifugation, and the precipitate was resuspended with PBS to obtain a phage antibody library. The titer of the phage antibody library was calculated by the following formula to be 1.28*10^9 PFU / mL.

[0144] Antibody library titer (PFU / mL) = dilution × number of plaques (PFU) / volume of bacterial solution used for plating (mL).

[0145] Example 3 Enrichment and screening of a fully human anti-TPO antigen phage antibody library

[0146] The TPO recombinant antigen (NP_001193673.1) was coated on the immunotube at a concentration of 10 μg / mL, incubated at 4°C overnight, and blocked with 5% skim milk at 37°C for 2 h; after washing twice with PBST, 1 mL of the ScFV phage library prepared in Example 2 was added, incubated at room temperature for 2 h with shaking, washed 10 times with PBST, 1 mL of triethylamine dissociation buffer (100 mM) was added, incubated at room temperature for 10 min, neutralized with 1 M Tris-HCl (PH = 6.4) and 50 mL of E. coli TG1 bacterial solution in the logarithmic growth phase was added, incubated at 37°C for 30 min, 10 μL was taken to coat 2YT-GA solid plates, and the plates were cultured at 37°C overnight to detect the output. The remaining bacterial solution was expanded and cultured until the A600 of the bacterial solution was about 0.5, and then helper phage M13K07 was added. The subsequent process was consistent with Example 2, and the above screening process was repeated for 4 rounds to enrich the phages that bind to the TPO recombinant antigen.

[0147] Example 4 Induced expression of positive phage clones

[0148] Randomly select single colonies after 4 rounds of enrichment in Example 3 in 96 deep-well plates, select 6 plates in total, add 400 μL 2YT-GA medium (2% glucose, 50 μg / mL Amp) to each well, and culture at 37°C overnight. The next day, take 5 μL of overnight cultured bacterial solution and transfer it to a 96-well plate containing 100 μL 2YT liquid medium for activation, culture at 37°C for 2-3 hours, and when the OD value is about 2, add 20 μL 2YT+helper phage (MOI=5) mixed solution to each well and incubate at 37°C for 30 minutes. After 1.5 hours of shaking culture, add 300 μL 2YT-AK (100 μg / mL Amp, 50 μg / mL Kan + ) Overnight culture for 16-18 hours. The next day, centrifuge and take the supernatant to obtain a phage monoclone for subsequent detection.

[0149] Example 5 Phage monoclonal Elisa detection

[0150] TPO recombinant antigen (coating amount 1ug / ml) was coated on the ELISA plate at 4℃ overnight; Casion was blocked at 37℃ for 2h, dried and set aside, monoclonal phage was added, warmed at 37℃ for 30min, washed 6 times with PBST solution, dried, HRP-M13 was added, warmed at 37℃ for 30min, washed 5 times with PBST solution, dried and color developed for 15min, and then 2M H2SO4 was added to terminate the reaction, and the absorbance value at 450nm was detected by ELISA instrument. The test results are as follows:

[0151] Table 2 Phage monoclonal Elisa detection of TPO antibody concentration values ​​(μg / mL)

[0152]

[0153]

[0154] Example 6 Nucleic acid sequence analysis of variable region genes and construction of full-length IgG antibodies

[0155] The two clones with strong reactivity in Example 5 (TH507 and TH512) were sent for sequencing.

[0156] Antibody 1-TH507: its heavy chain variable region has the amino acid sequence shown in SEQ ID NO.8; its light chain variable region has the amino acid sequence shown in SEQ ID NO.16.

[0157] Antibody 2-TH512: its heavy chain variable region has the amino acid sequence shown in SEQ ID NO.24; its light chain variable region has the amino acid sequence shown in SEQ ID NO.32.

[0158] Using the two selected positive monoclonal clones as templates, the variable region genes (VH / VL) were amplified by PCR technology, and spliced ​​with the human constant region CH / CL to obtain the full-length antibody sequence, which was constructed into the laboratory vector pTT5 (Fenghui Biology, BR135) through HindIII / XbaI. After the recombinant plasmid was transferred into competent DH5α cells, the positive clones were selected for sequencing and plasmid extraction, and the full-length TgG antibody plasmids of TH507 and TH512 were obtained respectively.

[0159] Example 7 Full-length IgG Antibody Expression

[0160] The day before transfection, adjust the density of HEK293F cells to 2-2.5×10 6 On the day of transfection, cells were diluted to 3-3.5×10 cells / mL using SMM293-TII medium. 6 Example 6 Obtaining full-length TgG antibody plasmids of TH507 and TH512 According to the instructions of PEI transfection reagent (Polysciences, 24885-2), dilute the antibody plasmid DNA and PEI, transfect the cells at a ratio of 1 μg:5 μL, add 24% CHO feed after 24 hours, culture until the cell viability drops to about 70-75%, harvest the supernatant, and obtain TH507 and TH512 full-length IgG antibody expression fluids, respectively.

[0161] Example 8 Purification of Full-length Human Antibody TPO IgG

[0162] The supernatant obtained from the TPO TH507 and TH512 antibodies in Example 7 (ie, the expression solution of the TH507 and TH512 full-length IgG antibodies) was filtered through a 0.45 μm filter membrane to obtain a filtered antibody supernatant.

[0163] Ultrapure water and buffer (0.02M PBS, pH7.4) were used to balance the chromatography column filled with Protein A filler, the filtered antibody supernatant was loaded, balanced again, and finally the target protein antibody was eluted with dissociation buffer (0.2M glycine + 0.15M NaCl pH2.7), and the dissociation peak was collected to obtain purified TPO TH507 and TH512 antibodies. Then, the spectrophotometer NanoDrop One was used to detect the protein content and the protein expression level was detected by SDS-PAGE and SEC-HPLC.

[0164] The results showed that after purification, the expression levels of TPO TH507 and TH512 antibodies were 150 mg / L and 120 mg / L, respectively, as detected by SDS-PAGE and SEC-HPLC ( Figure 4 ) showed that the antibody purity reached more than 98% (about 150KD), the heavy chain size was about 50KD, and the light chain size was about 25KD, which was consistent with expectations. ( Figure 4 ).

[0165] Example 9: Detection of the titer of fully human TPO full-length IgG antibody

[0166] The purified TPO TH507 and TH512 antibodies in Example 8 were adjusted to a protein concentration of 5 mg / mL, and the anti-thyroid peroxidase antibody detection kit (Kelu (Wuhan) Biotechnology Co., Ltd., ELK9058) was used for detection according to the instructions. According to the kit judgment standard: an activity value greater than 30 IU / mL is considered positive. The test results of the TH507 IgG and TH 512 IgG human antibodies prepared in this experiment are shown in Table 3. The average detection concentrations of TH507 IgG and TH 512 IgG were 298500 IU / mL and 234667 IU / mL, respectively, with strong reactivity, which met the reactivity requirements as quality control products.

[0167] Table 3 TH507 and TH512 IgG antibody reactivity test results

[0168]

[0169] Example 10 Antibody Stability Evaluation and Testing

[0170] The titers of purified TH507 and TH512 IgG antibodies in Example 8 were adjusted to low, medium, and high levels (target values ​​were 75±10, 180±10, and 300±10 IU / mL, respectively). After freeze-drying, the titer variation after 7 days and 14 days of heat acceleration at 37 degrees after reconstitution was assessed. After freeze-drying and reconstitution of the two antibodies, the titer stability variation of the heat-accelerated 7 days and 14 days was less than ±10%, which met the performance requirements of the quality control product, and TH507 had a smaller variation than TH 512 after 37 degrees acceleration. The stability data is shown in Table 4.

[0171] Table 4 TH507 and TH512 IgG antibody stability test results

[0172]

[0173] Example 11 Evaluation and detection of matrix effects between antibody batches and between reagent batches

[0174] The titers of purified TH507 and TH512 IgG antibodies in Example 8 were adjusted to three levels required by the quality control product, Q1, Q2, Q3, and the activity values ​​were 75±10, 180±10, 300±10 IU / mL, respectively. The configured quality control products were tested on three different Antu A2000 plus instruments and Antu anti-thyroid peroxidase antibody detection kits with different reagent batch numbers, and the inter-station difference and inter-test batch difference of the antibodies were assessed. The detection value range of ±10% meets the quality control product use requirements. It can be seen from the data that the inter-station difference and reagent batch difference of TH507 and TH512 IgG are both within 10%, which can meet the performance requirements of the quality control product (Tables 5 and 6).

[0175] Table 5 Matrix effect test results of TH507 and TH512 IgG

[0176]

[0177]

[0178] Table 6 Results of matrix effect test for TH507 and TH512 IgG reagents between batches

[0179]

[0180] Taking into account the fact that the reactivity and stability of TH507 IgG antibody are superior to those of TH512 IgG antibody, TH507 is preferred for use as a quality control and calibrator for the kit.

[0181] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A monoclonal antibody against TPO, characterized in that: It comprises a heavy chain and a light chain; the amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain are GXXFXXXDXX, XXXXXXXNXX, XXXXXXXAXDI, respectively; the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain are SGDXLPKQYAY, KDXERPS, QSADXSGXXXV, respectively; and X is any one of G, A, V, L, I, F, W, Y, D, H, N, E, K, Q, M, R, S, T, C, P, U and O.

2. The monoclonal antibody according to claim 1, characterized in that Include any of the following: (I), the CDR1 of the heavy chain has the amino acid sequence shown in SEQ ID NO.1 or SEQ ID NO.17; and / or The CDR2 of the heavy chain has an amino acid sequence as shown in SEQ ID NO.2 or SEQ ID NO.18; and / or The CDR3 of the heavy chain has an amino acid sequence as shown in SEQ ID NO.3 or SEQ ID NO.19; and / or (II), the CDR1 of the light chain has the amino acid sequence shown in SEQ ID NO.9 or SEQ ID NO.25; and / or The CDR2 of the light chain has an amino acid sequence as shown in SEQ ID NO.10 or SEQ ID NO.26; and / or The CDR3 of the light chain has an amino acid sequence as shown in SEQ ID NO.11 or SEQ ID NO.27; or (III) an amino acid sequence obtained by substituting, deleting or adding one or more amino acids to the amino acid sequence described in (I) or (II), and having the same function as the amino acid sequence described in (I) or (II); or (IV) An amino acid sequence having 90% or more identity with the amino acid sequence described in any one of (I) to (III).

3. A nucleic acid molecule encoding the monoclonal antibody according to claim 1 or 2.

4. An expression vector, characterized in that Comprising the nucleic acid molecule as described in claim 3.

5. A host, characterized in that Comprising the expression vector as claimed in claim 4.

6. The method for preparing a monoclonal antibody according to claim 1 or 2, characterized in that: The host according to claim 5 is cultured, the supernatant is harvested, and the monoclonal antibody is obtained by separation and purification.

7. Use of any of the following in the preparation of products for testing TPO: (I), the monoclonal antibody according to claim 1 or 2; and / or (II), the nucleic acid molecule according to claim 3; and / or (III), the expression vector according to claim 4; and / or (IV), the host according to claim 5; and / or (V) A monoclonal antibody prepared by the preparation method according to claim 6.

8. Use of any of the following in the preparation of products for diagnosis, prevention and / or treatment of thyroid function: (I), the monoclonal antibody according to claim 1 or 2; and / or (II), the nucleic acid molecule according to claim 3; and / or (III), the expression vector according to claim 4; and / or (IV), the host according to claim 5; and / or (V) A monoclonal antibody prepared by the preparation method according to claim 6.

9. A drug or a drug combination, characterized in that Include any of the following: (I), the monoclonal antibody according to claim 1 or 2; and / or (IV) A monoclonal antibody prepared by the method of claim 6.

10. A reagent combination or a kit, characterized in that: Including any of the following: (I), the monoclonal antibody according to claim 1 or 2; and / or (IV) A monoclonal antibody prepared by the method of claim 6.

Images