Method for identifying adulterated components of edible animal viscera products based on Cytb gene

Abstract

The invention belongs to the field of detection, and relates to an identification method for determining adulteration of twelve animal source components in edible animal viscera and products thereof based on a DNA (Deoxyribose Nucleic Acid) micro bar code technology of mitochondrial Cytb. The method comprises the following steps: deeply cleaning a sample by using a 70% ethanol solution and normal saline, mixing by combining a liquid nitrogen grinding technology and a vacuum freeze drying technology, extracting a DNA template by using an improved CTAB method, amplifying a target fragment by using a pair of designed universal primers Ctyb-A, and detecting the target fragment. Carrying out qualitative and quantitative analysis on an amplification product by utilizing a QIAxcel high-resolution capillary gel electrophoresis analysis system, and finally carrying out adulteration analysis on a sequencing result of the amplification product through an established adulteration visual model.

Description

Technical Field

[0001] The invention belongs to the field of detection and relates to a method for identifying adulteration of twelve kinds of animal-derived ingredients in edible animal offal and products thereof by using mitochondrial Cytb-based DNA microbarcode technology. Background Art

[0002] Animal offal is one of the food ingredients that is very popular among people. Common edible animal offal parts on the market include by-processed products of poultry and livestock, including intestines, stomachs, hearts, livers, kidneys, blood, and offal. Consumers can identify the source of some fresh animal offal ingredients sold as whole parts by sensory properties. However, some fresh ingredients come from animals of similar size and species, and unscrupulous merchants use flavors and spices to cover up the original odor properties. In addition, the original sensory properties of edible animal offal that has been deeply processed by crushing, smoking, pickling, etc. have changed. It is difficult for consumers to use their senses to judge and identify them through color, aroma and taste. Coupled with the price difference of offal from different sources, the risk of replacing offal from different sources is increased.

[0003] These actions not only infringe on the interests of consumers, but may also cause disputes due to the presence of non-halal ingredients in certain religious foods, which is not conducive to maintaining social stability. If the raw materials are not inspected and quarantined, it will also involve the spread of epidemics. In addition, replacing or mixing the claimed meat with other varieties of meat is a very potential threat to people and animals who are allergic to certain specific varieties of animal protein.

[0004] In recent years, many studies have used DNA barcoding technology to identify species, including the identification of adulteration of animal-derived foods. The basis of this technology is the need for easily amplified, relatively short, and sufficiently variable DNA fragments. This fragment has sufficient species specificity and inter-species diversity to enable rapid and accurate identification and identification of species, and can quickly and effectively identify species such as animals, plants, and fungi. In 2008, Meusnier et al. reported the DNA microbarcoding technology (mini-DNA barcoding) for the amplification of small DNA fragments, and designed universal primers specifically for some small fragments of DNA in the full-fragment DNA barcode, which can use degraded DNA to identify different species.

[0005] The Cytb gene is a subunit of the gene encoding cytochrome b oxidase on the inner membrane of mitochondria and is encoded by the H chain of mtDNA. It is located in the phospholipid bilayer of the inner membrane of mitochondria and is an important substance in the electron transport chain involved in the process of oxidative phosphorylation to synthesize ATP. The total length of its nucleotide sequence is about 1140bp, encoding 379 amino acids, and there is no significant difference in sequence length between species. Its origin is very ancient and has been found in almost all eukaryotes and many prokaryotes. It is not only diverse between genera and species, but also between varieties and individuals within varieties. Therefore, the Cytb gene is one of the best genes for studying interspecies evolutionary relationships. By detecting and comparing the Cytb genes of species, they can be accurately identified and classified. More and more studies use Cytb as the target fragment of DNA barcoding technology to identify species and authenticity.

[0006] Although the DNA fragments of edible animal offal will decompose after various deep processing, the DNA microbarcode technology can be used to amplify the small fragments of the Cytb gene fragments of various deep-processed offal products, and then identify their sources for adulteration. The present invention uses the DNA microbarcode technology based on mitochondrial Cytb to establish a method for identifying the adulteration of twelve animal-derived ingredients in edible animal offal and its products. Summary of the invention

[0007] The technical problem to be solved by the present invention is to provide a simple, qualitative and highly sensitive method for determining adulteration of twelve kinds of animal-derived ingredients in edible animal offal and its products by using mitochondrial Cytb-based DNA microbarcode technology.

[0008] In order to solve the above technical problems, the present invention provides a universal primer Cytb-A that can simultaneously amplify 12 species:

[0009] Forward primer: GAGGACAAATATCATTCTGAGG;

[0010] Reverse primer: TGTAGTTGTCTGGGTCTCC.

[0011] Note: The 12 species are pigs, cows, sheep, chickens, ducks, geese, rabbits, horses, mice, pigeons, cats and dogs.

[0012] In the present invention, Cytb gene fragments of 12 species (including pigs, cattle, sheep, chickens, ducks, geese, rabbits, horses, mice, pigeons, cats and dogs) were downloaded from NCBI, and universal primers were designed using Primer-BLAST on NCBI through sequence alignment. Finally, through a large number of practical verifications, screenings and improvements to primers, the universal primer Cytb-A (upstream primer: GAGGACAAATATCATTCTGAGG; downstream primer: TGTAGTTGTCTGGGTCTCC) that can simultaneously amplify 12 species was obtained.

[0013] The present invention also provides a PCR amplification method using the universal primer Cytb-A:

[0014] The PCR amplification reaction system (25ul) is: 12.5ul ready-to-use PCR amplification reagent (Shanghai Shenggong Company), 7.5-10.5ul (preferably 9.5ul) double distilled water, 0.5ul 10uM forward primer, 0.5ul 10uM reverse primer, 1-3ul (preferably 2ul) DNA template;

[0015] DNA microbarcode fragment amplification program: 95°C for 2 min; 95°C for 1 min, 43-47°C (preferably 45°C) for 1 min, 72°C for 30 s, 5 cycles; 95°C for 1 min, 50-55°C (preferably 52°C) for 1 min, 72°C for 30 s, 35 cycles; finally, keep at 72°C for 10 min.

[0016] The present invention also provides a method for identifying adulterated ingredients in edible animal offal products based on the Cytb gene (i.e., a method for identifying adulteration of twelve animal-derived ingredients in edible animal offal and its products based on mitochondrial Cytb DNA microbarcode technology), comprising the following steps:

[0017] 1) DNA extraction and purification:

[0018] Animal viscera products (animal viscera and blood are both animal viscera products) are used as samples to be tested, and DNA is extracted and purified from the samples to be tested to obtain a DNA template;

[0019] 2) PCR amplification: the amplification system is the same as above;

[0020] 3) Sequencing of amplified products;

[0021] The amplified product (confirmed amplified product) was recovered by conventional gel excision and subjected to first-generation DNA sequencing (Sanger method);

[0022] 4) Analyze the sequencing results obtained in step 3):

[0023] When the peak corresponding to the base (each base) is a single peak, the subsequent adulteration analysis is directly performed;

[0024] When the peaks corresponding to the base (each base) are two or more, clone sequencing is performed, and the extracted DNA is subjected to first-generation DNA sequencing;

[0025] 5) Using viscera (viscera products) confirmed in advance to be of 12 kinds of animal sources as standard samples, DNA extraction and purification, PCR amplification, and amplification product sequencing are performed according to the above steps 1) to 3) to obtain standard gene fragments (standard sequence fragments, DNA base sequences) of 12 kinds of animal-derived DNA microbarcodes based on Cytb;

[0026] 6) Establishment of adulteration visualization model:

[0027] Compare the standard sequence fragments of the microbarcodes of the 12 animal sources obtained in step 5) and establish an adulteration visualization model;

[0028] 7) Result analysis:

[0029] The sequence results of the sample to be tested obtained in 4) are compared and analyzed for adulteration through the comparison in step 6) and the established adulteration visualization model, thereby obtaining the corresponding test results.

[0030] As an improvement of the method for identifying adulterated ingredients in edible animal viscera products based on the Cytb gene of the present invention, the step 6) is:

[0031] The standard sequence fragments of the microbarcodes of the 12 animal sources obtained in step 5) were aligned using the R language package rBLAST package, and then the alignment results were used to establish and analyze the adulteration visualization model using the circlize package.

[0032] As a further improvement of the method for identifying adulterated ingredients in edible animal viscera products based on the Cytb gene of the present invention, the step 6) is:

[0033] The microbarcode standard fragments of 12 animal sources are put together in a fasta file named animal12, and a model code is established. The code for establishing the model can be described in the following specific implementation manner.

[0034] As a further improvement of the method for identifying adulterated ingredients in edible animal viscera products based on the Cytb gene of the present invention, step 6) is:

[0035] First, download blast+ (version 2.15.0) from the NCBI website, install local blast+, collect the standard gene fragments of 12 animal-derived DNA microbarcodes based on Cytb obtained in step 5) in a fasta file, use the makeblastdb command of the rBLAST package to establish a local database (animal12) of 12 animal-derived DNA microbarcodes based on Cytb, and then import the sample sequence to compare with the animal12 local database;

[0036] The circlize package was used to build and analyze the adulteration visualization model for the comparison results (evalue and bitscore).

[0037] As a further improvement of the method for identifying adulterated ingredients in edible animal viscera products based on the Cytb gene of the present invention:

[0038] The PCR amplification in step 2) also includes confirming and analyzing the obtained amplification products using a QIAxcel high-resolution capillary gel electrophoresis analysis system (qualitative and quantitative analysis).

[0039] The QIAxcel high-resolution capillary gel electrophoresis analysis system is confirmed as follows: the calibrated and balanced QIAxcel DNA High Resolution Kit (1200) cartridge is placed into the instrument, the power is turned on and the high-purity nitrogen is turned on, a DNA size marker and a small tube of amplification product are added to the sample analysis plate, and confirmation analysis is performed after high-resolution gel electrophoresis separation for 5 to 20 minutes (preferably 10 minutes).

[0040] As a further improvement of the method for identifying adulterated ingredients in edible animal offal products based on the Cytb gene of the present invention, the cloning sequencing in step 4) is as follows: different positive clones are selected from the PCR products for sequencing analysis, the purified PCR products are connected to the pGEM-T vector and then introduced into DH5α competent cells, and after blue-white screening, different white colonies are picked for culture and plasmid DNA is extracted; the extracted DNA is then subjected to first-generation DNA sequencing.

[0041] As a further improvement of the method for identifying adulterated ingredients in edible animal viscera products based on the Cytb gene of the present invention, in the step 1): the sample to be tested is first washed with a 70% (volume %) ethanol solution and then washed with physiological saline;

[0042] Then, it is processed by combining liquid nitrogen grinding and vacuum freeze-drying technology.

[0043] As a further improvement of the method for identifying adulterated ingredients in edible animal viscera products based on the Cytb gene of the present invention, the step 1) comprises the following steps:

[0044] 1.1. Take 100±10g of the sample to be tested, cut it into pieces, add 500±50ml of 70% (volume %) ethanol solution, ultrasonically clean (clean twice, 15min each time, and the ethanol solution needs to be replaced during the second cleaning), filter, and use 500±50ml of normal saline to ultrasonically clean the residue obtained by filtration (clean twice, 15min each time, and the normal saline needs to be replaced during the second cleaning), and then add 500±50ml of normal saline to crush it for 10min, filter, and repeat the process of adding normal saline to the residue obtained by filtration - crushing - filtering, and dry the water on the surface of the residue (use absorbent paper to dry it); obtain the treated residue;

[0045] 1.2. Add 250±20 ml of liquid nitrogen to the treated residue obtained in step 1.1, perform preliminary grinding, then add another 250±20 ml of liquid nitrogen, seal and let stand for 10 to 20 min (preferably 15 min), then perform vacuum freeze drying (-40 to -60°C vacuum freeze drying for 6 to 24 h, preferably -50°C air freeze drying for 12 h), and finally pulverize (pass through a 60-mesh sieve) as the test object;

[0046] 1.3. Extract DNA from the sample obtained in step 1.2 using QIAGEN DNeasymericon Food Kit:

[0047] Weigh an appropriate amount of the substance to be tested obtained in step (1.2):

[0048] When fresh viscera products and deep-processed viscera products are used as the test samples, weigh 0.5-2.0 g (preferably 1.0 g) of the test substance obtained in step (1.2);

[0049] When blood products are used as the sample to be tested, weigh 1.0 to 3.0 g (preferably 2.0 g) of the sample to be tested obtained in step (1.2);

[0050] Place the test object in a 50ml polyvinyl fluoride centrifuge tube, add 10-30ml (preferably 20ml) lysis solution and 25-200ul (preferably 100ul) proteinase K, vortex oscillate for 30s, lyse at 60°C for 0.5-2h (preferably 1h), vortex oscillate once every 15min, and after lysis, cool to room temperature, centrifuge at 1000-5000×g (preferably 2500×g) for 2-10min (preferably 5min);

[0051] 1.4. Accurately pipette 1-10 ml (preferably 5 ml) of chloroform into a 10 ml centrifuge tube, take 1-2 ml (preferably 1.5 ml) of the supernatant solution obtained in step 1.3 into the centrifuge tube, vortex for 15 seconds, and centrifuge at 10,000-20,000 × g (preferably 14,000 × g) for 15-30 min (preferably 20 min);

[0052] 1.5. Take 0.5 ml of the supernatant obtained in step 1.4 into a 5 ml centrifuge tube, add 2 ml of PB buffer solution, vortex and oscillate for 30 seconds, let it stand, then pipette 1.2 ml of the mixed solution onto a QIAquick cleanup column, centrifuge at 15000-20000 × g (preferably 18000 × g) for 0.5-2 min (preferably 1 min), pipette 1.2 ml of the mixed solution and repeat the above steps, and discard the filtrate;

[0053] 1.6. Add 1 ml of AW2 buffer solution to the QIAquick cleanup column in step 1.5, centrifuge at 15000-20000 × g (preferably 18000 × g) for 0.5-2 min (preferably 1 min), discard the filtrate, and centrifuge at 15000-20000 × g (preferably 18000 × g) for 0.5-2 min (preferably 1 min);

[0054] 1.7. Add 50-200 μl (preferably 100 μl) of EB elution solution to the QIAquick purification column in step 1.6, let stand at room temperature for 1-3 min (preferably 2 min), centrifuge at 15,000-20,000 × g (preferably 18,000 × g) for 0.5-2 min (preferably 1 min) to elute and obtain the DNA template.

[0055] 1.8. Take the DNA template obtained in step 1.7 and measure the DNA purity and concentration using a micro-nucleic acid protein analyzer. The ratio of A260 to A280 is used to determine the DNA purity. The purity is better when it is between 1.8 and 2.0.

[0056] In the present invention: in order to facilitate DNA sequencing, M13 is connected to each pair of primers, and the size of the amplified fragment is about 360 bp;

[0057] The source-mitochondrial Cytb reference sequences designed by the universal primer Cytb-A for twelve animal-derived ingredients are shown in Table 1:

[0058] Table 1. Mitochondrial Cytb reference sequences from twelve animal species

[0059]

[0060]

[0061] The standard gene fragments of 12 animal-derived DNA microbarcodes are shown in Table 2:

[0062] Table 2. Standard gene fragments of DNA microbarcodes of twelve animal sources

[0063]

[0064] In the present invention:

[0065] (1) This method uses 70% ethanol solution and physiological saline solution, respectively, to perform preliminary removal of impurities contained in edible animal offal and its products through ultrasonic cleaning and food processor pulverization. Compared with other techniques such as direct sampling, this method can partially eliminate the influence of these impurities on the purity of the subsequently extracted DNA, thereby ensuring the subsequent amplification efficiency of the target fragment;

[0066] (2) This method uses a combination of liquid nitrogen grinding technology and vacuum freeze-drying technology to process edible animal offal and its products, ensuring the uniformity of the samples. Compared with other pre-treatment technologies, including food processor pulverization or single liquid nitrogen grinding and vacuum freeze-drying, the method has higher processing efficiency and better uniformity of the obtained samples. The detection rate of adulteration model of samples treated with liquid nitrogen grinding technology and vacuum freeze-drying method is 100% for beef adulterated with 5% pig-derived ingredients, while both food processor pulverization and liquid nitrogen grinding methods have missed detection. Although the adulteration detection rate of single vacuum freeze-drying method is also 100%, the processing efficiency is low, exceeding 28 hours. The method uses a combination of liquid nitrogen grinding and vacuum freeze-drying technology, and uses liquid ammonia grinding technology instead of pre-freezing technology, and only needs 12 hours to complete sample preparation;

[0067] (3) This method improves and optimizes the method and steps for extracting DNA from edible animal offal products provided by the QIAGEN DNeasy mericon Food Kit (CTAB method), making it more suitable for DNA extraction and purification from edible animal offal and its products, improving the content and quality of the adulterated component template in the extracted DNA template, ensuring the subsequent amplification efficiency of the adulterated component, improving the sensitivity of the adulteration identification experiment, and ensuring the minimum adulteration detection rate (detection sensitivity) of this method;

[0068] (4) This method uses NCBI to download Cytb gene fragments of 12 species (including pigs, cattle, sheep, chickens, ducks, geese, rabbits, horses, mice, pigeons, cats, and dogs). Through sequence alignment, universal primers are designed using Primer-BLAST on NCBI. Finally, a pair of universal primers Cytb-A are designed. The primers can simultaneously amplify 12 species (the size of the amplified fragment is about 360 bp), which improves the detection efficiency and has a high amplification efficiency. The final concentration of the amplified product of the standard DNA microbarcode is above 2.0 μg / ml, which greatly improves the sensitivity of the method for detecting adulterated components.

[0069] (5) This method uses the QIAxcel high-resolution capillary gel electrophoresis analysis system to perform qualitative and quantitative analysis on the amplified products. Compared with the ordinary agarose gel electrophoresis method, capillary gel electrophoresis can not only perform qualitative analysis on the amplified product bands, but also perform quantitative analysis on the amplified products by comparing the fluorescence values ​​of the standard bands. In order to determine whether the amplified products have interference from mixed bands, this method uses high-resolution capillary gel electrophoresis to confirm the amplified products, which can help eliminate interference with subsequent sequencing. The capillary gel electrophoresis analysis time is relatively fast, and no gel preparation steps are required. The analysis time can be completed within 10 minutes, which greatly improves the experimental efficiency of this method.

[0070] (6) This method uses the fact that the peak corresponding to each base in the first-generation sequencing results is a single peak or two or more peaks to optimize and improve the sequencing program. If the peak corresponding to each base in the sequencing results is a single peak, adulteration analysis is performed directly; if the peak corresponding to each base in the sequencing results is a double peak or more, subsequent cloning sequencing is performed. Compared with other adulteration experiments that directly use cloning sequencing technology, this optimization scheme greatly improves the efficiency of adulteration experiments and saves manpower, material and financial resources;

[0071] (7) This method uses the blast+ tool and the R language package rBLAST to establish a local database of 12 animal-derived DNA microbarcodes based on Cytb, and simultaneously performs sample comparison. The circlize package is used to establish and analyze the comparison results (evalue and bitscore) for adulteration visualization modeling. The established visualization model greatly improves the efficiency of adulteration analysis and can make relatively intuitive authenticity judgments on large quantities of samples.

[0072] In summary, the method for identifying adulteration of twelve animal-derived ingredients in edible animal offal and their products based on mitochondrial Cytb described in the present invention has less impurity interference, higher purity of extracted DNA template, higher amplification efficiency of target fragments, and a minimum detection ratio of adulterated ingredients of 1%. It has good detection specificity, high reproducibility, and high detection efficiency.

[0073] The technical points of the present invention mainly include (but not only include the following contents):

[0074] 1. The existing food safety standards for the identification of adulteration of edible animal offal are SN / T5199-2020 "Technical Specifications for DNA Barcode Detection of Livestock and Poultry Ingredients". Other relevant standards for adulteration detection of animal-derived foods (livestock and poultry meat) include NY / T 3309-2018 "Real-time Fluorescence Qualitative PCR Method for Identification of Meat-derived Ingredients", QB / T 5505-2020 "PCR Method for Detection of Beef, Sheep, Pork, Chicken and Duck Derived Ingredients in Canned Meat", SB / T 10923-2012 "Real-time Fluorescence PCR Method for Determination of Animal-derived Ingredients in Meat and Meat Products" and SN / T 2557-2010 "Real-time Fluorescence PCR Method for Qualitative Detection of Bovine Components in Livestock Meat Foods". Although SN / T5199-2020 uses DNA barcode technology, this method can only be applied to the detection of single species samples, and is not suitable for the detection of animal components in multi-species mixed samples. Among them, NY / T 3309-2018, QB / T5505-2020, SB / T 10923-2012 and SN / T 2557-2010 all use real-time fluorescence PCR, which uses specific primers and can only purposefully screen the required species within a limited range. The amplification conditions of each specific primer are different, so these methods have low adulteration screening efficiency. The present invention is a new detection method for the determination of adulteration identification of twelve animal-derived ingredients in edible animal offal and its products based on mitochondrial Cytb DNA microbarcode technology.

[0075] 2. The prior art tells that during the identification of adulteration of animal-derived ingredients in edible animal offal and its products, the samples are pre-cleaned. Since various offal contain different interfering ingredients, coupled with various deep processing methods, the pretreatment of offal products is relatively troublesome. There are standards and literature that simply wash and clean them with water. However, the present invention uses 70% ethanol solution and physiological saline to deeply clean the offal products, and uses ultrasonic cleaning and food processor pulverization to remove some impurities and interfering substances in the pretreated edible animal offal products, which helps to improve the purity of the DNA template extracted subsequently and ensure the amplification efficiency of the subsequent target fragments.

[0076] 3. The prior art tells that during the identification of adulteration of animal-derived ingredients in edible animal offal and its products, the samples must be fully mixed to ensure the homogeneity of the samples. Some standards and literature use a food processor to grind, a single liquid nitrogen grinding method or a single vacuum freeze-drying method to process and mix the samples. The present invention combines liquid nitrogen grinding with vacuum freeze-drying technology, which can make the final sample obtained by the present invention have better homogeneity, avoid the omission of the adulterated ingredients in the adulterated samples, and greatly improve the time-consuming disadvantage of the single vacuum freeze-drying method, thereby greatly improving the sample processing efficiency;

[0077] 4. The prior art tells that DNA templates must be extracted and purified during the identification of adulteration of animal-derived ingredients in edible animal offal and its products. There are common extraction and purification steps (CTAB method) in literature, standards and the instructions for the QIAGEN DNeasy mericon Food Kit, but they are not suitable for DNA extraction and purification in edible animal offal and its products. The method of the present invention makes it more suitable for DNA extraction and purification in edible animal offal and its products, improves the content and quality of adulterated component templates in the extracted DNA template, ensures the subsequent amplification efficiency of adulterated components, improves the sensitivity of adulteration identification experiments, and guarantees the minimum adulteration detection rate (detection sensitivity) of the method;

[0078] 5. The prior art tells that a pair of primers is needed in the process of identifying adulteration of animal-derived ingredients in edible animal offal and its products. The primers can simultaneously amplify all species that need to be screened and ensure the amplification efficiency of all species. Some documents or standards use specific primers for amplification. Although the screening purpose is strong, it is not possible to screen multiple species simultaneously on a large scale. The present invention designs a universal primer Cytb-A that can amplify 12 species at the same time, which can screen adulterated animal-derived ingredients on a large scale and improve the screening efficiency. Although some documents or standards also use universal primers for amplification, the amplification efficiency of the designed universal primers is low, which affects the final The detection sensitivity is high. At the same time, some universal primers will produce miscellaneous bands of similar size to the target fragment, which will interfere with the sequencing results. The universal primer Cytb-A designed in the present invention has a high amplification efficiency, and the minimum detection ratio of the adulterated components in various adulteration modes reaches 1%, and the target fragment band is clear and has no interference; at the same time, the DNA micro-barcode technology used in the present invention has a small fragment, rather than the full-fragment technology used in other literature or standards, which ensures that in the adulteration experiment of deep-processed viscera products, DNA breakage caused by various factors (such as high-temperature heating, etc.) is avoided, thereby preventing the consequences of invalid DNA amplification, thereby ensuring the reliability and stability of the experiment;

[0079] 6. The prior art tells that the amplification results need to be confirmed during the identification of adulteration of animal-derived ingredients in edible animal offal and their products. Some literature or standards use agarose gel electrophoresis for confirmation, while the present invention uses a high-resolution capillary gel electrophoresis analysis system to analyze the amplification results. It not only has high analysis efficiency (10 min), simple operation, and does not require steps such as gel preparation, but also can perform qualitative and quantitative analysis of the amplification products and automatically correct the results, with a high success rate and good confirmation efficiency. By using high-resolution capillary gel electrophoresis for analysis, amplification products with differences of more than 3 to 5 bp can also be separated and analyzed, and it can be judged whether the amplification products have interference from stray bands, which can assist in eliminating interference with subsequent sequencing.

[0080] 7. The prior art tells that the sequencing results need to be analyzed during the adulteration identification process of animal-derived ingredients in edible animal offal and their products. Some literature or standards directly submit the sequences to NCBI for comparison. The present invention uses the blast+ tool and the R language package rBLAST package to establish a local database of 12 animal-derived DNA microbarcodes based on Cytb, and performs sample comparison at the same time. The circlize package is used to establish and analyze the comparison results (evalue and bitscore) for adulteration visualization model. The established visualization model greatly improves the efficiency of adulteration analysis, and can make relatively intuitive authenticity judgments on large quantities of samples.

[0081] In summary, the present invention uses a DNA microbarcode technology based on mitochondrial Cytb to identify the adulteration of twelve kinds of animal-derived ingredients in edible animal offal and its products. After the sample is deeply cleaned with 70% ethanol solution and physiological saline, it is mixed by combining liquid nitrogen grinding technology with vacuum freeze drying technology, and then the DNA template is extracted by the improved CTAB method. A pair of universal primers Ctyb-A is designed to amplify the target fragment, and the amplified product is qualitatively and quantitatively analyzed by QIAxcel high-resolution capillary gel electrophoresis analysis system. Finally, the sequencing results of the amplified product are analyzed by the established adulteration visualization model. The present invention solves the problem of adulteration identification in the process of detecting twelve kinds of animal-derived ingredients in edible animal offal and its products. It has important practical significance for protecting human health, improving the level of technological development of enterprises themselves, promoting the development of my country's detection technology, improving the international status of my country's poultry and livestock by-product quality and safety detection technology, increasing employment, and driving the overall progress of the poultry and livestock by-product industry, and has great economic and social benefits for technological progress and industrial transformation and upgrading. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0083] Figure 1 This is a capillary gel electrophoresis diagram of 12 animal-derived amplification products based on Cytb.

[0084] Note: M. Marker (30-1 500 bp), 1. PCR product (pig), 2. PCR product (cattle), 3. PCR product (sheep), 4. PCR product (chicken), 5. PCR product (duck), 6. PCR product (goose), 7. PCR product (rabbit), 8. PCR product (rat), 9. PCR product (horse), 10. PCR product (pigeon), 11. PCR product (dog), 12. PCR product (cat);

[0085] Figure 2 It is a visualization model and adulteration analysis diagram for adulteration identification of 12 animal sources based on Cytb. DETAILED DESCRIPTION

[0086] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto.

[0087] 1 Reagents and Materials

[0088] 1.1 Ethanol: analytical grade;

[0089] 1.2 Liquid nitrogen;

[0090] 1.3 Double distilled water;

[0091] 1.4 Physiological saline: analytical grade;

[0092] 1.5DNeasymericon Food Kit: QIAGEN, Germany;

[0093] 1.6 Universal primer Cytb-A: commissioned by Hangzhou Qingke Biotechnology Co., Ltd. to synthesize;

[0094] 1.7 Ready-to-use PCR amplification reagents: Shanghai Bioengineering;

[0095] 1.8QIAxcel DNA High Resolution Kit (1200): QIAGEN, Germany;

[0096] 1.9QX Alignment Marker 15 / 3000bp: QIAGEN, Germany;

[0097] 1.10QX DNA Size Marker 50~1500bp: QIAGEN, Germany;

[0098] 1.11 Amplification product recovery kit: Shanghai Bioengineering;

[0099] 1.12T4 ligation kit: TaKaRa;

[0100] 1.13DH5α competent cells: TaKaRa;

[0101] 2 Instruments and equipment

[0102] 2.1QIAxcel fully automated capillary gel electrophoresis analysis system;

[0103] 2.2Veriti 96-well gradient PCR instrument;

[0104] 2.3 Analytical balance: sensitivity is 0.01g;

[0105] 2.4 Vortex shaker;

[0106] 2.5 High-speed centrifuge: maximum speed can reach 20000rpm;

[0107] 2.6 Food grinder;

[0108] 2.7 Chinese medicine grinder;

[0109] 2.8 Ultrasonic cleaning machine;

[0110] 2.9 Vacuum freeze dryer;

[0111] Example 1: A method for determining adulteration of twelve kinds of animal-derived ingredients in edible animal offal and its products based on mitochondrial Cytb DNA microbarcode technology, and performing the following steps in sequence:

[0112] 1) DNA extraction and purification

[0113] (1.1) Take 100g of the sample to be tested (including fresh, deeply processed visceral products, and blood products), cut it into small pieces (particle size ≤ 5mm) with a knife, place it in a 1000ml beaker, add 500ml of 70% (volume %) ethanol solution, ultrasonically clean it twice (the 70% ethanol solution needs to be replaced during the second cleaning), each time for 15 minutes, filter, and obtain residue. The obtained residue is ultrasonically cleaned twice with 500ml of normal saline (the normal saline needs to be replaced during the second cleaning), each time for 15 minutes, and the obtained residue is placed in a food processor, 500ml of normal saline is added, and conventional pulverization treatment is performed for 10 minutes, filtered, and the residue is placed in a food processor, and the process of adding normal saline - pulverization treatment - filtration is repeated once, and the moisture on the surface of the residue is absorbed with absorbent paper; the treated residue is obtained;

[0114] (1.2) The treated residue obtained in step (1.1) was placed in a mortar, and 250 ml of liquid nitrogen was added for preliminary grinding. The obtained product after preliminary grinding was placed in a 500 ml liquid nitrogen tank, and 250 ml of liquid nitrogen was added. The product was sealed and allowed to stand for 15 min. The sample treated with liquid nitrogen was immediately placed in a vacuum freeze drying oven and the vacuum was less than 1*10 -4 Pa, vacuum freeze-dried at -50°C for 12h, the vacuum freeze-dried sample was crushed by a traditional Chinese medicine crusher (passed through a 60-mesh sieve) and used as the test object; the test object can be directly subjected to the following step (13), or can be placed in a desiccator for storage and use, that is, used immediately upon inspection.

[0115] (1.3) DNA extraction reagents and consumables used QIAGEN Dneasymericon Food Kit;

[0116] Weigh an appropriate amount of the substance to be tested obtained in step (1.2):

[0117] When fresh viscera products and deep-processed viscera products are used as test samples, weigh 1.0 g of the test substance obtained in step (1.2);

[0118] When blood products are used as the sample to be tested, weigh 2.0 g of the test substance obtained in step (1.2).

[0119] The test substance was placed in a 50 ml polyvinyl fluoride centrifuge tube, 20 ml lysis buffer and 100 ul proteinase K were added, vortexed for 30 s, and lysed at 60 °C for 1 h. During the lysis process, vortexed every 15 min. After lysis, the tube was cooled to room temperature and centrifuged at 2500 × g for 5 min.

[0120] (1.4) Accurately pipette 5 ml of chloroform into a 10 ml centrifuge tube, take 1.5 ml of the supernatant solution obtained by centrifugation in step (1.3) into the centrifuge tube, vortex for 15 seconds, and centrifuge at 14,000 × g for 20 minutes;

[0121] (1.5) Take 0.5 ml of the supernatant obtained by centrifugation in step (1.4) and transfer it to a 5 ml centrifuge tube. Add 2 ml of PB phosphate buffer (0.2 M, pH 7.2-7.4). Vortex and shake for 30 seconds. After standing, pipette 1.2 ml of the mixed solution onto a QIAquick cleanup column and centrifuge at 18,000 × g for 1 min. Pipet 1.2 ml of the mixed solution and repeat the above steps of transferring to a QIAquick cleanup column - centrifugation. Discard the filtrate.

[0122] (1.6) Add 1 ml of AW2 buffer solution to the QIAquick cleanup column obtained in step (1.5), centrifuge at 18,000 × g for 1 min, and discard the filtrate;

[0123] (1.7) Add 100 μl of EB elution solution to the QIAquick cleanup column obtained in step (1.6), let stand at room temperature for 2 min, and centrifuge at 18,000 × g for 1 min to elute to obtain the DNA template;

[0124] (1.8) Take the DNA template obtained in step (1.7) and measure the DNA purity and concentration using a micro-nucleic acid protein analyzer. The DNA purity is determined by the ratio of A260 to A280. The purity is better when it is between 1.8 and 2.0.

[0125] 2) PCR amplification and confirmation of amplification products

[0126] (2.1) Download the Cytb gene fragments of 12 species (including pig, cattle, sheep, chicken, duck, goose, rabbit, horse, mouse, pigeon, cat, and dog) from NCBI, and design universal primers by sequence alignment and using Primer-BLAST on NCBI. Finally, through practical verification, a pair of universal primers Cytb-A (upstream primer: GAGGACAAATATCATTCTGAGG; downstream primer: TGTAGTTGTCTGGGTCTCC) that can simultaneously amplify 12 species were selected. In order to facilitate DNA sequencing, M13 was connected to each pair of primers, and the amplified fragment size was about 360 bp;

[0127] Mitochondrial Cytb reference sequences from twelve animal species

[0128]

[0129]

[0130] (2.2) PCR amplification of micro-fragments was performed on the DNA template extracted from each batch of samples. Each PCR amplification reaction tube contained the following reagents (25ul system): 12.5ul ready-to-use PCR amplification reagent (Shanghai Shenggong Company), 9.5ul double distilled water, 0.5ul 10uM forward primer, 0.5ul 10uM reverse primer, 2ul DNA template;

[0131] (2.3) DNA microbarcode fragment amplification procedure: 95℃ for 2 min; 95℃ for 1 min, 45℃ for 1 min, 72℃ for 30 s, 5 cycles; 95℃ for 1 min, 52℃ for 1 min, 72℃ for 30 s, 35 cycles; finally, keep at 72℃ for 10 min. The amplified product was stored at -20℃ for future use;

[0132] (2.4) Use the QIAxcel high-resolution capillary gel electrophoresis analysis system to perform confirmation analysis (qualitative and quantitative analysis) on the amplification products obtained in step (2.3). The analysis steps are as follows: Place the calibrated and balanced QIAxcel DNA High Resolution Kit (1200) cartridge into the instrument, turn on the power and turn on the high-purity nitrogen gas, add the DNA size marker and the small tube of the amplification product to the sample analysis plate, and perform confirmation analysis after high-resolution gel electrophoresis separation for 10 minutes.

[0133] Note: The results of high-resolution capillary gel electrophoresis confirmation of edible viscera (intestines) of 12 species based on Cytb are shown in Figure 1 ;

[0134] 3) Sequencing of amplified products

[0135] The amplified product confirmed in step 2) is recovered by gel excision and subjected to first-generation DNA sequencing (Sanger method), and subsequent operations are selected based on the sequencing results;

[0136] 4) Analyze the sequencing results obtained in step 3):

[0137] If the peak corresponding to each base is a single peak, proceed directly to the subsequent adulteration analysis;

[0138] If there are two or more peaks corresponding to each base, subsequent cloning sequencing is performed. The cloning sequencing steps are as follows: different positive clones are selected from the PCR products for sequencing analysis. After the purified PCR products are connected to the pGEM-T vector, they are introduced into DH5α competent cells. After blue-white screening, different white colonies are selected for culture and plasmid DNA is extracted. The extracted DNA is then sequenced for the first generation of DNA; the sequencing results are then analyzed to obtain the target DNA fragment sequences of different animal-derived components in the sample.

[0139] Note: Cloning and sequencing is a conventional method, so the present invention will not elaborate on it in detail.

[0140] The explanation is as follows: A single peak may also involve adulteration, that is, all of it is adulterated. For example, if the sample label indicates that it is cow offal, but the sequencing result is pig offal after analysis, the species cannot be matched, which is also considered adulteration.

[0141] 5) Preparation of standard DNA microbarcodes

[0142] (5.1) The 12 kinds of animal-derived viscera used must be guaranteed to be free of adulteration. Therefore, the unprocessed complete viscera (including intestines, stomach, heart, liver, kidneys, and blood) are taken, part of which comes from the animal source in the slaughterhouse and part of which comes from the Animal Experiment Center of Hangzhou Institute of Food and Drug Inspection, as the unadulterated viscera used in the present invention. After washing, they are stored at -20°C for later use;

[0143] (5.2) Take the 12 animal samples from step (5.1), perform DNA extraction, amplification (including confirmation), and sequencing according to steps 1 to 3, and finally obtain standard gene fragments (DNA base sequences) of 12 animal DNA microbarcodes based on Cytb. The similarity with the NCBI database (BLAST results) is shown in the following table;

[0144] Standard gene fragments for DNA microbarcoding of twelve animal species

[0145]

[0146] 6) Establishment of adulteration visualization model and comparative analysis of results

[0147] (6.1) The standard sequence fragments of the microbarcodes of 12 animal sources obtained in step 5) are compared by the R language package rBLAST, and then the comparison results are used to establish and analyze the adulteration visualization model through the circlize package. First, download blast+ (version 2.15.0) from the NCBI website, install local blast+, and concentrate the standard gene fragments of the 12 animal-derived DNA microbarcodes based on Cytb obtained in step 5) in a fasta file, use the makeblastdb command of the rBLAST package to establish a local database (animal12) of the 12 animal-derived DNA microbarcodes based on Cytb, and then import the sample sequence and compare it with the animal12 local database;

[0148] (6.2) Use the circlize package to build and analyze the adulteration visualization model for the comparison results (evalue and bitscore). The specific code is as follows:

[0149]

[0150]

[0151] (6.3) comparing and analyzing the sequence results of the sample obtained in step 4) by using the comparison in step (6.1) and the adulteration visualization model established in step (6.2);

[0152] 7) Detection sensitivity

[0153] A certain proportion of low-economic-value viscera is mixed with high-economic-value viscera as an adulteration pattern, including three adulteration ratios of 0.5%, 1.0%, and 2.0% (among which, in the adulteration pattern of blood products mixed with mammalian (including pigs, cattle, sheep, rabbits, horses, mice, cats, and dogs) animal-derived components, the three adulteration ratios are set to 2.0%, 3.0%, and 4.0%), each ratio is repeated 20 times, and the detection sensitivity of the method is investigated with the detection rate of adulterated components as 100% as the standard. The results show that the detection sensitivity (minimum detection ratio) of the adulteration identification method for twelve kinds of animal-derived components in edible animal viscera and their products based on mitochondrial Cytb DNA microbarcode technology is 1%; in blood products, the detection sensitivity (minimum detection ratio) of the method of mixing with poultry animal sources is 1%, and the detection sensitivity (minimum detection ratio) of the method of mixing with poultry animal sources is 3%.

[0154] Experiment 1: Extracted DNA purity and amplification product concentration

[0155] Taking pig viscera as an example, the intestines, stomach, heart, liver, kidney, and blood treated by four deep processing methods (including boiling, frying, pickling, and braising) were simulated. According to the experimental method of Example 1 above, the purity of the extracted DNA (the ratio of A260 to A280) and the concentration of the amplified product were investigated. The results are shown in Table 3.

[0156] Table 3. DNA purity and amplification product concentration

[0157]

[0158]

[0159] According to Table 3, it can be learned that the purity of DNA obtained from the intestine, stomach, heart, liver, kidney and blood processed by simulating four deep processing methods (including boiling, frying, pickling and braising) is between 1.76 and 2.05, with good purity and high quality. After amplification, the concentration of the obtained amplification product (except blood products) is between 1.89 and 3.22 ng / ul, and the amplification efficiency is high. Due to the particularity of livestock blood, mature red blood cells have no nucleus, so the DNA they contain is less, but using the experimental method of Example 1 of the present invention, the concentration of the obtained amplification product meets the requirements of sequencing.

[0160] Experiment 2: Use of adulteration visualization model for identification

[0161] Seventeen samples were taken, namely samples 1 to 17 (s-1 to s-12), of which samples 1 to 12 were positive control samples, which were the intestinal parts of pigs, sheep, cattle, ducks, chickens, horses, pigeons, rabbits, geese, mice, cats and dogs, respectively; samples 13 to 17 (s-13 to s-17) were samples labeled as bovine origin, of which samples 13 to 15 were beef tripe, and samples 16 to 17 were beef offal. DNA microbarcode sequences of the seventeen samples were obtained, and then compared with the microbarcode standard sequence fragments of 12 animal sources, and adulteration analysis was performed through the adulteration visualization model. The adulteration identification results are shown in Figure 1. Figure 2 As can be seen from the figure, samples 1 to 12 can be paired with the corresponding species in the adulteration model. Among samples 13 to 17, samples 13, 14, and 16 are all bovine-derived ingredients, while samples 15 and 17 are both adulterated products. Sample 15 contains porcine-derived ingredients, and sample 17 contains duck-derived ingredients.

[0162] The following are some specific examples: Figure 2 As shown, taking sample s-1 as an example, it is a pig sample. After analysis, it is found that its animal source components are Figure 2 The upper part of s-15 (microbarcode standard sequence fragments of 12 animal sources) matches the porcine components, indicating that this sample is a non-adulterated sample; while the animal-derived components of sample s-15 match the porcine components, but its sample is identified as beef offal. The animal-derived components contained in the actual sample are inconsistent with those identified, so it is an adulterated sample.

[0163] Experiment 3: Actual sample testing

[0164] The laboratory randomly selected 65 batches of common edible animal offal and its products (including 10 batches of pig offal products, 20 batches of bovine offal products, 10 batches of sheep offal products, 15 batches of duck offal products, 5 batches of chicken offal products, and 5 batches of goose offal products), of which samples No. 1 to 10 were pig offal products, No. 11 to 30 were bovine offal products, No. 31 to 40 were sheep offal products, and No. 41 to 55 were duck offal products. Products, No. 56 to 60 are chicken-derived visceral products, No. 61 to 65 are goose-derived visceral products, and there are also samples 66 (1g of pork tripe added to 99g of beef tripe), sample 67 (1g of pork intestine added to 99g of beef intestine), sample 68 (1g of pork intestine added to 99g of sheep intestine), sample 69 (3g of pork blood added to 97g of duck blood), sample 70 (1g of duck liver added to 99g of goose liver), and sample 71 (1g of pork tripe and 1g of lamb tripe added to 98g of beef tripe). The 65 batches of visceral products are mainly deep-processed cooked food, including various types of marinated and pickled food.

[0165] According to the above steps, DNA extraction, amplification, confirmation and sequencing were performed, and finally adulteration analysis was performed. Each sample was repeated twice in parallel. The sample measurement results are shown in Table 4.

[0166] The DNA microbarcode identification result is obtained by analyzing the sample sequencing result through the adulteration visualization model.

[0167] Table 4. Actual sample measurement results

[0168]

[0169]

[0170]

[0171] illustrate:

[0172] Taking "Sample 1" as an example, the sequencing results obtained were analyzed. The peak corresponding to the base of the first-generation DNA sequencing result was a single peak, so the adulteration analysis was directly performed, that is, the sequence results of the obtained sample were compared and analyzed for adulteration through the established adulteration visualization model; the final result was that the animal-derived component contained in the sample was porcine-derived component, which was consistent with the animal source type indicated on its label and was not adulterated.

[0173] Taking "Sample 13" as an example, the sequencing results obtained were analyzed. The peak corresponding to the base of the first-generation DNA sequencing result was a single peak, so adulteration analysis was performed directly, that is, the sequence results of the obtained sample were compared and analyzed for adulteration through the established adulteration visualization model; the final result was that the animal-derived component contained in the sample was porcine-derived component, which was inconsistent with the animal source type indicated on its label, and it was an adulterated sample.

[0174] Taking "Sample 9" as an example, the sequencing results obtained were analyzed. The peaks corresponding to the first-generation DNA sequencing bases were double peaks, so subsequent cloning sequencing was performed. The cloning sequencing steps are as follows: different positive clones of PCR products were selected for sequencing analysis. After the purified PCR products were connected to the pGEM-T vector, they were introduced into DH5α competent cells. After blue-white screening, different white colonies were selected for culture and plasmid DNA extraction. The extracted DNA was subjected to first-generation DNA sequencing; then the sequencing results were analyzed for adulteration, and the sequence results of the obtained samples were compared and analyzed for adulteration through the established adulteration visualization model; the final result was that the animal-derived components contained in the sample were pig-derived components and chicken-derived components, which did not match the type of animal-derived components indicated on its label, and it was an adulterated sample.

[0175] Taking "Sample 66" as an example, the obtained sequencing results were analyzed. The peaks corresponding to the first-generation DNA sequencing bases were double peaks, so subsequent cloning sequencing was performed. The cloning sequencing steps are as follows: different positive clones of PCR products were selected for sequencing analysis. After the purified PCR products were connected to the pGEM-T vector, they were introduced into DH5α competent cells. After blue-white screening, different white colonies were picked for culture and plasmid DNA extraction. The extracted DNA was sequenced for the first generation of DNA; then the sequencing results were analyzed for adulteration, and the sequence results of the obtained samples were compared and analyzed for adulteration through the established adulteration visualization model; the final result was that the animal-derived components contained in the samples were bovine and porcine, which were consistent with the components contained in the adulterated positive samples set in this experiment (beef tripe samples containing 1% porcine components).

[0176] Taking "Sample 71" as an example, the sequencing results obtained in step (3.1) are analyzed. The peaks corresponding to the first-generation DNA sequencing bases are more than double peaks, so subsequent cloning sequencing is performed. The cloning sequencing steps are: different positive clones are selected from the PCR products for sequencing analysis. After the purified PCR products are connected with the pGEM-T vector, they are introduced into DH5α competent cells. After blue-white screening, different white colonies are selected for culture and plasmid DNA extraction. The extracted DNA is sequenced for the first generation of DNA; then the sequencing results are analyzed for adulteration, and the sequence results of the obtained samples are compared and analyzed for adulteration through the established adulteration visualization model; the final result is that the animal-derived components contained in the samples are bovine-derived components, porcine-derived components, and sheep-derived components, which are consistent with the components contained in the adulterated positive samples set in this experiment (beef tripe samples containing 1% porcine-derived components and 1% sheep-derived components).

[0177] According to Table 4, we know that among pig-derived visceral products, chicken-derived ingredients were detected in one batch of pig blood tofu (sample 9); among bovine-derived visceral products, pig-derived ingredients were detected in five batches of visceral products, including two batches of beef tripe (samples 11 and 13), one batch of beef tripe (sample 17), and two batches of beef offal (samples 27 and 28); among sheep-derived visceral products, pig-derived ingredients were detected in one batch of sheep offal (sample 37), and bovine-derived ingredients were detected in one batch of sheep offal (sample 40); among duck-derived visceral products, chicken-derived ingredients were detected in one batch of duck intestines (sample 46) and one batch of duck blood tofu (sample 55), and pig-derived ingredients were detected in two batches of duck blood tofu (samples 49 and 51); among goose-derived visceral products, duck-derived ingredients were detected in one batch of goose intestines (sample 62) and one batch of goose liver (sample 65).

[0178] Comparative Example 1: Change (1.1) of step 1) of Example 1 to: cut into small pieces with a knife, wash and clean the surface with water and scrape off any possible contaminated parts of the surface; the rest is the same as Example 1.

[0179] The results showed that the purity of the DNA templates extracted from animal viscera samples that simulated four deep processing methods (boiling, frying, pickling, and braising) was lower than 1.60. If the ratio of the extracted DNA is between 1.8-2.0, it can be considered that the DNA is relatively pure and of high quality. This means that the DNA extracted from samples that have not undergone deep cleaning has large impurities, insufficient purity, and poor quality, which will affect the efficiency of subsequent target fragment amplification.

[0180] Comparative Example 2: (1.2) of step 1) of Example 1 is changed to "the obtained treated residue is placed in a -40°C refrigerator for precooling for 4 hours, the precooled sample is placed in a vacuum freeze drying oven and dried to the same effect as Example 1 of the present invention, and then crushed"; the rest is the same as Example 1. Results The detection rate of adulterated components in positive adulterated samples (adulteration ratio of 1%) is consistent with that of the present invention, both of which are 100%, but the processing time requires two days, which is much longer than the freezing time required by the present invention, that is, the efficiency is greatly reduced.

[0181] Comparative Example 3: (2) of step 1) of Example 1 was changed to "the treated residue was placed in a mortar, 50 ml of liquid nitrogen was added for grinding to obtain a sample"; the rest was the same as Example 1. Results The detection rate of adulterated components in positive adulterated samples (with an adulteration ratio of 1%) was less than 50%, and the sensitivity and accuracy were significantly reduced.

[0182] Comparative Example 4: (1.3) of step 1) of Example 1 was changed to "DNA extraction reagents and consumables were all QIAGENDneasy mericon Food Kit, and DNA extraction was performed according to the instructions of the kit"; the rest was the same as Example 1. Results The purity (judged by the ratio of A260 to A280) of the DNA template extracted from animal viscera samples simulated in four deep processing methods (boiling, frying, pickling, and braising) was all lower than 1.65.

[0183] Comparative Example 5: The universal primer Cytb-A in Example 1 was changed to "by consulting the literature, a pair of universal primers COI-A (upstream primer: TCCACTAATCACAARGATATTGGTAC; downstream primer: GAAAATCATAATGAAGGCATGAGC) was referenced"; the rest is the same as Example 1.

[0184] Results: The concentrations of amplified products of 12 species' viscera products (using simulated four deep processing methods (boiling, frying, pickling, and braising)) were all lower than 0.5 μg / ml. The concentrations of amplified products of some blood products (pig, cattle, sheep, horse, rabbit, cat, dog, and mouse) were all lower than 0.2 μg / ml, which was invalid amplification (lower than the detection limit of 0.3 μg / ml of the first-generation DNA sequencer). The minimum detection rate of adulterated ingredients was only 10%, and the minimum detection rate of some blood products was only 20%. The sensitivity and accuracy were significantly reduced.

[0185] Description: An adulteration experimental model was designed. Taking the adulteration of pork components into beef intestine as an example, 20 samples were taken from beef intestine samples with 5%, 10%, and 15% pig intestine added, and the results showed that the detection rate of pig-derived components in samples with an adulteration ratio of more than 10% was 100%. For blood products, taking the adulteration of pig blood components into duck blood as an example, 20 samples were taken from beef intestine samples with 15%, 20%, and 25% pig intestine added, and the results showed that the detection rate of pig-derived components in samples with an adulteration ratio of more than 20% was 100%.

[0186] Comparative Example 6: The universal primer Cytb-A in Example 1 was changed to "by consulting the literature, a pair of full-fragment universal primers were referenced (upstream primer: TGTAAAACGACGGCCAGTTCTCAACCAACCACAARGAYATYGG; downstream primer: CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCRAARAAYCA)"; the rest is the same as Example 1.

[0187] Results: The amplification products of the viscera products of 12 species (using four deep processing methods (boiling, frying, pickling, and braising)), especially the viscera products treated by deep processing methods such as frying, pickling, and braising, did not amplify the corresponding full-fragment amplification products, indicating that the deep processing of the viscera products caused DNA breakage and the amplification of the full-fragment target fragment failed.

[0188] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. It is clear that the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by ordinary technicians in this field should be considered as the protection scope of the present invention.

Claims

1. Universal primer Cytb-A can simultaneously amplify 12 species, characterized by: Forward primer: GAGGACAAATATCATTCTGAGG; Reverse primer: TGTAGTTGTCTGGGTCTCC.

2. The PCR amplification method using the universal primer Cytb-A according to claim 1, characterized in that: The PCR amplification reaction system is: 12.5ul ready-to-use PCR amplification reagent, 7.5-10.5ul double distilled water, 0.5ul 10uM forward primer, 0.5ul 10uM reverse primer, 1-3ul DNA template; Amplification program: 95°C for 2 min; 95°C for 1 min, 43-47°C for 1 min, 72°C for 30 s, 5 cycles; 95°C for 1 min, 50-55°C for 1 min, 72°C for 30 s, 35 cycles; finally, keep at 72°C for 10 min.

3. A method for identifying adulterated ingredients in edible animal offal products based on the Cytb gene, characterized in that The following steps are involved: 1) DNA extraction and purification: Animal viscera products are used as samples to be tested, and DNA is extracted and purified from the samples to be tested to obtain DNA templates; 2) PCR amplification: the amplification system is the same as that in claim 2; 3) Sequencing of amplified products; The amplified product was recovered by gel excision and subjected to first-generation DNA sequencing; 4) Analyze the sequencing results obtained in step 3): When the peak corresponding to the base is a single peak, the subsequent adulteration analysis is directly performed; When there are two or more peaks corresponding to the base, clone sequencing is performed, and the extracted DNA is subjected to first-generation DNA sequencing; 5) Extract and purify the viscera previously confirmed to be of 12 kinds of animal origin, perform PCR amplification, and sequence the amplified products according to the above steps 1) to 3) to obtain standard gene fragments of 12 kinds of animal-derived DNA microbarcodes based on Cytb; 6) Establishment of adulteration visualization model: Compare the standard sequence fragments of the microbarcodes of the 12 animal sources obtained in step 5) and establish an adulteration visualization model; 7) Result analysis: The sequence results of the sample to be tested obtained in step 4) are compared and analyzed for adulteration through the adulteration visualization model established in step 6), thereby obtaining the corresponding test results.

4. The method for identifying adulterated ingredients in edible animal viscera products based on the Cytb gene according to claim 3, characterized in that The step 6) is: The standard sequence fragments of the microbarcodes of the 12 animal sources obtained in step 5) were aligned using the R language package rBLAST package, and then the alignment results were used to establish and analyze the adulteration visualization model using the circlize package.

5. The method for identifying adulterated ingredients in edible animal viscera products based on the Cytb gene according to claim 3, characterized in that The step 6) is: The microbarcode standard fragments of 12 animal sources were put into a fasta file named animal12, and a model code was established.

6. The method for identifying adulterated ingredients in edible animal viscera products based on the Cytb gene according to any one of claims 3 to 5, characterized in that The step 6) is: First, download blast+ from the NCBI website, install local blast+, collect the standard gene fragments of 12 animal-derived DNA microbarcodes based on Cytb obtained in step 5) in a fasta file, use the makeblastdb command of the rBLAST package to establish a local database of 12 animal-derived DNA microbarcodes based on Cytb, and then import the sample sequence to compare with the animal12 local database; The circlize package was used to build and analyze the adulteration visualization model for the comparison results.

7. The method for identifying adulterated ingredients in edible animal viscera products based on the Cytb gene according to any one of claims 3 to 6, characterized in that: The step 2) also includes confirming and analyzing the obtained amplification products using a QIAxcel high-resolution capillary gel electrophoresis analysis system.

8. The method for identifying adulterated ingredients in edible animal viscera products based on the Cytb gene according to any one of claims 3 to 7, characterized in that The cloning sequencing of step 4) is as follows: different positive clones are selected from the PCR products for sequencing analysis, the purified PCR products are connected to the pGEM-T vector, and then introduced into DH5α competent cells, and after blue-white screening, different white colonies are selected for culture and plasmid DNA is extracted; the extracted DNA is then subjected to first-generation DNA sequencing.

9. The method for identifying adulterated ingredients in edible animal viscera products based on the Cytb gene according to any one of claims 3 to 8, characterized in that In the step 1), the sample to be tested is first washed with 70% ethanol solution and then washed with physiological saline; Then, it is processed by combining liquid nitrogen grinding with vacuum freeze-drying technology.

10. The method for identifying adulterated ingredients in edible animal viscera products based on the Cytb gene according to claim 9, characterized in that The step 1) comprises the following steps: 1.

1. Take 100±10g of the sample to be tested, cut it into pieces, add 500±50ml of 70% ethanol solution, ultrasonically clean it, filter it, and use 500±50ml of normal saline to ultrasonically clean the residue obtained by filtration, then add 500±50ml of normal saline to crush it for 10min, filter it, and repeat the process of adding normal saline to the residue obtained by filtration - crushing - filtering, and dry the water on the surface of the residue to obtain the treated residue; 1.

2. Add 250±20 ml of liquid nitrogen to the treated residue obtained in step 1.1, perform preliminary grinding, then add another 250±20 ml of liquid nitrogen, seal and let stand for 10-20 min, then perform vacuum freeze drying, and finally pulverize to obtain the test substance; 1.

3. Extract DNA from the sample obtained in step 1.2 using QIAGEN DNeasymericon Food Kit: Weigh an appropriate amount of the substance to be tested obtained in step 1.2: Add 10-30 ml of lysis buffer and 25-200 ul of proteinase K to the sample, vortex for 30 seconds, and lyse at 60°C for 0.5-2 hours, vortex every 15 minutes. After lysis, cool to room temperature and centrifuge at 1000-5000 × g for 2-10 minutes. 1.

4. Pipette 1-10 ml of chloroform into a 10 ml centrifuge tube, take 1-2 ml of the supernatant solution obtained in step 1.3 into the centrifuge tube, vortex for 15 seconds, and centrifuge at 10,000-20,000 × g for 15-30 minutes; 1.

5. Take 0.5 ml of the supernatant obtained in step 1.4 and transfer it to a 5 ml centrifuge tube. Add 2 ml of PB phosphate buffer and vortex for 30 seconds. After standing, pipette 1.2 ml of the mixed solution onto a QIAquick cleanup column and centrifuge at 15,000 to 20,000 × g for 0.5 to 2 minutes. Pipet 1.2 ml of the mixed solution and repeat the above steps. Discard the filtrate. 1.

6. Add 1 ml of AW2 buffer solution to the QIAquick cleanup column in step 1.5, centrifuge at 15,000-20,000 × g for 0.5-2 min, discard the filtrate, and centrifuge at 15,000-20,000 × g for 0.5-2 min; 1.

7. Add 50-200 μl of EB elution solution to the QIAquick cleanup column in step 1.6, let stand for 1-3 min, and centrifuge at 15,000-20,000 × g for 0.5-2 min to elute to obtain the DNA template.

Images