Rape green revolution gene bgr and application thereof

Abstract

The invention discloses an oilseed rape green revolution gene bgr and application thereof. The gene bgr can obviously reduce the height of the rape plant, the stem is thick and strong, lodging resistance is realized, the branching angle is reduced, the plant type is compact, and the harvest index is effectively improved. The gene has remarkable heterosis, the heterozygous bgr can enable tetraploid rapes (brassica napus and brassica juncea) to have ideal plant type characteristics, the plant height is 120-160 cm, the plant type is compact, the branching angle is small (1t, 30 degrees), the position of a first branch is lowered, the harvest index is increased by about 27%, the gene is suitable for close planting, and the yield is greatly increased by 11-27%. The oil content of the hybrid brassica napus with bgr is greatly increased, can reach 51.7-54.86%, and is increased by 9.14-19.26% compared with that of a common high-oil-content rape variety. The invention contributes to valuable gene resources for rape breeding, and provides an effective means for creation of new rape germplasm.

Description

[0001] The present invention is a divisional application of the Chinese patent application with application number CN202211177399.1 and invention name “Rapeseed Green Revolution Gene bgr and Its Application”. Technical Field

[0002] The invention belongs to the technical field of plant gene engineering, and in particular relates to rapeseed green revolution gene bgr and its application. Background Art

[0003] Rapeseed is an important oil crop. Rapeseed belongs to the Brassicaceae family, Brassica genus. Brassica In the 1930s, Japanese scholars Sheng Yonghe, Yu Changchun and others divided Brassica plants into three basic species and three complex species. The three basic species are Brassica rapa ( Brassica rapa , AA, 2n=20), black mustard ( Brassica nigra , BB, 2n=16) and Brassica oleracea ( Brassica oleracea , CC, 2n=18); 3 composite species are Brassica napus ( Brassica napus , AACC, 2n=38), Brassica juncea ( Brassica juncea , AABB, 2n=36) and Ethiopicus mustard ( Brassica carinata , BBCC, 2n=34), it is believed that the composite species is formed by the natural hybridization of the basic species and the doubling of chromosomes. At present, the main rapeseed varieties in China are mainly cabbage rapeseed, and mustard rapeseed and cabbage rapeseed are also planted in small areas. The rapeseed planting area in China is about 100 million mu. Europe, Canada and India are also important rapeseed production areas.

[0004] Looking at the current status of rapeseed breeding at home and abroad, although rapeseed breeding has achieved the improvement of "low erucic acid and low glucosinolate" quality and increased oil content, the overall average yield of rapeseed per unit area is low.

[0005] In the last century, the successful application of "Green Revolution" genes in crops such as wheat and rice improved their plant type, such as semi-dwarfing of plants, which in turn enhanced lodging resistance and greatly increased yield and harvest index. In view of the common problems of plant height, wide canopy, and easy lodging in current rapeseed varieties, plant type breeding is a focal issue in rapeseed breeding. The ideal plant type of rapeseed refers to a semi-dwarf plant type, a plant height of 120-140 cm, a compact plant type with a branching angle of <30°, and upright, dense, and medium-length siliques. The "Green Revolution" genes have not yet been applied in rapeseed breeding, so finding the "Green Revolution" genes of rapeseed and obtaining new rapeseed germplasm with ideal plant type characteristics is the key to breaking through the bottleneck of plant type breeding in global rapeseed. Summary of the invention

[0006] The purpose of the present invention is to provide rapeseed green revolution gene bgr and application thereof.

[0007] Another object of the present invention is to provide a method for creating new germplasm of Brassica napus.

[0008] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides a rapeseed green revolution gene bgr, which is a gene encoding the following protein (a) or (b): (a1) a protein consisting of the amino acid sequence shown in SEQ ID NO:4; (b1) A protein derived from (a1) with the sequence shown in SEQ ID NO:4 replaced, deleted or added with one or more amino acids and having equivalent functions.

[0009] The genomic DNA sequence of gene bgr is: i) the nucleotide sequence shown in SEQ ID NO: 1; ii) a nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 1 and the nucleotide sequence expresses a protein with the same function; iii) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:1 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS at 65°C and the membrane is washed with the solution; or

[0010] iv) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses a protein with the same function.

[0011] The CDS sequence of gene bgr is: i) the nucleotide sequence shown in SEQ ID NO: 3; ii) a nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 3 and the nucleotide sequence expresses a protein with the same function; iii) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:3 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS at 65°C, and the membrane is washed with the solution; or

[0012] iv) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses a protein with the same function.

[0013] The rapeseed green revolution genebgr From Brassica napus mutant bgr-JT . bgr-JT The ethyl methanesulfonate (EMS) was used to treat Brassica napus Jietou No. 2 ( Brassica rapa , diploid, 2n=20, chromosome set AA) were chemically induced to obtain a dwarfed, compactly branched Brassica rapa-type rapeseed mutant with the characteristics of an ideal plant type.

[0014] In a second aspect, the present invention provides homologous genes of the rapeseed green revolution gene bgr, a total of 7 homologous genes, namely mBnaA01T000997, mBnaA03T004751, mBnaA08T002216, mBnaC03T001151, mBnaC04T001741, mBnaC04T005325 and mBnaC07T004394; Among them, mBnaA01T000997 is a gene encoding the following protein (a2) or (b2): (a2) a protein consisting of the amino acid sequence shown in SEQ ID NO: 23; (b2) a protein derived from (a2) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 23; mBnaA03T004751 is a gene encoding the following protein (a3) ​​or (b3): (a3) a protein consisting of the amino acid sequence shown in SEQ ID NO: 25; (b3) a protein derived from (a3) ​​having the same function as that of SEQ ID NO:25, wherein one or more amino acids are substituted, deleted or added. mBnaA08T002216 is a gene encoding the following protein (a4) or (b4): (a4) a protein consisting of the amino acid sequence shown in SEQ ID NO: 27; (b4) a protein derived from (a4) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 27; mBnaC03T001151 is a gene encoding the following protein (a5) or (b5): (a5) a protein consisting of the amino acid sequence shown in SEQ ID NO: 29; (b5) a protein derived from (a5) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO:29; mBnaC04T001741 is a gene encoding the following protein (a6) or (b6): (a6) a protein consisting of the amino acid sequence shown in SEQ ID NO:31; (b6) a protein derived from (a6) having the same function as that of SEQ ID NO:31, wherein one or more amino acids are substituted, deleted or added. mBnaC04T005325 is a gene encoding the following protein (a7) or (b7): (a7) a protein consisting of the amino acid sequence shown in SEQ ID NO:33; (b7) a protein derived from (a7) having the same function as that of SEQ ID NO:33, wherein one or more amino acids are substituted, deleted or added. mBnaC07T004394 is a gene encoding the following protein (a8) or (b8): (a8) a protein consisting of the amino acid sequence shown in SEQ ID NO:35; (b8) A protein derived from (a8) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 35.

[0015] In a third aspect, the present invention provides biological materials containing the rapeseed green revolution gene bgr or the homologous gene, wherein the biological materials include but are not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors or engineered bacteria.

[0016] In a fourth aspect, the present invention provides any of the following applications of the rapeseed green revolution gene bgr or the homologous gene or the biological material: (1) Used to regulate plant height, plant shape, leaf shape, oil content and yield; (2) for plant variety improvement; (3) Used for preparing transgenic plants.

[0017] The plant type includes but is not limited to branch angle and branch number.

[0018] In the present invention, the plant is a Brassica plant, preferably rapeseed, more preferably tetraploid rapeseed, and most preferably Brassica napus ( Brassica napus ), Brassica juncea ( Brassica juncea ).

[0019] In a fifth aspect, the present invention provides a method for reducing the plant height of rapeseed, reducing the branch angle, making the plant compact, the leaves wrinkled, the oil content increased, and the yield increased, the method comprising: using genetic engineering means, gene editing means, chemical and / or physical mutagenesis means, and plant hybridization means to introduce mutations into the rapeseed genome, so that the E in the conserved motif LGTPTRE in the glycogen synthase kinase 3β (GSK3β) encoded by it and its homologous proteins is mutated to K; or,

[0020] The rapeseed green revolution gene bgr or the homologous gene is introduced into rapeseed via a plasmid or integrated into rapeseed chromosomes via genetic engineering.

[0021] The rapeseed is preferably tetraploid rapeseed, more preferably Brassica napus or Brassica juncea.

[0022] Further, the method comprises: overexpressing the rapeseed green revolution gene bgr or the homologous gene in the plant; The overexpression method is selected from the following 1) to 5), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the plant chromosome; 3) by changing the promoter sequence of the gene on the plant chromosome; 4) by operably linking a strong promoter or a weak promoter to the gene; 5) By introducing enhancers.

[0023] Preferably, the promoter is Brassica napus ( Brassica rapa ) GSK3β protein bgr or BGR gene promoter, the nucleotide sequence of which is: i) the nucleotide sequence shown in SEQ ID NO:7; ii) a nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 7 and which has the same promoter function; iii) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:7 under stringent conditions and has the same promoter function, wherein the stringent conditions are hybridization in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS at 65°C and the membrane is washed with the solution; or

[0024] iv) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of i), ii) or iii) and has the same promoter function.

[0025] In a sixth aspect, the present invention provides the use of the transgenic rapeseed obtained according to the method in plant breeding.

[0026] Breeding methods include, but are not limited to, transgenic, hybridization, backcrossing, selfing, or asexual reproduction.

[0027] Preferably, the obtained transgenic rapeseed is used as a maintainer line to create a rapeseed sterile line or a restorer line.

[0028] In the seventh aspect, the present invention provides a method for creating new germplasm of Brassica napus, using genetic engineering technology (such as gene editing or transgenic technology) or mutagenesis technology to introduce mutations into the diploid rapeseed genome, so that the E in the conserved motif LGTPTRE in the glycogen synthase kinase 3β encoded by it mutates to K (as shown in SEQ ID NO:4), thereby obtaining a rapeseed mutant with ideal plant characteristics; then, the rapeseed mutant is hybridized with Brassica napus and combined with microspore culture technology to obtain Brassica napus breeding material.

[0029] In a specific embodiment of the present invention, CRISPR / Cas9 gene editing technology is used to introduce mutations into the diploid rapeseed genome, and the guide editing sequence is preferably as shown in SEQ ID NO:36.

[0030] In an eighth aspect, the present invention provides a method for creating new germplasm of Brassica napus, by introducing mutations into the tetraploid rapeseed genome using genetic engineering technology (such as gene editing or transgenic technology) or mutagenesis technology, so that the E in the conserved motif LGTPTRE in the glycogen synthase kinase 3β encoded by it mutates to K (as shown in SEQ ID NO:4), thereby obtaining a rapeseed mutant with ideal plant characteristics.

[0031] In a ninth aspect, the present invention provides a glycogen synthase kinase 3β mutant, the mutant comprising a mutation of E in the conserved motif LGTPTRE in glycogen synthase kinase 3β from E to an amino acid other than E (preferably a mutation from E to K). The glycogen synthase kinase 3β is from rapeseed.

[0032] In the tenth aspect, the present invention provides a method for breeding new varieties of Brassica napus, based on the use of the above-mentioned genetic engineering technology (such as gene editing or transgenic technology) or mutagenesis technology to obtain rapeseed mutants with ideal plant characteristics, creating dwarf rapeseed sterile lines or restorer lines, and producing hybrids through three-line matching.

[0033] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: This invention discovered rapeseed green revolution gene for the first time bgr (SEQ ID NO:1 and SEQ ID NO:3) ，This gene can significantly reduce the height of rapeseed plants, make the stems thicker, resist lodging, reduce the branch angle, make the plant compact, and effectively improve the harvest index. This gene has significant hybrid vigor, and heterozygous bgr It can make tetraploid rapeseed (Brassica napus and Brassica juncea) have more ideal plant characteristics, with plant height of 120-160 cm, compact plant type, small branching angle (<30°, the current branching angle of rapeseed is greater than 30°), the first branch position is lowered, the harvest index is increased by about 27%, suitable for dense planting (30,000-40,000 plants / mu, the current planting density of Brassica napus is 15,000-20,000 plants / mu), and the yield is greatly increased by 11-27%. bgr The oil content of hybrid rapeseed is greatly improved, and the oil content can reach 51.7-54.86%, which is 9.14-19.26% higher than that of ordinary high-oil rapeseed varieties (46.00-47.37%). The present invention contributes valuable gene resources to rapeseed breeding and provides an effective means for the creation of new rapeseed germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is a diagram of the pHZM137-BrBGRpro vector in a preferred embodiment of the present invention.

[0035] Figure 2 In the preferred embodiment of the present invention BrBGR and Brbgr Functional analysis in Brassica napus. WT, wild-type westar; BGR , driven by its own promoter BrBGR phenotype of the genetic strain; bgr , driven by its own promoter Brbgr Phenotypes of genotyped strains.

[0036] Figure 3 In the preferred embodiment of the present invention bgr Effects on plant types of different Brassica plants. bgr-JT The hybrid phenotype of Brassica rapa with yellow-seeded Sassoon, the left is F1, the right is yellow-seeded Sassoon; B, the mustard head 2 mutant bgr-JT Hybrid phenotypes with Brassica napus Westar, Westar on the left and F1 on the right; C, Brassica napus 2 mutant bgr-JT The hybrid phenotype with rapeseed FY02, with rapeseed FY02 on the right and F1 on the left.

[0037] Figure 4 These are some of the DH strains of Brassica napus in the preferred embodiments of the present invention, wherein DH56 and DHD1 are respectively the tall and short strains of Brassica napus separated by microspore culture.

[0038] Figure 5 The Brassica napus mutant in the preferred embodiment of the present invention is bgr Among them, C76 Brassica napus; Brassica napus bgr Strain DHD1.

[0039]

[0040] Figure 8 The figure is a schematic diagram of the gene editing vector in the preferred embodiment of the present invention, wherein pHZM184B is the editing vector constructed by our laboratory; gK1 is the vector for editing the K1 site; and gK2 is the vector for editing the K2 site.

[0041] Figure 9 Part of the preferred embodiment of the present invention bgr The knockout phenotype. Bnbgr ,exist bgr Phenotype of editing the K2 locus in the background; g1-1 / Bnbgr ,exist bgr The phenotype of editing the K1 site in the background; Bnbgr , Dwarf Brassica napus bgr ; A, B and C, respectively g2-1 / Bnbgr 、g1-1 / Bnbgr and Bnbgr Enlarged view of the rosette leaves.

[0042]

[0043] Figure 11 In the preferred embodiment of the present invention bgr Phenotypes of transgenic plants of homologous gene mutants. mBnaA01T000997 , mBnaA03T004751 , mBnaA08T002216 , mBnaC03T001151 , mBnaC04T001741 , mBnaC04T005325 and mBnaC07T004394 Phenotypes of the mutants.

[0044] Figure 12 This is a diagram of the BGR guide sequence editing vector in a preferred embodiment of the present invention. Among them, M_MLV_RT, MoloneyMurine Leukemia Virus Reverse Transcriptase. Cas9, SpCas9 840H mutation to A. DETAILED DESCRIPTION

[0045] The present invention establishes a set of efficient creation system of new germplasm of Brassica napus. The system obtains mutants with breeding potential and ideal plant characteristics through EMS mutagenesis of diploid rapeseed, hybridizes mutants with tetraploid rapeseed and combines microspore culture technology to achieve rapid fixation of traits and homozygosity of materials, and finally obtains Brassica napus breeding materials with breeding potential.

[0046] The present invention is the first to discover and utilize the ideal plant type gene of rapeseed bgr The ideal strain type gene is a gain-of-function gene caused by a point mutation, and the E in the BGR conservative sequence LGTPTRE of the encoded protein is mutated to K.

[0047] Further, bgr Genes are used for tetraploid rapeseed improvement.

[0048] Furthermore, the homozygous bgr Hybridization with conventional tetraploid rapeseed yielded F1 with hybrid vigor.

[0049] Furthermore, the homozygous bgr Brassica napus can be used as a maintainer line for cytoplasmic male sterile lines, and the traits of dwarfing and compact plant type can be transferred into a male sterile line with dwarfing and compact plant type through hybridization and continuous backcrossing.

[0050] Furthermore, the sterile line with dwarfed plants and advanced plant shape obtained above is hybridized with a restorer line to obtain F1 seeds, and the F1 seeds can be used for rapeseed production and can be used for dense planting to obtain rapeseed with high yield and high oil content.

[0051] Through breeding analysis, it was found that bgr The gene has no hybrid breeding potential in the diploid rapeseed background, but has great breeding potential in the tetraploid background.

[0052] Furthermore, the ideal plant type of rapeseed was obtained through map-based cloning. bgr Gene. Sequence analysis revealed that the phenotype is due to BGR The 2191th base in the 9th exon of the gene mutated from G to A, causing the 293rd amino acid in the amino acid sequence it encodes to change from E (glutamic acid) to K (lysine). This gene encodes a glycogen synthase kinase3β (GSK3β). bgr The gene is a gain-of-function gene. The mutation site of the protein it encodes is located within the conserved LGTPTRE motif of GSK3β in animals and plants, and the E in the protein is mutated to K.

[0053] Further homologous gene analysis revealed that there are 8 copies (8 homologous genes) in the rapeseed genome. Site-directed mutagenesis revealed that the other 7 copies were bgr The same mutation ( Figure 11 ), can cause bgr Similar phenotypes. In addition, the proteins encoded by homologous genes in other species, whose E in the conserved GTPTRE motif mutates to K, all have the function of regulating rapeseed plant type. Therefore, it can be seen that the mutation of E to K in the LGTPTRE motif of this type of protein can make rapeseed plants dwarfed and reduce the branching angle.

[0054] Furthermore, by gene editing, the E of LGTPTRE in the BGR protein was changed to K, and Brassica napus plants with dwarfed and compact plant shapes could be obtained.

[0055] Further, BGR In vitro site-directed mutagenesis of genes (genomic DNA and cDNA) bgr (genomic DNA and its cDNA), and the mutated gene bgr By transferring into tetraploid rapeseed, we can obtain rapeseed breeding materials with dwarfed plants and compact plant shape.

[0056] Further, using BGR / bgr Self-promoter driven bgr Gene, used for tetraploid rapeseed improvement.

[0057] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions.

[0058] Example 1 Brassica rapa bgr Map-based cloning of genes

[0059] 1. Brbgr Positioning

[0060] The seeds of Brassica rapa L. were treated with 0.5% EMS. A Brassica rapa mutant with dwarfed plants and compact branches was obtained through EMS mutagenesis. bgr-JT , with the characteristics of an ideal plant type. This mutant was hybridized with Beijing Kuaicai to construct an F2 population. B. rapa Chiifu_V3.0 (http: / / brassicadb.cn) was used as the reference genome. Using Mutmap technology, we initially bgrThe gene was located at A4:14035360 bp-20192770 bp. Fine positioning was performed using SSR markers, and the interval was located at A4:16312022-16495148. In this interval, only the coding region of BraA04g022200 had SNP variation, that is, the coding region of BraA04g022200 in tall plants did not have SNP variation, while the coding region of BraA04g022200 in short plants had SNP variation. According to functional annotation, BraA04g022200 encodes a glycogen synthase kinase 3β (GSK3β), which has 96.79% sequence similarity with AT2G30980 (BIL1). This gene is a core negative regulatory element of the brassinolides (BRs) signaling pathway and is also involved in the auxin signaling pathway. We named BraA04g022200 BGR , whose genes with SNP variations are named bgr .

[0061] 2. Brassica rapa BrBGR and Brbgr Clone

[0062] In order to obtain the full-length transcript of the genome, we used the Trizol method to extract total RNA from five tissues of the mutant, including roots, stems, leaves, flowers, and siliques. After equal amounts were mixed, the full-length transcript was obtained using PacBio sequencing technology. Based on the full-length transcript, primers BrBGR-F and BrBGR-R were designed, and genomic DNA and cDNA were used to obtain BrBGR The full length of DNA and CDS.

[0063] Primer BrBGR-F sequence: agcaggctttgactttATGACCTCACTATCATTGGGGC (lowercase letters represent the linker on the vector)

[0064] Primer BrBGR-R sequence: tgggtctagagactttccATGACCAGGCTGTGATGGGAA (lowercase letters represent the linker on the vector)

[0065] DNA extraction: Genomic DNA was extracted using the CTAB method. Take 100 mg of fresh tissue, grind it with liquid nitrogen, add 1 mL CTAB extraction buffer (4.1 g NaCl dissolved in 80 mL H2O, slowly add 10 g CTAB, add water to 100 mL); add 200 μL chloroform, place in a 65°C water bath for 10 min, centrifuge at 10,000 rpm for 10 min, and remove the supernatant; add 1 / 2 volume of isopropanol, centrifuge at 10,000 rpm for 5 min, and discard the supernatant; add 500 μL 70% ethanol, centrifuge for 5 min, and discard the supernatant; after drying, add TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) for use.

[0066] Extraction of total RNA: Grind the sample in liquid nitrogen and dispense the powder into 1.5 mL centrifuge tubes (about 0.1 g sample per tube); add 1 mL Trizol to the centrifuge tube, vortex to mix, and place at room temperature for 10 min; add 200 μL chloroform, vortex to mix, and place at room temperature for 5 min; centrifuge at 13,000 rpm for 15 min at 4°C, and take the supernatant into a new centrifuge tube; add 500 μL isopropanol, gently invert to mix, and place at room temperature for 10-15 min; centrifuge at 13,000 rpm for 15 min at 4°C; discard the supernatant, add 1 mL 70% ethanol (for RNA) to wash the precipitate, and centrifuge at 13,000 rpm for 5 min; blow the precipitate on a clean bench for 5-10 min, add a certain amount of RNAase-free water to dissolve it, and set aside.

[0067] Synthesis of cDNA: Take an appropriate amount of DNA-free total RNA and use a reverse transcription kit to transcribe the RNA into cDNA for later use.

[0068] PCR program: 98°C for 3 min; 98°C for 10 s, 60°C for 0.5-2 min, 72°C for 2 min, 28-35 cycles, 72°C for 3 min.

[0069] PCR system: 1 μL template, 10 μL Q5 ® High-Fidelity 2× Master Mix, 0.5 μL each of upstream and downstream primers, 8 μL ddH2O.

[0070] Using DNA or cDNA as a template, PCR amplification was performed to obtain the expected size fragment, which was then connected to the entry vector pGWC (kindly donated by Professor Chen Qijun of China Agricultural University) through in-fusion cloning. Sequencing analysis was then performed.

[0071] Vector digestion: 42 μL pGWC (200 ng / μL), 3 μL Ahd I, 5 μL 10×CutSmart buffer. 37℃ 2 hr, 65℃ 10 min. Reserve.

[0072] Seamless cloning: 4 μL 2× in-fusion mix, 2 μL digested plasmid, 2 μL PCR product.

[0073] Transformation of large intestine: The ligation product was transformed into DH5α by heat shock method, clones were picked, PCR detection was performed, and sequencing analysis was performed.

[0074] Sequence analysis of genes: Brbgr and BrBGR The full-length DNA sequences were named gBrbgr (SEQ ID NO: 1) and gBrBGR (SEQ ID NO: 2), the DNA sequence length of their coding regions is 2873 bp; the CDS sequences are named Brbgr (SEQ ID NO:3) and BrBGR (SEQ ID NO: 5) and, both of which are 1233 bp in length, encode a peptide chain consisting of 410 amino acids, Brbgr and BrBGR The encoded amino acid sequences are shown in SEQ ID NO: 4 and SEQ ID NO: 6, respectively.

[0075] BrBGRThe DNA sequence consists of 12 exons and 11 introns: 1-105 bp is the first exon, 106-680 bp is the first intron, 681-773 bp is the second exon, 774-962 bp is the second intron, 963-1022 bp is the third exon, 1023-1112 bp is the third intron, 1113-1385 bp is the fourth exon, 1386-1473bp is the fourth intron, 1474-1548 bp is the fifth exon, 1549-1625 bp is the fifth intron, 1626-1683 bp is the sixth exon, 1684-1781 bp is the sixth intron, 1782-1920 bp is the seventh exon, 1921-2009 bp is the seventh intron, 2010-2060 bp is the eighth exon, 2061-2169 bp is the eighth intron, 2170-2265 bp is the ninth exon, 2266-2354 bp is the ninth intron, 2355-2438 bp is the tenth exon, 2439-2555 bp is the tenth intron, 2556-2657bp is the eleventh exon, 2658-2777 bp is the eleventh intron, and 2778-2873bp is the twelfth exon. Brbgr With g BrBGR In contrast, at exon 9, g Brbgr There is a SNP mutation G2191A, which causes a change in the amino acid of the protein it encodes, that is, the amino acid at this position changes from glutamic acid (E) to lysine (K), marked as E293K.

[0076] Example 2 Brassica rapa bgr Cloning of gene promoter

[0077] Containing bgr The DNA of the 2nd mutant of Brassica rapa with the gene was used as a template and the primer pair (BrBGR_P-F1 and R1) was used to clone it into bgr / BGR The promoter region of -1234 bp upstream of the start codon was cloned into the pHZM137 binary vector, replacing the CaMV35S promoter, to obtain the vector pHZM137-BrBGRpro ( Figure 1 ).

[0078] BrBGR_P-F1: cacacttattacaggcctATGTTCGAAATCTACAAATAAGGAGCC (lowercase letters represent the linker on the vector)

[0079] BrBGR_P-R1: aacttgtgatctcgagGTGCTATTCTTCTCTCTCTCTCTCTAACTT (lowercase letters represent the linker on the vector)

[0080] Brassica rapa bgr The gene promoter sequence is shown in SEQ ID NO:7.

[0081] The pHZM137 binary vector was constructed as follows: the insulator gypsy (kindly donated by Professor Wang Junhui of Zhejiang University, see She W, Lin W, Zhu Y, Chen Y, Jin W, Yang Y, Han N, Bian H, Zhu M, Wang J. The gypsy insulator of Drosophila melanogaster, together with its binding protein suppressor of Hairy-wing, facilitate high and precise expression of transgenes in Arabidopsis thaliana. Genetics. 2010 Aug;185(4):1141-50. doi:10.1534 / genetics.110.117960. Epub 2010 Jun 1. PMID: 20516496; PMCID:PMC2922898.) was inserted into the 2 site of the vector pEarleyGate 100 ( Pme I and Ahd I Room and Stu I site); then Pme The hygromycin expression cassette from the vector pH7GWIWG2(II) was inserted into the I site, and finally Avr II and Spe I, a synthetic 3× flag (5′-GACTACAAGGATGACGATGACAAGGGCGCCGATTATAAAGATGACGATGACAAGCAATTGGACTATAAGGACGATGACGATAAATCTAGA-3′) was inserted.

[0082] Example 3 Brbgr and BrBGR Effects on rapeseed plant type

[0083] Will BrBGR and BrbgrThe vector was transformed into pHZM137-BrBGRpro by LR recombination reaction. The vector was transformed into Agrobacterium (GV3101) by heat shock method and into Brassica napus (Westar) by hypocotyl infection method. The transformation method was similar to that of Block et al. BrBGR and Brbgr Effect of expression on plant architecture of Brassica napus.

[0084] Phenotypic observation of transgenic Brassica napus: using BrBGR Driven by its own promoter Brbgr The rapeseed plants will be significantly shorter, the leaves will shrink, and the branch angle will decrease. BrBGR There is no significant difference in appearance between the strain and the wild type ( Figure 2 ).

[0085] visible, Brbgr It plays an important role in improving plant height and branch angle.

[0086] Example 4 Brassica rapa bgr Gene regulation of plant architecture in Brassica plants

[0087] In Brassica napus ( Brassica napus , AACC, 2n=38) and Brassica juncea ( Brassica juncea , AABB, 2n=36), all of which contain the AA subgenome. bgr As the male parent, Brassica napus Zheyou 50 and Brassica juncea FY02 (materials preserved in the State Key Laboratory of Plant Cells and Chromosomes, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences) were used as the female parents. Interspecific hybridization within the genus was performed, and both obtained F1 generation lines with dwarf plant type and compact branches ( Figure 3 ). This indicates that the bgr Functionally conservative.

[0088] Example 5 Obtaining new Brassica napus germplasm with ideal plant type characteristics

[0089] The Brassica napus C76 was used as the female parent and the dwarf mutant of Brassica juncea 2 was used as the female parent. bgr-JT Using 1BC1 as the male parent, we performed intra-genus interspecific hybridization to obtain F1 seeds; among the F1, we selected offspring with compact plant type and dwarfed plant height for backcrossing with Brassica napus C76; among the F1BC1 offspring, we selected offspring with compact plant type and dwarfed plant height for backcrossing with Brassica napus C76. We selected flower buds produced by the offspring of F1BC2 with compact plant type and dwarfed plant height for microspore culture, and obtained DH-series materials of Brassica napus with dwarfed and compact plant type through haploid technology. Bnbgr , such as DHD1 ( Figure 4), and also obtained tall Brassica napus DH lines, such as DH56 ( Figure 4 ).

[0090] The process of microspore culture is as follows: take flower buds with a size of 3 mm, soak them in 75% ethanol for 30-60 seconds, soak them in 8% sodium hypochlorite for 15 minutes, and wash them with sterile pure water for 3-5 times; grind the flower buds in a mortar and filter them; use NLN liquid culture medium (0.025 mg / L cobalt chloride hexahydrate, 0.025 mg / L anhydrous copper sulfate, 36.7 mg / L sodium ferric ethylenediaminetetraacetate, 10 mg / L boric acid, 18.95 mg / L manganese sulfate, 0.25 mg / L sodium molybdate, 10 mg / L zinc sulfate, 500 mg / L calcium nitrate, 125 mg / L potassium nitrate, 125 mg / L potassium dihydrogen phosphate, 61 mg / L magnesium sulfate, 0.05 mg / L biotin, 0.5 mg / L folic acid, 800 mg / L glutamine, 30 mg / L reduced L-glutathione, 2 mg / L glycine, 100 mg / L inositol, 5 mg / L niacin, 0.5 mg / L pyridoxine hydrochloride, 100 mg / L L-serine, 0.5 mg / L thiamine hydrochloride) and centrifuged at 2000 rpm at 4°C for 3 times; finally, the microspores were suspended in NLN liquid medium until the microspore concentration was controlled at 10 4 -10 5 / mL; dispense into glass culture dishes with a diameter of 9 cm, add colchicine (5 mg / L), place in a 32°C incubator for heat shock treatment, dark treatment for 2 days, then place in a 25°C dark culture for 10-15 days, culture on a shaker at 25°C, 50 rpm for 10-15 days, and transfer to B5 solid culture medium for germination.

[0091] Example 6 Brassica napus bgr Agronomic traits

[0092] After years of observations on planting in Beijing Changping Farm, Bnbgr The plant shape is stable, the leaves are wrinkled, the plant height is about 50 cm, the main branches are 5-6, and the branch angle is about 15° ( Figure 5 ), the siliques are short, with 5-25 grains in each silique.

[0093] Compared with the control, C76, a mutant of Brassica napus bgrPlant height, branch angle, branch number, biological yield per plant, and yield per plant decreased by 63.57%-64.15%, 46.66%-63.98%, 11.36%-53.64%, 51.22%-56.17%, and 39.89%-62.08%, respectively. However, harvest index, silique density, number of siliques in the main inflorescence, and total number of siliques increased by 23.22%-33.22%, 251.04%-395.46%, 90.07%-100.94%, and 37.25%-74.13%, respectively.

[0094] Example 7 Brassica napus Bnbgr Genetic characteristics

[0095] Brassica napus Bnbgr The strain DHD1 was reciprocally crossed with the tall stem material DH56 (plant height of about 170 cm), and it was found that the offspring had compact plant type and dwarfed plant height, and the performance was consistent. Therefore, it can be judged that this trait is not maternally inherited. The trait segregation statistics of the F2 generation population showed that the segregation ratio of dwarf type: intermediate type: tall stem type was 98:238:86. The chi-square test showed that it conformed to Mendel's single gene inheritance law of 1:2:1, confirming that the phenotype was controlled by a single gene. This can prove bgr It is an incompletely dominant (semi-dominant) inheritance controlled by a single gene.

[0096] Example 8 Brassica napus Bnbgr Changes of hormones in strains

[0097] In order to analyze the changes in hormones in mutants, the dwarf Bnbgr The changes in the content of brassinolide (BL), castasterone (CS), 6-deoxoCT (6-deoxocathasterone), typhasterol (TY), and teasterone (TE) in the seedling stage and apical meristem of strain DHD1 and tall DH56 were detected. First, the seedlings or apical meristems that were germinated for 3-5 days were taken, quickly frozen in liquid nitrogen, ground, and placed at -80℃ for later use after packaging. The determination method was based on the method Xin.

[0098] The results showed that, in both the seedling stage and the apical meristem, except for TE, the contents of BL, CS, TY and 6-deoxoCT were significantly increased compared with those of Brassica napus DH56 ( Figure 6 ).

[0099] At the same time, we have BnbgrThe levels of salicylic acid (SA), gibberellin A1 (GA1), gibberellin A3 (GA3), gibberellin A4 (GA4), gibberellin A7 (GA7), 3-indoleacetic acid (IAA), abscisic acid (ABA), jasmonic acid (JA), jasmonic acid-isoleucine (JA-Ile), aminocyclopropane-l-carboxylic acid (ACC), trans-zeatin (tZ) and trans-zeatin-riboside (tZR) in the apical meristem of strains DHD1 and tall-pole DH56 were determined.

[0100] The results showed that compared with DH56, the contents of ACC, ABA and GA7 in DHD1 were significantly increased; the contents of IAA, GA4, SA, JA and JA-Ile were significantly decreased; and the contents of tZ, tZR and GA3 did not change significantly ( Figure 7 ).

[0101] Example 9 New germplasm of Brassica napus Bnbgr De novo genome assembly

[0102] Dwarf, compactly branched Brassica napus Bnbgr The strain DHD1 is a breeding material obtained by distant hybridization combined with microspore culture. Its gene arrangement and chromosome structure may be quite different from those of existing Brassica napus. Its genome was assembled de novo using the CCS (Circular Consensus Sequencing) sequencing mode and HiC technology provided by PacBio. The total size of the assembled genome was 1063158305 bp, Contig N50 was 10122184 bp, there were 2006 contigs in total, and the proportion of contigs in the genome was 99.99%. Using BUSCO (Benchmarking Universal Single-Copy Orthologs: http: / / busco.ezlab.org / ), the completeness of the Brassica napus genome was 99.9%, and the completeness was relatively high through the evaluation of 2121 single-copy genes of eudicots. This provides a high-quality reference genome for the positioning of candidate genes.

[0103] Example 10 Cloning of the BGR gene in Brassica napus

[0104] To further determine whether the short-stemmed, compactly branched Brassica oleracea mutant originated from the Brassica rapa mutant, Brbgr We used the F2 genetic segregation population (DHD1 as the father and DH56 as the mother) to perform preliminary positioning using the BSA method and fine positioning using the SSR method. Finally, BnaA04T002134 located on chromosome A04 was identified as the candidate gene Bnbgr We use Bnbgr The genomic information of strain DHD1 was cloned using a pair of primers (BnBGR.F and BnBGR.R). Bnbgr and BnBGR The method is as in Example 1.

[0105] Primer BnBGR.F: agcaggctttgactttATGACCTCACTATCATTGGGGC (lowercase letters represent the linker on the vector)

[0106] Primer BnBGR.R: tgggtctagagactttccATGACCAGGCTGTGATGG (lowercase letters represent the linker on the vector)

[0107] Sequence analysis showed that the short stem and compact branching Brassica napus Bnbgr Full-length DNA sequence and short-stemmed, compactly branched Brassica rapa-type Brassica napus 2 Brbgr Completely identical (SEQ ID NO: 1); Brassica napus BnBGR The genome sequence of Brassica napus L. (gBnBGR) and Brassica napus L. 2 BrBGR The full-length DNA sequence is completely identical (SEQ ID NO: 2), tall Brassica napus BnBGR Brassica napus Bnbgr The full-length DNA sequence underwent a single base change at position 2191, which was a conversion from G to A.

[0108] DHD1 in Brassica napus Bnbgr The CDS sequence of BnBGR The CDS sequence of was different from that of in only one position, i.e., position 877 was converted from G to A.

[0109] DHD1 in Brassica napus Bnbgr Brassica napus L.2 BrbgrCompletely identical (SEQ ID NO: 3); tall stalk Brassica napus DH56 BnBGR Brassica rapa var.rapa 2 BrBGR The cDNA sequences are completely identical (sequence BrBGR , SEQ ID NO:5).

[0110] Embodiment 11 bgr Functional analysis

[0111] Brassica napus Bnbgr The strain DHD1 was used as the receptor material and CRISPR / Cas9 gene editing technology was used to evaluate bgr The effect of genes on rapeseed plant type. The specific steps are as follows: one, bgr Construction of gene editing vector

[0112] 1. bgr and BGR The DNA sequence of was used as a template, and two specific sgRNAs were designed on the third exon (965-984 bp) and the fourth exon (1133-1152 bp) respectively using CRISPOR v4.99 (http: / / crispor.tefor.net): K1: ATTAGTTACATGGCGGAAC

[0113] K2:GAATCTGTAGCCATTAAGA

[0114] 2. Primers for sgRNA K1 and K2 are as follows: K1.F: attgATTAGTTACATGGCGGAAC

[0115] K1.R:aaacGTTCCCGCCATGTAACTAAT

[0116] K2.F: attgGAATCTGTAGCCATTAAGA

[0117] K2.R:aaacTCTTAATGGCTACAGATTC

[0118] The lowercase letters are the sequences on the vector.

[0119] 3. Vector assembly

[0120] The synthesized K1 or K2 was diluted to 10 μM; K1.F and K1.R or K2.F and K2.R were mixed in equal amounts, incubated at 98°C for 5 min, and then decreased by 2°C per minute to 37°C. The carrier pHZM184B ( Figure 8)use Bsa I digestion: pHZM184B 8 μL (1.6 μg in total), Bsa I 1μL, CutSmart buffer 1μL, 37℃ digestion for 1 hr, 65℃ inactivation for 10 min. Then use T4 ligase to connect: 4 μL of pHZM184B digestion, 4μL of K1 or K2 annealing product, 1μL 10×NEB T4Buffer, 1μL T4 ligase, 16℃ reaction for 2 hr. Then transform E. coli DH5α, PCR identification, and save the correct ones after sequencing, named gK1 and gK2 respectively ( Figure 8 ).

[0121] The construction method of pHZM184B vector is as follows: Cas9 sequence (kindly donated by Xie Qi, a researcher at the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences) is inserted into the vector pHZM137 Xho I and Pac I; then the sgRNA expression from the vector pHSE401 (kindly donated by Professor Chen Qijun of the College of Life Sciences of China Agricultural University) was inserted into EcoR 1 and Stu Between I.

[0122] Literature on pHES401 (Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, WangXC, Chen QJ. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14:327. doi: 10.1186 / s12870-014-0327-y. PMID:25432517; PMCID: PMC4262988.)

[0123] 2. Genetic transformation of rapeseed

[0124] 1. Use the heat shock method to transform Agrobacterium GV3101, and obtain a single clone containing the target plasmid through PCR identification.

[0125] 2. Genetic transformation of rapeseed. Transformation of dwarfed, branched and compact Brassica napus using hypocotyl infection Bnbgr strain DHD1 and wild type Brassica napus Westar. Bnbgr In the Westar background, 14 and 15 transgenic lines were obtained at the K1 and K2 editing sites, respectively; in the Westar background, 2 and 5 transgenic lines were obtained, respectively.

[0126] 3. Analysis of gene knockout mutation types and phenotypes

[0127] Centered on the editing site K1 or K2 and using genomic DNA as a template, primers were designed to amplify a 250-300 bp DNA fragment. The primers are as follows (5′-3′): K1-F: GAACCTAAACAGGTTTGAGTTCC

[0128] K1-R: GATAACAGCGAGTGAAAAGCAC

[0129] K2-F: CACTCGCTGTTATCATTTGTAG

[0130] K2-R: GAGCTCATCTCTACTCGTAGTAG

[0131] The DNA of the transgenic material was extracted and amplified by PCR to obtain the target fragment, which was recovered by PCR and a library was constructed. The editing type of the editing target was determined by double-end sequencing using next-generation sequencing.

[0132] The results showed that in DHD1, at the K1 and K2 sites, we obtained bgr From the phenotype point of view, all bgr The plant height of the deletion mutants was restored, the branch angle became larger, and the leaves were no longer wrinkled ( Figure 9 ).

[0133] In the Westar background, knockout mutants were obtained for both K1 and K2 sites, but all BGR None of the deletion editing mutants had a visible phenotype.

[0134] The above results further confirmed bgr It can make the plant dwarf, the branches compact, the leaves wrinkled, etc.

[0135] Example 12 Brassica napus Bnbgr The homologous genes of

[0136] We downloaded the genome sequences of rapeseed, Arabidopsis, rice, corn, soybean, grape and Chlamydomonas reinhardtii from Ensembl Plants (http: / / plants.ensembl.org / index.html), combined with the assembled genome of the DHD1 mutant strain of Brassica napus. Through Orthofinder analysis, we obtained that DHD1 of Brassica napus is located on chromosome A04. BnbgrThere are 7 homologous genes of (BnaA04T002134), with one copy each on chromosomes A01 (BnaA01T000997), A03 (BnaA03T004751), A08 (BnaA08T002216), C03 (BnaC03T001151) and C07 (BnaC07T004394), and two copies on chromosome C04 (BnaC04T001741 and BnaC04T005325). bgr To determine whether mutations at specific sites are conservative in regulating rapeseed plant type, the functions of the remaining 7 copies of the specific site mutants were compared and analyzed.

[0137] 1. Different in DHD1 of dwarf Brassica napus BGR / bgr Copy CDS clone

[0138] Using the sequences of different copies in the whole genome sequence as templates, primers were designed as shown below, and cDNA was used as a template for PCR and cloned into the entry vector pGWC. The experimental method was similar to that in Example 1.

[0139] BnaA01T000997.F: agcaggctttgactttATGGCTGACGATAGGGAGATGCCG (lowercase letters represent the linker on the vector)

[0140] BnaA01T000997.R: tgggtctagagactttccAGTTCCAGACTGATTCAAGAAGCT (lowercase letters represent the linker on the vector)

[0141] BnaA03T004751.F: agcaggctttgactttATGGCTGACGATAAGGAGATGCCG (lowercase letters represent the linker on the vector)

[0142] BnaA03T004751.R: tgggtctagagactttccAGTTCCAGACTGATTCAAGAAACT (lowercase letters represent the linker on the vector)

[0143] BnaA08T002216.F: agcaggctttgactttATGGCTGACGATAAGGAGGTGCCG (lowercase letters represent the linker on the vector)

[0144] BnaA08T002216.R: tgggtctagagactttccAGTTCCAGACTGATTCAAGAAACT (lowercase letters represent the linker on the vector)

[0145] BnaC03T001151.F: agcaggctttgactttATGGCTGACGATAAGGAGGTGCCT (lowercase letters represent the linker on the vector)

[0146] BnaC03T001151.R: tgggtctagagactttccAGTTCCAGACTGATTCAAGAAACT (lowercase letters represent the linker on the vector)

[0147] BnaC07T004394.F: agcaggctttgactttATGGCTGCCGATAAGGAGATGCCA (lowercase letters represent the linker on the vector)

[0148] BnaC07T004394.R: tgggtctagagactttccAGTTCCAGACTGATTCAAGAAACT (lowercase letters represent the linker on the vector)

[0149] BnaC04T001741.F: agcaggctttgactttATGACATCCTCCATACCATTGGGT (lowercase letters represent the linker on the vector)

[0150] BnaC04T001741.R: tgggtctagagactttccATGACCAGCTTGTAATGGAAAGCC (lowercase letters represent the linker on the vector)

[0151] BnaC04T005325.F: agcaggctttgactttATGACATCACTATCATTGGGCCCT (lowercase letters represent the linker on the vector)

[0152] BnaC04T005325.R: tgggtctagagactttccATGACCAGGCTGTGATGGGAAGCC (lowercase letters represent the linker on the vector)

[0153] BnaA01T000997 The CDS sequence is shown in SEQ ID NO: 8, BnaA01T00099 The encoded amino acid sequence is shown in SEQ ID NO:9. BnaA03T004751 The CDS sequence is shown in SEQ ID NO: 10, BnaA03T004751 The encoded amino acid sequence is shown in SEQ ID NO:11. BnaA08T002216 The CDS sequence is shown in SEQ ID NO: 12, BnaA08T002216The encoded amino acid sequence is shown in SEQ ID NO:13. BnaC03T001151 The CDS sequence is shown in SEQ ID NO: 14, BnaC03T001151 The encoded amino acid sequence is shown in SEQ ID NO:15. BnaC07T004394 The CDS sequence is shown in SEQ ID NO: 16, BnaC07T004394 The encoded amino acid sequence is shown in SEQ ID NO:17. BnaC04T001741 The CDS sequence is shown in SEQ ID NO: 18, BnaC04T001741 The encoded amino acid sequence is shown in SEQ ID NO:19. BnaC044T005325 The CDS sequence is shown in SEQ ID NO: 20, BnaC044T005325 The encoded amino acid sequence is shown in SEQ ID NO:21.

[0154] 2. Site-directed mutagenesis

[0155] According to the protein sequence comparison analysis from different species ( Figure 10 ), we found that the BGR mutation site is located in the conserved motif LGTPTRE, which is conserved in both animals and plants.

[0156] We used site-directed mutagenesis to mutate nucleotide G at 787, 787, 787, 787, 880, 877, and 787 to nucleotide A in the CDS sequences of BnaA01T000997, BnaA03T004751, BnaA08T002216, BnaC03T001151, BnaC04T001741, BnaC04T005325, and BnaC07T004394, respectively. The encoded corresponding amino acid mutated from E to K, and different copy CDS mutants were obtained, which were named mBnaA01T000997, mBnaA03T004751, mBnaA08T002216, mBnaC03T001151, mBnaC04T001741, mBnaC04T005325 and mBnaC07T004394, respectively.

[0157] The primers for site-directed mutagenesis of different copies of CDS in Brassica napus are as follows: The primers for site-directed mutagenesis of BnaA01T000997, BnaA03T004751, BnaA08T002216, BnaC03T001151 and BnaC07T004394 are the same (5′-3′): m01.F: ACCAACTCGAaAAGAGATCCG

[0158] m01.R: CGGATCTCTTtTCGAGTTGGT

[0159] The site-directed mutagenesis primers for BnaC04T001741 and BnaC04T005325 are (5′-3′): mBnaC04T001741.F:TCCAACTCGAaAAGAGATCAG

[0160] mBnaC04T001741.R: CTGATCTCTTtTCGAGTTGGA

[0161] mBnaC04T005325.F:TCCAACTCGAaAAGAAATCCG

[0162] mBnaC04T005325.R: CGGATTTCTTtTCGAGTTGGA

[0163] The lowercase letters represent the mutated bases.

[0164] Site-directed mutagenesis PCR system: 1 μL plasmid containing the target gene (100 ng / μL), 10 μL Q5 ® High-Fidelity 2× Master Mix, 0.5 μL each of upstream and downstream primers, 8 μL ddH2O.

[0165] PCR program: 98°C 3 min; 98°C 10 sec, 60°C 10 sec, 72°C 2 min, 25 cycles; 72°C 5 min.

[0166] PCR product digestion: 1 μL Dpn I, 1 μL CutSmart, 8 μL PCR product, incubate at 37°C for 2 hr.

[0167] Detection of gene mutation: The PCR product after enzyme digestion was transformed into Escherichia coli DH5α, clones were randomly picked, sequenced and identified, and clones with site-directed mutations were selected.

[0168] mBnaA01T000997 , mutant BnaA01T000997 The CDS sequence is shown in SEQ ID NO: 22, mBnaA01T000997 The encoded amino acid sequence is shown in SEQ ID NO:23. mBnaA03T004751 , mutant BnaA03T004751 The CDS sequence is shown in SEQ ID NO: 24, mBnaA03T004751 The encoded amino acid sequence is shown in SEQ ID NO:25. mBnaA08T002216 , mutantBnaA08T002216 The CDS sequence is shown in SEQ ID NO: 26, mBnaA08T002216 The encoded amino acid sequence is shown in SEQ ID NO:27. mBnaC03T001151 , mutant BnaC03T001151 The CDS sequence is shown in SEQ ID NO: 28, mBnaC03T001151 The encoded amino acid sequence is shown in SEQ ID NO:29. mBnaC04T001741 , the CDS sequence of the mutant BnaC04T001741 is shown in SEQ ID NO:30, mBnaC04T001741 The encoded amino acid sequence is shown in SEQ ID NO:31. mBnaC04T005325 , mutant BnaC04T005325 The CDS sequence is shown in SEQ ID NO: 32, mBnaC04T005325 The encoded amino acid sequence is shown in SEQ ID NO:33. mBnaC07T004394 , mutant BnaC07T004394 The CDS sequence is shown in SEQ ID NO: 34, mBnaC07T004394 The encoded amino acid sequence is shown in SEQ ID NO:35.

[0169] 3. Functional analysis of different copy mutants of Brassica napus

[0170] Different copies of mutants were recombined into pHZM137-BrBGRpro through LR recombination. After transformation of Agrobacterium, genetic transformation of rapeseed (Westar) was carried out. Transgenic lines were obtained and phenotypes were analyzed.

[0171] From the phenotype point of view, all transgenic materials with different gene mutations are similar to those of transgenic bgr The plants are similar in phenotype, i.e., they are dwarfed, with compact branches and shrunken leaves ( Figure 11 ). This indicates that the E in the conserved motif LGTPTRE of the proteins encoded by these homologous genes in rapeseed is mutated to K, and the mutated proteins are conservative in regulating the plant type of Brassica napus, and can make the plants of Brassica napus dwarf and compact. The E mutation to K in the LGTPTRE motif of different copies of BnaA01T000997, BnaA03T004751, BnaA08T002216, BnaC03T001151, BnaC04T001741, BnaC04T005325 and BnaC07T004394 can achieve the regulation of the plant type of Brassica napus.

[0172] Example 13 Site-directed mutagenesis via guide sequence editing

[0173] 1. Artificial synthesis and vector construction of guide sequence editing

[0174] byBnBGR (5′-GAgAAGAAATCCGATGCATG-3′, g is the target mutation site) as the target site, the guide editing sequence was designed and synthesized according to the method of Jiang et al., and constructed into the pZ1WS vector (kindly donated by Professor Qijun Chen of China Agricultural University), and pZ1WS-PEbgr ( Figure 12 ). The construction method refers to Example 11.

[0175] The primer editing sequence is as follows (5′-3′) (SEQ ID NO: 36): CATGCATCGGATTTCTTCTCGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCCCAACCCGAAAAGAAATCCGATgccggcatggtcccagcctcctcgctggcgccggctgggcaacatgcttcggcatggcgaatgggact

[0176] Among them, the bold part is gRNA; the wavy line is scofford RNA; the single underline is the reverse transcription template; the double underline is PBS (primer binding site); and the lowercase letters are HDV (ribozyme from hepatitis deltavirus).

[0177] 2. Genetic transformation of rapeseed

[0178] Westar was used as the recipient material for genetic transformation, and the method was referred to Example 3.

[0179] 3. Phenotypic analysis

[0180] The offspring of westar gene editing showed dwarf plants, compact plant shape, and smaller branches, which is consistent with the above-mentioned DHD1 and transgenic bg r plant phenotypes are similar. Analysis of these gene-edited materials revealed that the editing target site of westar had a G mutation to an A. This shows that mutants at this site can be obtained through guide sequence editing.

[0181] Example 14 Brassica napus Bnbgr With obvious hybrid vigor

[0182] 1. Diploid Brassica rapa mutant bgr-JT Breeding evaluation

[0183] The F1 generation seeds obtained by hybridizing the homozygous mutant of Brassica rapa with yellow-seeded Sassoon were used to evaluatebgr-JT potential in diploid hybrid breeding, it was found that homozygous mutant bgr-JT It is extremely dwarfed and has poor fertility; the plant height of F1 is between the wild type and the mutant, and the branches are compact. From the results of single plant testing: compared with the wild type, the plant height of F1 is reduced by about 30%, the length of silique is reduced by about 30%, the number of silique seeds is reduced by about 30%, and the yield per plant is reduced by about 50%; the silique density is significantly increased by about 60%.

[0184] It can be seen that in the diploid background, this gene has no potential in improving the yield of Brassica rapa materials.

[0185] 2. Evaluation of breeding potential of tetraploid Brassica oleracea mutants

[0186] Brassica napus L. bgr The female parent was crossed with Brassica napus (C76) to obtain hybrid F1, which had significant hybrid vigor.

[0187] Analysis of individual plant traits: The plant height of hybrid F1 was 120.57±8.56 cm, and the branch angle was less than 30°. The data showed that compared with the father, the plant height, initial branch height and internode distance of F1 were significantly reduced, which were reduced by 30.10±2.91%, 64.29±13.64% and 43.76±13.17% respectively; the number of branches (one effective branch), the number of siliques per plant and the yield per plant were significantly higher than those of the father, which were increased by 42.86±13.67%, 49.09±9.18% and 45.34±6.44% respectively; there was no significant difference in biomass compared with the father, but the harvest index was significantly higher than that of the father, which was increased by 30.77±3.18%.

[0188] Therefore, we can conclude that this gene has breeding potential in the tetraploid background. bgr It can be used as the maintenance line of the cytoplasmic male sterility system of rapeseed. bgr Plant type (male parent) hybridization, then use bgr After 5 generations of backcrossing, the sterile line was obtained bgr A.

[0189] Will Bnbgr A was hybridized with the restorer line of Brassica napus (PM112) to produce F1 hybrids. The production capacity of the hybrids was tested in Luoping, Yunnan and Yangling, Shaanxi in October 2021. The hybrids were harvested in May 2022, and the test results are as follows: The planting area in Yangling, Shaanxi Province is 74.4 m 2The planting density is about 35,000 plants per mu, the plant height is about 130 cm at harvest, and it is resistant to lodging. The yield per mu can reach 282.27 kg, and its harvest index is 0.40; the yield per mu of the control Shaanyou 1203 is 252.98 kg, and its harvest index is 0.31; the yield and harvest index of the hybrid are increased by 11.57% and 29.03% respectively. The oil content of the hybrid was measured by near-infrared spectroscopy and nuclear magnetic resonance, reaching 51.7-54.86%, an increase of 9.14-19.26% over the control (46.00-47.37%).

[0190] A large-scale production demonstration was carried out in Luoping, Yunnan, and the harvest was in May 2022, with a planting area of ​​656.6 m 2 The planting density is about 28,000 plants / mu, the plant height is about 150 cm, it is resistant to lodging, and the yield per mu can reach 257.9 kg, which is 27.15% higher than the control Yunyouza No. 15 (200.83 kg / mu).

[0191] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

[0192] References: 1.Nagaharu U: Genomic anlaysis in Brassica with special reference to the experimental formation of B. napus and peculiar mode offertilization. Japanese Journal of Botany 1935:389-452.

[0193] 2.Fu T, Zhou Y: Progress and future development of hybrid rapeseed in China. Engineering Sciences 2013, 11(05):11-13.

[0194] 3.Deblock M, Debrouwer D, Tenning P: Transformation of Brassica-Napusand Brassica-Oleracea Using Agrobacterium-Tumefaciens and the Expression ofthe Bar and Neo Genes in the Transgenic Plants. Plant physiology 1989, 91(2):694-701.

[0195] 4.Xin P, Yan J, Fan J, Chu J, Yan C: An improved simplified high-sensitivity quantification method for determining brassinosteroids indifferent tissues of rice and Arabidopsis. Plant physiology 2013, 162(4):2056-2066.

[0196] 5.Emms DM, Kelly S: OrthoFinder: phylogenetic orthology inference forcomparative genomics. Genome biology 2019, 20(1):238.

[0197] 6.Jiang YY, Chai YP, Lu MH, Han XL, Lin Q, Zhang Y, Zhang Q, Zhou Y,Wang XC, Gao C et al : Prime editing efficiently generates W542L and S621Idouble mutations in two ALS genes in maize. Genome Biol 2020, 21(1):257.

Claims

1. Rapeseed Green Revolution Gene, characterized in that: It is a gene encoding a diploid rapeseed glycogen synthase kinase 3β mutant; the mutant is a mutant formed by a mutation of E to K in the conserved motif LGTPTRE in glycogen synthase kinase 3β; The amino acid sequence of the glycogen synthase kinase 3β mutant is shown in SEQ ID NO: 23, 25, 27, 29, or 35.

2. A biological material containing the rapeseed green revolution gene according to claim 1, wherein the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector or engineered bacteria.

3. Any of the following uses of the rapeseed green revolution gene according to claim 1 or the biological material according to claim 2: (1) Used to reduce plant height, reduce branch angle, make the plant compact, shrink leaves, and increase oil content and harvest index; (2) for plant variety improvement; (3) Used for preparing transgenic plants; The plant is Brassica napus ( Brassica napus ), Brassica juncea ( Brassica juncea ).

4. A method for reducing rapeseed plant height, reducing branch angle, making the plant compact, shrinking leaves, increasing oil content, and increasing harvest index, characterized in that: The method comprises: using genetic engineering means, gene editing means, chemical and / or physical mutagenesis means, and plant hybridization means to introduce mutations into the rapeseed genome, so that the E in the conserved motif LGTPTRE in the encoded glycogen synthase kinase 3β and its homologous proteins is mutated to K, and the amino acid sequence of the formed glycogen synthase kinase 3β mutant is shown in SEQ ID NO: 23, 25, 27, 29 or 35; or, The rapeseed green revolution gene of claim 1 is introduced into rapeseed via a plasmid or integrated into rapeseed chromosomes via genetic engineering; The rapeseed is Brassica rapa or Brassica juncea.

5. The method according to claim 4, characterized in that The method comprises: overexpressing the rapeseed green revolution gene in a plant; The overexpression method is selected from the following 1) to 5), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the plant chromosome; 3) by changing the promoter sequence of the gene on the plant chromosome; 4) by operably linking a strong promoter to the gene; 5) By introducing enhancers.

6. The method according to claim 5, characterized in that The promoter is Brassica napus ( Brassica. rapa ) GSK3β protein bgr or BGR gene promoter, the nucleotide sequence of which is shown in SEQ ID NO:

7.

7. Use of the transgenic rapeseed obtained according to any one of claims 4 to 6 in plant breeding; The purpose of breeding is to reduce the plant height of Brassica napus and Brassica juncea, reduce the branching angle, make the plant compact, shrink the leaves, increase the oil content and improve the harvest index.

8. The use according to claim 7, characterized in that: Breeding methods include transgenic, hybridization, backcrossing, selfing or asexual reproduction.

9. The use according to claim 8, characterized in that: The obtained dwarfed rapeseed with compact plant shape is used as a maintainer line to create a sterile line or a restorer line of rapeseed, and hybrids are produced on this basis.

Images