Application of molecular genetic marker YZU-LAYER-MGM-1 in identifying high-yield laying hens

Abstract

The invention discloses an application of a molecular genetic marker YZU-LAYER-MGM-1 in identification of high-yield laying hens. According to the molecular genetic marker and the detection method thereof, high-yield laying hens can be identified in an early stage, and the breeding process can be accelerated; according to the molecular genetic marker and the detection method thereof, high-yield laying hens can be identified at an early stage only by taking a small amount of blood, the molecular genetic marker has the advantages of convenience, high flux and labor saving, and the breeding cost can be saved.

Description

Technical Field

[0001] The invention relates to application of a molecular genetic marker YZU-LAYER-MGM-1 in identifying high-yield laying hens, and belongs to the field of poultry breeding technology and gene detection. Background Art

[0002] Egg production is a key indicator to measure the egg-laying performance of laying hens, and it is also an important trait to be selected in the breeding of high-yielding laying hens. Egg production is affected by many factors, including genetics, nutrition, health status, and feeding management. When the levels of other factors are consistent and sufficient, genetic differences are the key factors that dominate egg production. In traditional breeding, it is necessary to track and record the egg production information of each individual for a long time to guide subsequent selection and breeding work, which has the problems of long cycle, high cost, large manpower, and wide error. Therefore, early identification of high / low egg production-related genetic markers from the perspective of molecular genetics will help accelerate the breeding process and reduce breeding costs.

[0003] Single nucleotide polymorphism (SNP) is an important type of molecular genetic marker that only involves single base variation. Based on the theory of whole genome association analysis, candidate SNP sites related to egg production can be screened out by calculation. After accuracy verification, a detection method is established, which can be used to guide the breeding of related traits. The formation of reliable SNP genetic markers lies in: 1. Accurate large-scale population phenotypic information; 2. Reasonable analysis and screening strategies; 3. Accuracy verification. However, the existing egg production-related SNP sites still have varying degrees of accuracy errors, and their detection methods are mostly based on high-cost second-generation sequencing technology, which is difficult to be widely used. Summary of the invention

[0004] Purpose of the invention: The technical problem to be solved by the present invention is to provide an application of the molecular genetic marker YZU-LAYER-MGM-1 in identifying high-yielding laying hens, which is used for early selection of high-yielding individuals, helping to accelerate the breeding process and reduce breeding costs.

[0005] Technical solution: To solve the above technical problems, the present invention provides the use of a molecular genetic marker YZU-LAYER-MGM-1 or a detection kit containing the molecular genetic marker YZU-LAYER-MGM-1 in determining egg production traits, wherein the molecular genetic marker YZU-LAYER-MGM-1 is located at 2602463 bp on chromosome 16.

[0006] Wherein, the genotype of the molecular genetic marker YZU-LAYER-MGM-1 is A / A, G / A or G / G.

[0007] Among them, when the genotype is A / A, the egg production trait is a high egg production trait; when the genotype is G / A, the egg production trait is a medium egg production trait; when the genotype is G / G, the egg production trait is a low egg production trait.

[0008] The invention also provides the use of a molecular genetic marker YZU-LAYER-MGM-1 or a detection kit containing the molecular genetic marker YZU-LAYER-MGM-1 in identifying high-yield laying hens; the molecular genetic marker YZU-LAYER-MGM-1 is located at 2602463 bp of chromosome 16.

[0009] Among them, when the genotype is A / A, the chicken to be tested is a high-yielding laying hen.

[0010] The invention also provides the use of a specific primer pair of the molecular genetic marker YZU-LAYER-MGM-1 or a kit containing the specific primer pair in determining egg production traits; the nucleotide sequences of the specific primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0011] The method comprises the following steps: using the DNA of the chicken to be tested as a template and using the specific primer pair to perform PCR amplification; when the 240bp position of the amplified product sequence shows an A / A homozygous type, the chicken to be tested has a high egg production trait; when the 240bp position of the amplified product sequence shows a G / A heterozygous type, the chicken to be tested has a medium egg production trait; when the 240bp position of the amplified product sequence shows a G / G homozygous type, the chicken to be tested has a low egg production trait.

[0012] The invention also provides application of a specific primer pair of the molecular genetic marker YZU-LAYER-MGM-1 or a kit containing the specific primer pair in identifying high-yield laying hens.

[0013] The method comprises the following steps: using the DNA of the chicken to be tested as a template and using the specific primer pair to perform PCR amplification; when the 240 bp position of the amplified product sequence shows an A / A homozygous type, the chicken to be tested is a high-yielding laying hen.

[0014] The technical solution of the present invention mainly includes three parts: screening of genetic markers, detection method of the genetic markers, and accuracy verification of the detection method.

[0015] 1. Screening of Molecular Genetic Markers

[0016] 1) Phenotypic determination: The egg production data of 1353 Rock Island Red chickens at different stages were recorded, including egg production from the beginning of laying to 300 days of age, egg production from 301 days to 560 days of age, egg production from 561 days to 651 days of age, and total egg production.

[0017] 2) Whole-genome association analysis: Each individual was genotyped using a 55k gene chip. After the typing data passed quality control and the whole-genome significance threshold was calculated, the 55k variation information was used for whole-genome association analysis with the corresponding phenotypic data to obtain multiple loci significantly associated with egg production at each stage ( Figure 1 and Figure 2 ).

[0018] 3) Screening of candidate sites: Overlap analysis of sites significantly correlated at different stages revealed that 54 significant sites were associated with egg production at 301-560 days of age, egg production at 561-651 days of age, and total egg production. Bioinformatics annotation of the 54 sites revealed that 30 of the Top31 sites were located on chromosome 16, with a range of 2.47Mb-2.64Mb, and these 30 sites were highly linked to each other. Among them, the Top1 site chr16:2602463 (located at 2602463bp on chromosome 16, rs740363964, and the reference genome is GRCg6a) can be used as the Tag SNP of these 30 sites, which is a missense mutation, and multiple proteins involved in these 30 sites are enriched in various KEGG pathways related to amino acid synthesis and metabolism, ATP transport, endocytosis, and cell aging ( Figure 3-6 ). Therefore, chr16:2602463 was determined as a candidate site.

[0019] 4) Determination of the relationship between the genotype of the genetic marker and egg production

[0020] In this population, there are three genotypes at this locus: A / A, G / A, and G / G. The frequency of A is 0.61, and the frequency of G is 0.39. The average total egg production of A / A individuals is 422 eggs, the average total egg production of G / A individuals is 412 eggs, and the average total egg production of G / G individuals is 381 eggs. There is a statistical difference between the groups ( Figure 6 ). Therefore, it is determined that the A / A genotype at this site has a high egg production trait and should be retained; it is determined that the G / A and G / G genotypes at this site have medium and low egg production traits and can be eliminated.

[0021] 2. Method for detecting the genetic marker

[0022] 1) Blood collection: 0.1 mL of blood was collected from the venous vein of the chicken to be tested.

[0023] 2) Blood DNA extraction: Use a blood DNA extraction kit to extract blood sample DNA.

[0024] 3) PCR and product quality inspection: PCR amplification is performed using the designed specific primers and the extracted DNA. The amplified product should have a single band and a size of 340 bp. It can be used for subsequent sequencing after passing the agarose gel electrophoresis quality inspection.

[0025] 4) Product sequencing: Sanger sequencing was used to read the base information at the 240 bp of the amplified product.

[0026] 5) Result determination: If the result shows A / A homozygous type, it is a high egg-laying individual; if the result shows G / A heterozygous type or G / G homozygous type, it is a medium or low egg-laying individual ( Figure 7 ).

[0027] 3. Verification of the accuracy of the genetic marker detection method

[0028] The detection method was verified on another 96 individuals, showing that individuals with the A / A genotype at this site had higher egg production, indicating that the genetic markers and the detection method thereof in the present invention can effectively identify high-producing laying hens at an early stage.

[0029] The present invention records the egg production information of more than one thousand Luodao Red chickens at different stages, and uses 55k gene chips for genotyping. The whole genome association analysis (GWAS) of egg production at different stages, combined with the overlap screening strategy at different stages, screened out a SNP genetic marker (chr16:2602463, rs740363964, GRCg6a) that is highly correlated with the egg production of the group. In this group, there are 3 genotypes at this SNP site: A / A, G / A, and A / A. The average total egg production of A / A individuals is 422 eggs, the average total egg production of G / A individuals is 412 eggs, and the average total egg production of G / G individuals is 381 eggs, and there are statistical differences between the groups, judging that the A / A genotype at this site has a high egg production trait. Accordingly, the present invention has developed a blood DNA group detection method for this site and verified it to realize the preference for the A / A genotype at this site. Therefore, this genetic marker and its detection method can be used for the early selection of individuals with high egg production traits, avoiding the problems of long work cycle, high cost, large manpower and wide error in conventional breeding.

[0030] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: 1. The molecular genetic marker and its detection method can be used to identify high-yielding laying hens at an early stage, which can accelerate the breeding process; 2. The molecular genetic marker and its detection method only require a small amount of blood sampling to identify high-yielding laying hens at an early stage, which has the advantages of convenience, high throughput, and labor saving, and can save breeding costs; based on the breeding cost of a laying hen from brooding to elimination of 190 yuan / hen, according to the gene frequency of the population, A / A type high egg-producing individuals account for about 40% of the total population, so 60% of medium and low egg-producing individuals can be eliminated at an early stage; if 10,000 chickens are raised, excluding the detection cost of this method, about 1.1 million yuan in costs can be saved (10,000 × 190 yuan / hen × 60% - 40,000). BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The screening process of molecular genetic markers (chr16:2602463, GRCg6a): ac are the GWAS results of egg production from the first day of laying to 300 days, egg production from 301 days to 560 days, and egg production from 561 days to 651 days, respectively;

[0032] Figure 2 GWAS results for total egg production;

[0033] Figure 3 Overlap analysis of significantly correlated sites in four stages;

[0034] Figure 4 LD analysis revealed that chr16:2602463 could be used as a Tag SNP for these 30 loci;

[0035] Figure 5 Functional enrichment of proteins involved in these 30 sites;

[0036] Figure 6 It is a statistical analysis of the total egg production corresponding to the genotype of the site in the population, that is, the determination of the relationship between the genotype of the genetic marker and egg production. The A / A genotype has a high egg production trait, and the G / A and G / G genotypes have medium and low egg production traits;

[0037] Figure 7 The figure shows the interpretation of the results of the molecular genetic marker (chr16:2602463, GRCg6a) detection method: if the detection result shows a G / A double peak at 240bp, the genotype of the site is determined to be G / A, as shown in a; if a single peak of G is presented, the genotype of the site is determined to be G / G, as shown in b; if a single peak of A is presented, the genotype of the site is determined to be A / A, as shown in c. DETAILED DESCRIPTION

[0038] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0039] By using the genetic marker and the detection method thereof of the present invention, chickens with high egg production traits can be identified at an early stage, thereby guiding subsequent selection work.

[0040] Example 1 Screening of molecular genetic markers

[0041] 1) Phenotypic determination: The egg production data of the same generation breeding group at different stages were recorded. The breed is Luodao Red, and the recorded data volume is 1353 individuals. The group is raised in Baoding City, and the coordinates are 115.53, 39.46. The egg production data include: egg production from the beginning of laying to 300 days of age, egg production from 301 days to 560 days of age, egg production from 561 days to 651 days of age, and total egg production.

[0042] 2) Genome-wide association analysis: Each individual was genotyped using a 55k gene chip (the trade name of the gene chip is "Jingxin No. 1", and the test was provided by Beijing Compson Biotechnology Co., Ltd.). The typing data passed quality control (quality control parameters were: filtering individuals with sample detection rate <90%, filtering gene loci with genotype missing rate >10% and minimum allele frequency <5%), and the genome-wide significance threshold was calculated (1 / number of independent SNPs, and the number of independent SNPs was calculated using the parameter --indep-pairwise 25 5 0.2, that is, 25 SNPs were used as a sliding window and 5 SNPs were added each time, and the R value of any other SNP was 0. 2 The number of SNPs with a value greater than 0.2) was analyzed by genome-wide association analysis using a general linear model, with the variant sites that passed quality control being analyzed and the egg production data. Several sites that were significantly associated with egg production at each stage were obtained ( Figure 1 and Figure 2 ).

[0043] 3) Screening of candidate loci: Overlap analysis of loci significantly associated with different stages revealed that 54 significant loci were associated with egg production from 301 days to 560 days of age, egg production from 561 days to 651 days of age, and total egg production ( Figure 3 ). Bioinformatics annotation of the 54 loci (Table 1) revealed that 30 of the Top 31 loci were located on chromosome 16, with a range of 2.47Mb-2.64Mb, and these 30 loci were highly linked to each other ( Figure 4 ).

[0044] Table 1 30 loci located at chr16 in Top31 and their annotation information

[0045]

[0046]

[0047] Among them, the Top1 site chr16:2602463 (located at 2602463bp on chromosome 16, rs740363964, the reference genome is GRCg6a) can be used as the Tag SNP of these 30 sites, which is a missense mutation, and the multiple proteins involved in these 30 sites are enriched in the KEGG pathways related to various amino acid synthesis and metabolism, ATP transport, endocytosis, and cell aging ( Figure 5 ). Therefore, chr16:2602463 was determined as a candidate site.

[0048] 4) Determination of the relationship between the genotype of the genetic marker and egg production

[0049] In this population, there are three genotypes at this locus: A / A, G / A, and G / G. The frequency of A is 0.61, and the frequency of G is 0.39. The average total egg production of A / A individuals is 422 eggs, the average total egg production of G / A individuals is 412 eggs, and the average total egg production of G / G individuals is 381 eggs. There is a statistical difference between the groups ( Figure 6 ). Therefore, the A / A genotype at this site is judged to have a high egg production trait and should be retained; the G / A and G / G genotypes at this site are judged to have medium and low egg production traits and can be eliminated. Among them, the definition of high, medium and low egg production is based on the median level of egg production in the group. Statistically significantly higher than the median level is defined as high production, significantly lower than the median level is defined as low production, and no difference from the median level is defined as medium production.

[0050] Example 2 Detection method of the genetic marker

[0051] 1) Blood collection: Using a blood collection needle and an anticoagulant EDTA vacuum blood collection tube, 0.1-0.3 mL of blood from each chicken to be tested was collected from the subwing vein of 96 hens for subsequent testing.

[0052] 2) Blood DNA group extraction: Use a blood DNA extraction kit (Tiangen Biotechnology, DP348) to extract blood sample DNA according to the operating procedures, measure the DNA concentration, and control the DNA concentration to about 100 ng / μL for subsequent PCR.

[0053] 3) PCR: PCR amplification was performed with the extracted DNA using specific primers designed for the molecular genetic marker (chr16:2602463) (see Table 2 for reagents). A 20 μL reaction system was used, and the composition of the reaction system and the reaction procedure are shown in Tables 3 and 4. The amplified product was used for subsequent use.

[0054] Table 2

[0055]

[0056]

[0057] Table 3

[0058]

[0059] Table 4

[0060]

[0061] 4) Quality inspection and sequencing of amplified products: Take 1 μL of amplified products, mix with 1 μL of nucleic acid dye, and use DNA marker to perform 1.5% agarose gel electrophoresis. After the electrophoresis, if a single band of 340 bp is present, it indicates that the quality inspection has passed and can be used for subsequent sequencing. The sequence of the amplification product is: 5'-TGGGTTTGGGGGTCCTGT CCATATCTGGGGGTCCTCTGATGGGTTCTGGGCACTCCACTGACCCTTTGTGATTGTCTGAAGGGTTCTGGGCTCTCCATTGACCCTTTGTGATTGTCTGAAGGGTTCTGGGCTCTCCATTGACCCCTGATGGGTTTTGGAGTCGCCCCCCCAATTCCTTCCCAGCTCGCTGTTTGCCGGCTGCCGCGGTGGCCTCTTCACCTTCATCAGGTTCCCGCTTC(G / A)TCT TGCGCACCCGCGACCAGCTCTTCTCCAGCCTGGTGTACCGGGACCTCGCCTTCTTC CAGAAGACCACAGCAGGTACAGACTGGGGGCACTTTTGTCC-3'.

[0062] 5) The amplified products that passed the quality inspection were sequenced using Sanger sequencing to obtain sequencing data and read the base information at the 240 bp position.

[0063] 6) Result determination: If the A / A homozygous type is shown here, it is a high egg-laying individual; if the G / A heterozygous type or the G / G homozygous type is shown here, it is a medium or low egg-laying individual. The results show that among the 96 chickens, there are 43 A / A type chickens, 31 G / A type chickens, and 22 G / G type chickens at this site. According to the result determination criteria, the A / A type individuals are retained, and the G / A and G / G type individuals are eliminated. The egg-laying situation of the 43 A / A type individuals retained was tracked, and 39 of them had an egg-laying amount higher than the group average, which are high-yielding individuals, and the accuracy rate can reach more than 90%.

Claims

1. The use of the molecular genetic marker YZU-LAYER-MGM-1 or a detection kit containing the molecular genetic marker YZU-LAYER-MGM-1 in determining egg production traits, characterized in that: The molecular genetic marker YZU-LAYER-MGM-1 is located at 2602463 bp of chromosome 16.

2. The use according to claim 1, characterized in that: The genotype of the molecular genetic marker YZU-LAYER-MGM-1 is A / A, G / A or G / G.

3. The application according to claim 1, characterized in that: When the genotype is A / A, the egg production trait is a high egg production trait; when the genotype is G / A, the egg production trait is a medium egg production trait; when the genotype is G / G, the egg production trait is a low egg production trait.

4. The use of the molecular genetic marker YZU-LAYER-MGM-1 or a detection kit containing the molecular genetic marker YZU-LAYER-MGM-1 in identifying high-yielding laying hens, characterized in that: The molecular genetic marker YZU-LAYER-MGM-1 is located at 2602463 bp of chromosome 16.

5. The application according to claim 4, characterized in that: The genotype of the molecular genetic marker YZU-LAYER-MGM-1 is A / A, G / A or G / G.

6. The use according to claim 4, characterized in that: When the genotype is A / A, the chicken to be tested is a high-yielding laying hen.

7. Use of the specific primer pair of the molecular genetic marker YZU-LAYER-MGM-1 according to claim 1 or a kit containing the specific primer pair in determining egg production traits, characterized in that: The nucleotide sequences of the specific primer pair are shown in SEQ ID NO.1 and SEQ ID NO.

2.

8. The use according to claim 7, characterized in that: The following steps are involved: The DNA of the chicken to be tested is used as a template and the specific primer pair is used for PCR amplification; when the 240bp position of the amplification product sequence shows an A / A homozygous type, the chicken to be tested has a high egg production trait; when the 240bp position of the amplification product sequence shows a G / A heterozygous type, the chicken to be tested has a medium egg production trait; when the 240bp position of the amplification product sequence shows a G / G homozygous type, the chicken to be tested has a low egg production trait.

9. Use of the specific primer pair of the molecular genetic marker YZU-LAYER-MGM-1 according to claim 1 or a kit containing the specific primer pair in identifying high-yielding laying hens, characterized in that: The nucleotide sequences of the specific primer pair are shown in SEQ ID NO.1 and SEQ ID NO.

2.

10. The use according to claim 9, characterized in that: The following steps are involved: The DNA of the chicken to be tested is used as a template and the specific primer pair is used for PCR amplification; when the 240 bp position of the amplified product sequence shows an A / A homozygous type, the chicken to be tested is a high-yielding laying hen.

Images