Major gene AhFTB02 for controlling flowering phase character of peanut as well as molecular marker and application of major gene AhFTB02

Abstract

The invention discloses a major gene AhFTB02 for controlling flowering phase traits of peanuts as well as a molecular marker and application of the major gene AhFTB02, and belongs to the technical field of molecular genetics. The invention discovers that the peanut AhFTB02 gene can regulate and control the flowering phase of peanuts for the first time; based on the peanut AhFTB02 gene, the invention further develops a KASP molecular marker for identifying or assisting in identifying the peanut flowering phase character, and accurate genetic typing can be carried out on the peanut flowering phase. The method can quickly and accurately assist in selection of breeding target traits of peanuts in different flowering periods, and can effectively improve the peanut breeding efficiency and the molecular breeding technology level.

Description

Technical Field

[0001] The invention relates to the technical field of peanut molecular breeding, and in particular to a major gene AhFTB02 for controlling flowering period traits of peanuts, and a molecular marker and application thereof. Background Art

[0002] Peanut is an important economic and oil crop, and is also a high-quality source of edible protein. It is widely planted around the world. The flowering period (start of flowering, flowering and peak flowering) plays a vital role in determining the life cycle, yield and seed quality of crops. Locating flowering period regulatory genes not only helps to improve yield and adaptability, but also helps to accelerate the breeding process of early-maturing or late-maturing varieties, achieve double harvests of peanuts and wheat, alleviate the contradiction between grain and oil crops, or increase the growth period of peanuts to increase yield. It has important theoretical guidance significance and practical application value for improving the level of peanut molecular breeding technology and improving peanut planting system.

[0003] However, due to the complex genetic background and genome of peanut, there are few studies on peanut flowering-related traits, resulting in the genetic research of peanut flowering traits lagging far behind other oil crops. In recent years, the development of peanut genome sequencing technology and the construction of genetic linkage maps have made it possible to locate QTLs related to peanut flowering. At present, studies have located QTLs related to peanut flowering, but peanut flowering is greatly affected by environmental factors, and environmentally insensitive peanut flowering regulatory genes have not been reported. Therefore, the discovery of genes and molecular markers related to peanut flowering traits is of great significance for high-yield and high-quality peanut breeding. Summary of the invention

[0004] In view of the above-mentioned prior art, the purpose of the present invention is to provide a major gene AhFTB02 for controlling flowering period traits of peanut and its molecular marker and application.

[0005] To achieve the above object, the present invention adopts the following technical solution:

[0006] In a first aspect of the present invention, there is provided the use of the AhFTB02 gene in regulating flowering traits of peanut, wherein the nucleotide sequence of the AhFTB02 gene is shown in SEQ ID NO.1.

[0007] In the above application, the regulation of flowering characteristics of peanuts specifically includes: regulating the number of days of the beginning flowering period, flowering period and peak flowering period of peanuts.

[0008] The present invention discovered a new major gene AhFTB02 that regulates the flowering period of peanut based on genome resequencing and genetic association analysis. The CDS sequence of the AhFTB02 gene is shown in SEQ ID NO.1, which is as follows:

[0009] ATGGGTCGTGGAAAAACGGTCTATGAATGCATCAAAAACGAACGAGAACGTAAAATTTCTTTCATGCAAAGAAAAGATGGAATCATGAAGAAAATTTCAACATTTTCAAAGTTATGTAAAGTTGAAGCTTGTCTAATTGTTTATGGAGATGATTCTTCTCGACCAATGACTTGGCCAAAGAACATTCAAAGGTGCAATCCATCATTAAAAAGTACGAGGTTCAAAAGAATAATGAGACACACCCCATAATCTTTGATGAAGAAGAATTTTTCAAGAACAAGAAGATCATGATTGAAGCCGAGATTTCTAAATTGAGAAAGAAGGTATTCAAACTCAAATATCCTACCATGGATCCAATCTTTACTACCTTAGATGGGAACCAATTGATGGAGTTCATTGCTTTGGTGAACACTAAAATTAAAGCTTGTAAGAAAAGAATTGACATGTTGAAGGAGAGTAATCAAGATAATGGTAGCAAC TTCAATGTTGACCAAAATCAAAGTCAACTCAATTTCATGAACAACATTTCTAATCATGATTATGCTCTTCATCATGATAATTTGGTATATCAAACTCAAAACCCTAAGTTTGATCCAAATGTTACTTATTTTGTGGCAAAGAACAATGGGATGATCATGGATTCTATTAGCCAAGTTAATGTGTCTCTAGATTGTTCTACTACAAATCAAGTTGCGATTATGAATTCTAAAGAAAGAATGTTATTGTGGATTCTACAAATCAAATCAGTGAAGATGGTGATCTTATTAATTGGGATGATTTTGTTGAGGTTGAGAATTGGATTGATCAACTTCAATATGAGACTGATTTAAAAGAGATTCTTTCTCATCAATCTCAGAATGTGCCACAATCTTCACAAATCTTGCCACCAATAACAATGGATGGATTTTTGGCTGATGAGAAGAACAATGACCACCAATTTCAACCATTCAACATGTAA

[0010] The present invention has found that the gene is associated with the days of the initial flowering period, flowering period and peak flowering period of peanut. The AhFTB02 gene is used as a target to regulate the flowering period traits of peanut.

[0011] Furthermore, the use of the recombinant expression vector, recombinant bacteria and / or transgenic cell line containing the above-mentioned AhFTB02 gene in regulating the flowering period traits of peanut is also within the protection scope of the present invention.

[0012] Based on the AhFTB02 gene, in order to facilitate its application in peanut breeding practice, the present invention develops multiple SNP sites in the CDS and its upstream and downstream regions of the AhFTB02 gene, and designs KASP molecular marker primers for typing detection according to the SNP sites. Therefore, the second aspect of the present invention provides a KASP molecular marker primer combination for detecting specific SNPs, including: a first KASP molecular marker primer set and a second KASP molecular marker primer set;

[0013] The first KASP molecular marker primer set includes: an allele-specific primer AlleleX-12-1 shown in SEQ ID NO.8, an allele-specific primer AlleleY-12-1 shown in SEQ ID NO.9, and a common primer Primer_Common-12-1 shown in SEQ ID NO.10;

[0014] The second KASP molecular marker primer set includes: an allele-specific primer AlleleX-12-6 shown in SEQ ID NO.11, an allele-specific primer AlleleY-12-6 shown in SEQ ID NO.12, and a common primer Primer_Common-12-6 shown in SEQ ID NO.13.

[0015] The specific SNP detected includes a first SNP site and a second SNP site; wherein the first SNP site is the nucleotide 117809024 on chromosome 12 of the peanut genome, which is a C / T polymorphism; the first SNP site is detected by a first KASP molecular marker primer set;

[0016] The second SNP site is the nucleotide 118126407 on chromosome 12 of the peanut genome, which is a G / C polymorphism; the second SNP site is detected by the second KASP molecular marker primer set.

[0017] The third aspect of the present invention provides the use of the above-mentioned KASP molecular marker primer combination for detecting specific SNP in the following (1) or (2):

[0018] (1) Identify or assist in identifying flowering characteristics of peanut;

[0019] (2) Peanut breeding.

[0020] In the above application, the peanut breeding is the breeding of early-maturing peanut varieties and / or late-maturing peanut varieties.

[0021] A fourth aspect of the present invention provides a method for identifying or assisting in identifying flowering period traits of peanut, comprising the following steps:

[0022] The peanuts to be tested are detected based on the genotyping of specific SNPs, and the flowering period traits of the peanuts are determined according to the genotyping. The flowering period of the peanuts with the haplotype Hap_CG is earlier than that of the peanuts with the haplotype Hap_TC.

[0023] The specific SNP includes a first SNP site and a second SNP site; wherein the first SNP site is the 117809024th nucleotide on chromosome 12 of the peanut genome, which is a C / T polymorphism; the second SNP site is the 118126407th nucleotide on chromosome 12 of the peanut genome, which is a G / C polymorphism.

[0024] Preferably, the KASP molecular marker primer combination for detecting specific SNPs is used to detect the genotyping of the peanut to be tested based on the specific SNP.

[0025] A fifth aspect of the present invention provides a method for growing peanuts, comprising the following steps:

[0026] Detecting the genotyping of peanut materials based on specific SNPs, selecting peanut materials with haplotype Hap_CG to breed early-maturing peanut varieties; or selecting peanut materials with haplotype Hap_TC to breed late-maturing peanut varieties;

[0027] The specific SNP includes a first SNP site and a second SNP site; wherein the first SNP site is the 117809024th nucleotide on chromosome 12 of the peanut genome, which is a C / T polymorphism; the second SNP site is the 118126407th nucleotide on chromosome 12 of the peanut genome, which is a G / C polymorphism.

[0028] Beneficial effects of the present invention:

[0029] The present invention discovered for the first time that the peanut AhFTB02 gene can regulate the flowering period of peanuts; based on the peanut AhFTB02 gene, the present invention further developed a KASP molecular marker for identifying or assisting in the identification of the flowering period trait of peanuts, which can accurately perform genotyping of the flowering period of peanuts. The present invention can quickly and accurately assist in the selection of breeding target traits for peanuts at different flowering periods, and can effectively improve the breeding efficiency of peanuts and the level of molecular breeding technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1: Genotyping and phenotypic analysis of the 117,815,886-118,001,302bp segment of the B02 RIL population; A and B are comparisons of chromosome segments between LF36 and Baisha 1016, ICGV86699, and LF96, and "n" represents the number of RIL families of each genotype; C is a comparison of flowering period-related traits of three recombinant RILs under three environments (2021 Tai'an, 2021 Xuzhou, and 2022 Tai'an); D is a comparison of flowering period-related traits of LF96 and LF36 under three environments (2021 Tai'an, 2021 Xuzhou, and 2022 Tai'an).

[0031] Figure 2 : Electrophoresis of PCR amplification products of peanut AhFTB02 gene.

[0032] Figure 3 :Phenotypic analysis of silenced peanut linesA, Relative expression level of AhFTB02 in the shoot tips of negative control (Mock) and AhFTB02 silenced plants (T2) 30 days after transfection;B, Negative control and silenced plants 42 days after transfection. The 3 plants on the left are negative controls, and the 3 plants on the right are AhFTB02 silenced plants.

[0033] Figure 4 : The relative positions of AhFTB02 gene and SNP-12-1 and SNP-12-6.

[0034] Figure 5 : Genotyping detection of KASP markers in 72 varieties and strains; the left figure shows the typing detection results of the first SNP site (SNP-12-1), and the right figure shows the typing detection results of the first SNP site (SNP-12-6).

[0035] Figure 6 : Comparison of flowering period between two haploid variety lines. DETAILED DESCRIPTION

[0036] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0037] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below in conjunction with specific embodiments.

[0038] The test materials used in the examples of the present invention are all conventional test materials in the art and can be purchased through commercial channels. Experimental methods without detailed conditions are carried out according to conventional test methods or the operating instructions recommended by the supplier.

[0039] Example 1: Fine positioning of flowering period regulating genes in peanut

[0040] (1) The early-flowering peanut germplasm Baisha 1016 used for genome resequencing in the present invention was cultivated by Baisha Farm in Chenghai County, Guangdong Province, and the late-flowering germplasm ICGV86699 was created by the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) (Table 1); the varieties (lines) used for developing SNP markers were provided by several domestic breeding units and preserved by the Peanut Research Group of Shandong Agricultural University.

[0041] Table 1: Statistics of the beginning, flowering and full flowering periods of Baisha 1016 and ICGV86699 under various planting environments

[0042]

[0043] **Indicates that the difference reached an extremely significant level (P<0.01).

[0044] (2) In the early stage, a RIL population containing 257 families was constructed using the combination of "Baisha 1016×ICGV86699". The whole genome of the parents and RIL population was resequenced. The sequencing depth of the maternal Baisha 1016 was 28×, generating approximately 303,768,161 reads; the sequencing depth of the paternal ICGV86699 was 25×, generating approximately 275,262,029 reads. In the RIL population, the number of reads ranged from 23,726,507 to 63,136,600 (average 36,882,203), and the average sequencing depth was 3.26×. A total of 381,277 SNPs were detected. The RIL families were genotyped based on the resequencing results, and the markers were filtered and corrected. Finally, 293,606 SNPs were screened out, and the SNP markers obtained above were integrated into 4908 bin markers.

[0045] (3) The qFTB02.1 interval sequence information showed that the chromosome fragment 117,815,886-118,001,302bp (186kb) of Baisha 1016B02 was missing, and a recombination event occurred in the RIL population, which occurred near B02 117,868,636bp. This event divided the RIL population into three genotypes, namely the maternal type (Type_A, chromosome fragment missing), the recombinant type (Type_B, partial chromosome fragment missing) and the paternal type (Type_C, chromosome fragment intact) ( Figure 1 B). Combining the genotyping and phenotype analysis of each family in the RIL population, it was found that the B02117,815,886-117,868,636bp (53kb) interval was closely linked to the flowering period trait ( Figure 1 C).

[0046] When further analyzing the genotyping of the B02 117,815,886-117,868,636bp segment, we found that the RIL family LF96 only had a deletion in B02 117,861,706-117,864,100bp (2.4kb), while the typing in the rest of the interval was the same as ICGV86699. The flowering period-related traits of the two lines in all environments were lower than the RIL population mean ( Figure 1 D). Comparing the bin marker typing of LF96 with all other pedigrees, it was found that the genetic background similarity between LF36 and LF96 reached 99.85% ( Figure 1 A), when comparing the genotyping of the 117,815,886-117,868,636bp segment of LF36 and LF96 B02, we found that LF36 lacked the entire sequence and the genotyping was the same as the paternal type (Type_C). When comparing the flowering period-related traits of LF36 and LF96 in three environments, we found that there was no regularity in the differences between the two, which were caused by environmental factors. This shows that B02117,861,706-117,864,100bp is a candidate interval for flowering period-related genes, and there is only one functional gene Arahy.4RS8DG in this interval. Based on the above analysis, Arahy.4RS8DG is a candidate gene for peanut flowering period regulation, and we named it AhFTB02 gene.

[0047] Example 2: Cloning and sequencing of peanut AhFTB02 gene cDNA

[0048] 1. Extraction of total RNA from peanut buds and cDNA synthesis:

[0049] (1) RNA was extracted from flower bud tissue of peanut variety ICGV86699 according to the instructions of the Huayueyang RNA extraction kit.

[0050] (2) Reverse transcribe the extracted RNA to synthesize cDNA according to the instructions of Fermentas' RevertAid First Strand cDNA Synthesis Kit:

[0051] Add 1 μg of total RNA and 1 μl of 100 μM oligo (dT) primer to an RNase-free PCR tube, and add DEPC-treated sterilized water to the volume of 12 μl; treat the above mixture at 65°C for 5 minutes, and then immediately cool on ice for 1 minute; then add 4 μl 5X reaction buffer, 1 μl RiboLock RNase Inhibitor (20u / μl), 2 μl 10mM dNTP mix, 1 μl RevertAid M-MuLV Reverse Transcriptase (200u / μl) to the reaction solution in sequence, mix gently, and centrifuge briefly; incubate at 42°C on a PCR instrument for 1 hour, and incubate at 70°C for 5 minutes to terminate the reaction.

[0052] (3) Monoclonal sequencing of AhFTB02 gene:

[0053] The primer sequences were synthesized by Sangon Biotechnology (Shanghai) Co., Ltd. and are as follows:

[0054] AhFTB02-N1F: 5'-CATGAACTTTAATTTATATGTGAAAGCTG-3' (SEQ ID NO.2)

[0055] AhFTB02-P1F: 5'-ATGGGTCGTGGAAAAACGGT-3' (SEQ ID NO.3)

[0056] AhFTB02-P1R: 5'-TTACATGTTGAATGGTTGAAATTGG-3' (SEQ ID NO.4)

[0057] AhFTB02-N1R: 5'-CATACTTGCTAAATTAAGAGAATATAAACA-3' (SEQ ID NO.5)

[0058] PCR amplification system: total system 50 μl, including PCR-Grade Water: 15.0 μl, 2×PCR Buffer for KOD FX Neo: 25.0 μl, dNTP Mix (10 mM): 1.0 μl, KOD FX Neo (1 U / μl): 1.0 μl, cDNA first chain: 5.0 μl, primer F (10X): 1.5 μl, primer R (10X): 1.5 μl.

[0059] PCR reaction program: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 30 s, gradient annealing at 55°C for 30 s, extension at 72°C for 1.5 min, 35 cycles; post-extension at 72°C for 10 min.

[0060] The PCR amplification product was subjected to agarose gel electrophoresis to produce a target band of about 900 bp ( Figure 2 ); the PCR amplification product was then transformed into Escherichia coli competent cells, positive clones were screened and identified, and the positive clones were sequenced by Sangon Biotechnology (Shanghai) Co., Ltd.

[0061] According to the size of the DNA band detected in the electrophoresis diagram, clones that met the expected size were selected and sequenced by Sangon Biotechnology (Shanghai) Co., Ltd. The full length of the sequence of the CDS region of the AhFTB02 gene was 960bp; comparison with the reference genome DNA sequence of cultivated peanut (LegumeMine: Gene 4RS8DG A. hypogaea Tifrunner) revealed that the gene contained 1 exon and 2 introns.

[0062] Example 3: Verification of AhFTB02 gene function using VIGS technology

[0063] AhFTB02 gene silencing primers were designed using Primer Premier 5.0, and the sequences are as follows:

[0064] TAhFTB02-F:5'-GTGAGTAAGGTTACCGAATTC-3'(SEQ ID NO.6)

[0065] TAhFTB02-R: 5'-CTCGAGGCCCGGGCATGTCCCG-3' (SEQ ID NO.7)

[0066] A 565 bp fragment of the AhFTB02 coding sequence (CDS) was cut to construct the pTRV2:AhFTB02 vector. A 1:1 mixture of Agrobacterium containing pTRV1 and pTRV2 empty vectors was used as a negative control. After germination for 7 days, ICGV86699 seedlings were transformed by vacuum infiltration. To test the effectiveness of VIGS, the silencing efficiency of AhFTB02 was detected by qRT-PCR after 30 days. The results showed that the gene expression levels in the shoot apex of the AhFTB02 silenced strain (T2) were significantly reduced ( Figure 3 A). Phenotypic analysis showed that the flowering period of AhFTB02-silenced plants was advanced. The flowering period of the control group was 45 days, while the flowering period of the AhFTB02-silenced plants was 40 days ( Figure 3 B).

[0067] Example 4: SNP detection of AhFTB02 gene and its upstream and downstream sequences and development of KASP markers

[0068] (1) AhFTB02 gene sequence and its flanking SNP detection:

[0069] The genomic DNA of young leaves of 72 peanut germplasm materials was extracted according to the operating instructions of Tiangen Plant DNA Extraction Kit. The extracted DNA was fragmented, purified and end-repaired. After DNA fragment size selection and PCR amplification, a resequencing library with a fragment length of 250-350bp was constructed. High-throughput sequencing was performed on the Illumina HiSeq2500 platform using 150bp*2 bidirectional sequencing technology. The original sequence obtained by sequencing was filtered to remove reads with adapters, reads with N content greater than 10%, reads with bases with a quality value less than 10 exceeding 50%, and low-quality reads, and finally clean reads were obtained.

[0070] With reference to the peanut cultivar genome Tifrunner.gnm1.KYV3 (Tifrunner.gnm1.KYV3-data.legumeinfo.org>Arachis>hypogaea>genomes>Tifrunner.gnm1.KYV3), the clean reads were aligned using bwa software. Picard's Mark Duplicate tool was used to remove duplicates and the effects of PCR-duplication. GATK was used for SNP variation detection, and six SNP difference sites were detected in the CDS and upstream and downstream regions of AhFTB02, named SNP-12-1, SNP-12-2, SNP-12-3, SNP-12-4, SNP-12-5 and SNP-12-6 (Table 2).

[0071] Table 2: AhFTB02 gene CDS sequence and 6 SNP sites in the upstream and downstream regions

[0072]

[0073] Note: The above physical location is determined based on the cultivated peanut genome Tifrunner.gnm1.KYV3.

[0074] (2) KASP Marker Evaluation and Development:

[0075] The specificity of the 6 SNP sites obtained was evaluated. Each SNP site and its upstream and downstream 100bp sequences were selected for Blast analysis with reference to the Tifrunner peanut genome. The number of similar sequences in the genome was calculated (standard: identity>83% and coverage>80% were satisfied at the same time). SNP-12-1 and SNP-12-6 with a similar sequence number of less than or equal to 2 were selected for KASP marker development. SNP-12-1 is located upstream of the AhFTB02 gene, and SNP-12-6 is located downstream of the AhFTB02 gene ( Figure 4 ).

[0076] (3) Design of PCR primers for detecting KASP markers:

[0077] Two pairs of allele-specific primers, AlleleX-12-1, AlleleY-12-1 and AlleleX-12-6, AlleleY-12-6, and two universal primers, Primer_Common-12-1, Primer_Common-12-6, were designed to detect the genotyping of SNP-12-1 and SNP-12-6 in different varieties.

[0078] AlleleX-12-1: GAAGGTGACCAAGTTCATGCTAACAAGTGTCGAAAATTCGAATTTC; (SEQ IDNO.8)

[0079] AlleleY-12-1:GAAGGTCGGAGTCAACGGATTCTTAAACAAGTGTCGAAAATTCGAATTTT; (SEQID NO.9)

[0080] Primer_Common-12-1:GAATAAGGATTAAATCGTCACGGGTCTAA. (SEQ ID NO.10)

[0081] AlleleX-12-6: GAAGGTGACCAAGTTCATGCTCGACAAGTTCTTCGACGATGTG; (SEQ IDNO.11)

[0082] AlleleY-12-6:GAAGGTCGGAGTCAACGGATTCGACAAGTTCTTCGACGATGTC; (SEQ IDNO.12)

[0083] Primer_Common-12-6: CCCTACCTCGTATTAAAAGTTTAAGTTGAT. (SEQ ID NO.13)

[0084] Example 5: Application of KASP markers in the upstream and downstream regions of the major gene AhFTB02 related to flowering period of peanut

[0085] Peanut varieties and strains bred by several domestic breeding units were also selected, and the KASP marker developed in Example 4 was used to identify the genotypes of SNP-12-1 and SNP-12-6, and the validity of the marker was verified.

[0086] (1) Extraction of genomic DNA from peanut leaves:

[0087] The traditional CTAB method was used to extract genomic DNA from leaves of 72 varieties and strains. The purity and concentration of the DNA samples were determined by spectrophotometer, A260 / 280: 1.8-2.2, 260 / 230>=2.0; the DNA was diluted to 100 ng / μl for later use.

[0088] (2) KASP marker detection:

[0089] KASP detection PCR reaction system: DNA: 0.8μl, 2×Master mix: 0.4μl, primer: 0.022μl, H2O: 0.4μl.

[0090] The PCR reaction program for KASP detection was as follows: pre-denaturation at 94°C for 15 mins; denaturation at 94°C for 10 s, gradient annealing at 61-55°C for 60 s (0.6°C decrease per cycle), for 10 cycles; denaturation at 94°C for 20 s, annealing and extension at 55°C for 60 s, for 26 cycles.

[0091] After the PCR reaction program is completed, the PCR product is placed on the Omega fluorescent signal reader and Araya to convert the fluorescent signal into analyzable values, and then the genotype analysis is performed using the analysis software KrakenTM provided by LGC.

[0092] (3) Correlation analysis between KASP marker typing and peanut flowering period

[0093] After KASP marker detection, 72 peanut varieties were accurately classified into two haplotypes: Hap_CG and Hap_TC ( Figure 5); haplotype Hap_CG means that the nucleotide at the SNP-12-1 site is C, and the nucleotide at the SNP-12-6 site is G; haplotype Hap_TC means that the nucleotide at the SNP-12-1 site is T, and the nucleotide at the SNP-12-6 site is C. Among them, 48 materials have the haplotype Hap_CG, and the average values ​​of their initial flowering period, flowering period, and full flowering period are 28.92d, 30.21d, and 31.35d, respectively; 24 materials have the haplotype Hap_TC, and the average values ​​of their initial flowering period, flowering period, and full flowering period are 30.71d, 31.88d, and 33.21d, respectively. The flowering period of peanut varieties of Hap_CG type is significantly earlier than that of Hap_TC type ( Figure 6 ).

[0094] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Application of AhFTB02 gene in regulating flowering period traits of peanut, the nucleotide sequence of the AhFTB02 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The method of regulating the flowering period traits of peanuts specifically includes regulating the number of days of the initial flowering period, flowering period and peak flowering period of peanuts.

3. Use of a recombinant expression vector, a recombinant bacterium and / or a transgenic cell line comprising the AhFTB02 gene according to claim 1 in regulating flowering traits of peanut.

4. A KASP molecular marker primer combination for detecting a specific SNP, characterized in that: include: a first KASP molecular marker primer set and a second KASP molecular marker primer set; The first KASP molecular marker primer set includes: primers shown in SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10; The second KASP molecular marker primer set includes primers shown in SEQ ID NO.11, SEQ ID NO.12 and SEQ ID NO.

13.

5. The KASP molecular marker primer combination according to claim 4, characterized in that: The specific SNP detected includes a first SNP site and a second SNP site; wherein the first SNP site is the nucleotide 117809024 on chromosome 12 of the peanut genome, which is a C / T polymorphism; the first SNP site is detected by a first KASP molecular marker primer set; The second SNP site is the nucleotide 118126407 on chromosome 12 of the peanut genome, which is a G / C polymorphism; the second SNP site is detected by the second KASP molecular marker primer set.

6. Use of the KASP molecular marker primer combination for detecting specific SNPs according to claim 4 or 5 in the following (1) or (2): (1) Identify or assist in identifying flowering characteristics of peanut; (2) Peanut breeding.

7. The use according to claim 6, characterized in that: The peanut breeding is the breeding of early-maturing peanut varieties and / or late-maturing peanut varieties.

8. A method for identifying or assisting in identifying flowering traits of peanut, characterized in that: The following steps are involved: The peanuts to be tested are detected based on the genotyping of specific SNPs, and the flowering period of the peanuts is determined according to the genotyping. The flowering period of the peanuts with the haplotype Hap_CG is earlier than that of the peanuts with the haplotype Hap_TC. The specific SNP includes a first SNP site and a second SNP site; wherein the first SNP site is the 117809024th nucleotide on chromosome 12 of the peanut genome, which is a C / T polymorphism; the second SNP site is the 118126407th nucleotide on chromosome 12 of the peanut genome, which is a G / C polymorphism.

9. The method according to claim 8, characterized in that The KASP molecular marker primer combination according to claim 4 or 5 is used to detect the genotyping of the peanut to be tested based on the specific SNP.

10. A method for growing peanuts, characterized in that: The steps include: Detecting the genotyping of peanut materials based on specific SNPs, selecting peanut materials with haplotype Hap_CG to breed early-maturing peanut varieties; or selecting peanut materials with haplotype Hap_TC to breed late-maturing peanut varieties; The specific SNP includes a first SNP site and a second SNP site; wherein the first SNP site is the 117809024th nucleotide on chromosome 12 of the peanut genome, which is a C / T polymorphism; the second SNP site is the 118126407th nucleotide on chromosome 12 of the peanut genome, which is a G / C polymorphism.

Images