DCAPS molecular marker for identifying wheat leaf rust resistance associated SNP site and application of dCAPS molecular marker

Abstract

The invention discloses a dCAPS molecular marker for identifying a wheat leaf rust resistance associated SNP site and application of the dCAPS molecular marker, and belongs to the technical field of wheat disease resistance breeding and molecular biology. The invention develops a dCAPS molecular marker of SNP (Single Nucleotide Polymorphism) linked with a leaf rust resistance genetic locus QLr.hebau-1BS in a wheat adult-plant stage by virtue of 277 parts of wheat materials which have genotype data and are introduced from Turkey and in combination with a Chinese spring reference sequence. By utilizing the molecular marker, different wheat can be accurately and quickly detected, early-stage molecular-assisted selection of leaf rust resistant germplasm materials in the adult-plant stage is realized, and the wheat disease-resistant breeding efficiency is improved. The method solves the problem of high difficulty in detecting the leaf rust resistance gene in the wheat adult-plant stage in the prior art, and is suitable for the field of molecular genetic breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of wheat disease resistance breeding and molecular biology, and in particular relates to a dCAPS molecular marker for identifying wheat leaf rust resistance associated SNP sites and an application thereof. Background Art

[0002] Common wheat (Triticum aestivum) is an important food crop worldwide. Its disease resistance and stable yield are of great significance to world food security and agricultural development. With global warming and the toxicity variation of leaf rust, the damage of wheat leaf rust is showing a trend of aggravation. Wheat leaf rust caused by leaf rust (Puccinia triticinaa) is widely distributed throughout the world. The southern United States, South America, Canada, Egypt and most wheat-growing areas in my country are all epidemic areas of wheat leaf rust, and it occurs widely in wheat-growing areas around the world (Khan MH, et al. Agric. Sci., 2013). Breeding disease-resistant varieties is still the most economical and environmentally friendly means to reduce the damage of leaf rust. However, controlled by relatively complex quantitative genetic loci (QTL), the genetic research on wheat leaf rust resistance is still relatively lagging, and disease-resistant germplasm resources are also urgently needed to be explored. Subsequently, my country began to screen wheat leaf rust-resistant germplasm resources and disease-resistant genes. At present, our group has systematically sorted out the progress of genetic research on wheat leaf rust resistance. There are about 161 reported wheat leaf rust resistance loci / genes, distributed on 21 chromosomes (Ren Xiaopeng, Suatainability, 2023).

[0003] Molecular markers usually refer to DNA molecular markers, which refer to the differences in DNA sequences between individuals or species, are close to or closely linked to the target gene expressing a certain trait, and do not affect the expression of the target gene. According to the detection method and development history, DNA molecular markers are divided into three categories: the first generation of molecular marker technology is based on molecular hybridization technology, such as restriction endonuclease fragment length polymorphism (RFLP); the second generation of molecular marker technology is based on PCR technology, such as random amplified polymorphic DNA markers (RAPD) and simple sequence repeats (SSR); the third generation of molecular marker technology is based on DNA sequences, such as single nucleotide polymorphisms (SNP) (Amiteye et al., 2021). With the application of second-generation sequencing and third-generation sequencing technologies, research on SSR and SNP molecular markers has gradually occupied a major position in plant research. Molecular marker-assisted selection breeding is one of the most important uses of molecular markers. Selecting phenotypes based on the genotypes of molecular markers can overcome the time-consuming and labor-intensive shortcomings of traditional breeding.

[0004] A simple method for detecting SNPs is to use restriction amplified polymorphic sequence (CAPS) markers or derived CAPS markers (dCAPS). Both methods combine PCR amplification with restriction digestion, using restriction endonucleases to identify the target SNP site sequence and perform digestion, followed by electrophoresis typing and identification. CAPS markers can be developed for SNP sequences with naturally occurring restriction sites, while dCAPS can be developed for SNPs with non-naturally occurring restriction sites by artificially introducing mutant bases. CAPS and dCAPS molecular markers have the characteristics of co-dominance, site specificity, simple operation, rapid detection, low cost, and independence from precision instruments and equipment, and can be used for rapid genotyping, positioning, genetic diversity analysis, and variety identification of plants.

[0005] Currently, there are few studies and reports on dCAPS molecular markers related to wheat leaf rust resistance at the adult stage. Therefore, there is an increasing need to develop dCAPS molecular markers related to wheat leaf rust and use them to accurately and rapidly identify the resistance of wheat and its hybrid progeny to leaf rust at the adult stage. Summary of the invention

[0006] The present invention uses 277 wheat materials from Turkey that have genotype data and combines them with the Chinese Spring reference sequence to develop a molecular marker that is tightly linked to the wheat leaf rust resistance genetic locus QLr.hebau-1BS in the adult stage. The molecular marker can be used to accurately and quickly detect different wheats, realize early molecular assisted selection of germplasm materials resistant to leaf rust in the adult stage, and improve the efficiency of wheat disease resistance breeding. The present invention solves the problem of difficulty in detecting wheat leaf rust resistance genes in the adult stage in the prior art, and is applicable to the field of molecular genetic breeding.

[0007] The invention provides a SNP molecular marker tightly linked to the leaf rust resistance trait of wheat in the adult stage. The SNP molecular marker is located at the 308011295th base on chromosome 1B of the wheat Chinese Spring reference sequence, and its polymorphic site is A / G.

[0008] The present invention also provides a dCAPS molecular marker developed based on the above SNP molecular marker, and the nucleotide sequence of the dCAPS molecular marker is shown as SEQ ID NO.1 or 2.

[0009] Preferably, the dCAPS molecular marker is obtained by amplifying primers with sequences as shown in SEQ ID NO.3-4.

[0010] The present invention also provides an application of a reagent for detecting the above-mentioned SNP molecular marker in identifying genetic loci for resistance to leaf rust in wheat at the adult stage. When the genotype of the SNP molecular marker is AA, it is determined that the sample does not contain the disease-resistant genetic loci; when the genotype of the SNP molecular marker is GG, it is determined that the sample contains the disease-resistant genetic loci.

[0011] Preferably, the reagent contains primers whose sequences are shown in SEQ ID NO.3-4.

[0012] The present invention also provides a product for identifying wheat leaf rust resistance genetic loci in the adult plant stage, wherein the product contains a reagent for detecting the SNP molecular marker.

[0013] Preferably, the product is a kit.

[0014] More preferably, the kit contains primers whose sequences are shown as SEQ ID NO.3-4.

[0015] More preferably, the kit further comprises restriction endonuclease HphI.

[0016] The present invention also provides a method for identifying genetic loci for resistance to leaf rust in wheat at the adult stage, the method comprising the following steps:

[0017] (1) using the genomic DNA of the wheat to be tested as a template, and performing a PCR amplification reaction using primers with sequences as shown in SEQ ID NO.3 and SEQ ID NO.4;

[0018] (2) using restriction endonuclease HphI to digest the PCR amplification product; if the digestion product contains two main bands of 169 bp and 26 bp, the wheat to be tested does not contain the disease resistance genetic locus; if the digestion product contains only one main band of 195 bp, the wheat to be tested contains the disease resistance genetic locus.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The dCAPS molecular marker of the present invention can be used to quickly and accurately detect wheat leaf rust resistance strains (in a short time, the results can be obtained within a few hours), greatly improving the detection accuracy and shortening the detection time, and can accelerate the disease breeding process of wheat leaf rust resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the Manhattan plot of the genome-wide association analysis of leaf rust resistance genetic loci for 277 Turkish wheat materials in Example 1.

[0022] Figure 2The agarose gel electrophoresis results after PCR amplification of 6 disease-resistant materials and 6 susceptible materials of Turkish wheat using dCAPS primers in Example 2, wherein: M is DL2000 Marker, R is the disease-resistant material, S is the susceptible material, and the length of the amplified product is 195 bp.

[0023] Figure 3 The agarose gel electrophoresis results of the PCR products of the six disease-resistant materials and the six disease-susceptible materials in Example 2 after digestion with the corresponding restriction endonucleases, wherein: M is the DL2000 Marker, R1-R6 represent the electrophoresis results of the PCR products of the adult plant leaf rust resistant materials after digestion, and S1-S6 represent the electrophoresis results of the PCR products of the adult plant leaf rust susceptible materials after digestion.

[0024] Figure 4 For other wheat materials in Example 3, HUBARA-5 / ANGI-1 (S1'), Xinmai 9 (S2'), Laizhou 953 (S3'), ALTTAR 84 / AE.SQUARROSA (219) / / SERI / 3 / MASSIRA (S4'), Mianyang 79-2 (S5'), oord (S6'), KATILA-7 / 4 / CROC-1 / AE.SQUARROSA (224) / / OPATA / 3 / PASTOR / 5 / PA STOR / / MUNIA / ALTAR 84 (R1'), ATTILA*2 / CROW / 3 / KAUZ / / KAUZ / STAR / 4 / ATTILA 50Y / / ATTILA / BCN / 3 / SEKSAKA-1 (R2'), KARAWAN-1 / TALLO 3 / / Agarose gel electrophoresis results after PCR amplification of JADIDA-2 (R3'), Reeves (R4'), Heng 136 (R5'), and Yumai 48 (R6'), where: M is DL2000 Marker, R' is the disease-resistant material, S' is the disease-susceptible material (other wheat materials are divided into R' and S' according to the enzyme digestion results), and the length of the amplified products is 195bp.

[0025] Figure 5 The agarose gel electrophoresis results of the PCR products of the susceptible materials and the resistant materials in Example 3 after digestion with the corresponding restriction endonucleases, wherein: M is the D2000 Marker, R' represents the electrophoresis result of the PCR products of the adult plant leaf rust resistant material after digestion, and S' represents the electrophoresis result of the PCR products of the adult plant leaf rust susceptible material after digestion. DETAILED DESCRIPTION

[0026] Example 1 Acquisition of linked SNP loci for wheat leaf rust resistance

[0027] With leaf rust (Puccinia triticinaa) as the pathogen, the method of inoculating leaf rust in the late stage of field planting was adopted. In late October, 277 Turkish wheat materials were identified for disease resistance at the third plant of Hebei Agricultural University. Each material was sown in one row, with a row length of 2m and a row spacing of 25cm. One row of the control variety Xiaoyan 22 was sown every 10 rows. Around mid-April of the following year, the test materials were inoculated with fungi by the powder spraying method after jointing. The specific method was: leaf rust spore powder and talcum powder were uniformly mixed in a ratio of 1:1000, and the test materials were uniformly sprayed with 0.03% Tween 20 aqueous solution in the evening, and then the leaf rust spore powder was sprayed on the leaf surface of the test materials with a powder sprayer. The ground film was covered to keep moisture for 3 days and then uncovered. After about 30 days, the disease was fully developed and investigated. In this study, the grading of leaf rust in the adult plant stage adopted a 0-100% severity grading standard, and an assessment of the resistance to leaf rust in the adult plant was conducted on 277 global wheat germplasm resources introduced from Turkey (most of the wheat materials were breeding materials with only germplasm pedigrees). It was found that about 53% of the wheat materials showed a high level of resistance to leaf rust.

[0028] Combined with the existing chip data of the above materials, a genome-wide association analysis (GWAS) was performed on the wheat leaf rust resistance genetic locus in the adult stage, and three high-confidence linked SNP loci were obtained, which were adjacently distributed in the physical segment of the 1BS chromosome with a length of about 60.79Mb. This segment was named the wheat leaf rust resistance genetic locus QLr.hebau-1BS. Phenotypic effect analysis and haplotype analysis were performed on the three SNPs. The genotype of 1B-AX-110439262 can basically reflect the haplotype of QLr.turkey-1BS. dCAPS primers were designed based on 1B-AX-110439262. The SNP locus 1B-AX-110439262 is located at the physical position 308011295bp, the reference genome base is A, the mutant base is G, and the P value is 0.089647301. These mutations are significantly different in disease-resistant and susceptible wheat, so it is predicted that SNP site 1B-AX-110439262 is significantly associated with wheat leaf rust resistance in the adult stage.

[0029] Example 2 Development of tightly linked dCAPS molecular markers for wheat leaf rust resistance

[0030] 1. Design of dCAPS primers

[0031] According to the SNP site provided in Example 1, adjacent sequences were extracted from the Chinese Spring genome, and dCAPS primer pairs were designed using dCAPS Finder2.0 (http: / / helix.wustl.edu / dcaps / ):

[0032] 1B-AX-110439262(dCAPS):

[0033] Forward primer: GATAGTTGTTATGCCTTTTTGGGTG (SEQ ID NO. 3);

[0034] Reverse primer: CATGCACTCACTCCCTTCTTTTAAC (SEQ ID NO. 4).

[0035] The PCR amplification product based on this primer pair is 195bp, and its sequence is shown in SEQ ID NO.1 or SEQ ID NO.2. The 26th position of the sequence is A / G, which is a polymorphic site. Resequencing data analysis revealed that wheat germplasm has two genotypes at this site, AA and GG. The genotype AA can be digested by enzymes, while the genotype GG cannot be digested by enzymes.

[0036] SEQ ID NO.1:

[0037] GATAGTTGTTATGCCTTTTTGGGAG A ATTTTCTTGATGTGAATGAACAAACTTCTAGAGTCCAGAGGCAGTGTGGAACATAATTGCCACCTTAGTTGGTAAAAAAAAATGTTCATACCATAAAATTAATGAGTTCATTGCAGCGAAGGGTGTGCATTGTAGATTTTTAGTGTTAAAAGAAGGGAGTGAGTGCATG;

[0038] SEQ ID NO.2:

[0039] GATAGTTGTTATGCCTTTTTGGGAG G ATTTTCTTGATGTGAATGAACAAACTTCTAGAGTCCAGAGGCAGTGTGGAACATAATTGCCACCTTAGTTGGTAAAAAAAAATGTTCATACCATAAAATTAATGAGTTCATTGCAGCGAAGGGTGTGCATTGTAGATTTTTAGTGTTAAAAGAAGGGAGTGAGTGCATG.

[0040] 2. Extraction and PCR amplification of sample genomic DNA

[0041] All wheat materials used in this study were breeding materials introduced from abroad, and material information can be found on the USDA-GRIN website (https: / / www.ars-grin.gov / ). Six susceptible materials (S1-S6 were MARVDASHT / SOISSO NS / / ALVAND / 3 / EKIZ, ESPADA / KARAHAN, PVN / / CAR422 / ANA / 5 / BOW / CROW / / BUC / PVN / 3 / YR / 4 / TRAP#1 / 6 / WELS-2 / 7 / AP01T2421 / BCG99-156, GEREK79, URUP, KARAHAN) and seven resistant materials (R1-R7 were ALTAR 84 / AE.SQ.(J BANGOR) / / ESDA / 3 / KAUZ / STAR / / U1254-1-5-1-1 / TX89V4213(OCW00S063S-2) / 4 / OK95548 / TXHBG0358(OK05303), FGMU T293, K1329A4 / SELYANKA / 3 / BONITO / / KAREE / TUGELA, NIKIFOR / / KROSHKA, T.TAU.83.2.36 / ATTILA / / TAM200 / KAUZ / 3 / F130-L-1-12*2 / MILAN, ALEX) and 12 other wheat materials HUBARA-5 / ANGI-1(S1'), Xinmai 9(S2'), Laizhou 953(S3'), ALTTAR 84 / AE.SQUARR OSA(219) / / SERI / 3 / MASSIRA(S4'), Mianyang 79-2(S5'), oord(S6'), KATILA-7 / 4 / CRO C-1 / AE.SQUARROSA(224) / / OPATA / 3 / PASTOR / 5 / PASTOR / / MUNIA / ALTAR Genomic DNA was extracted from young leaves of wheat varieties 84 (R1'), ATTILA*2 / CROW / 3 / KAUZ / / KAUZ / STAR / 4 / ATTILA50Y / / ATTILA / BCN / 3 / SEKSAKA-1 (R2'), KARAWAN-1 / TALLO 3 / / JADIDA-2 (R3'), Reeves (R4'), Heng 136 (R5'), and Yumai 48 (R6') for subsequent dCAPS molecular marker development experiments;

[0042] DNA extraction method:

[0043] (1) Take samples in the greenhouse, cut one wheat leaf into small pieces and place them in a 2 mL centrifuge tube (if not extracted immediately, store at -80°C);

[0044] (2) Add a grinding bead to each centrifuge tube, cool it in liquid nitrogen, and then put it into the freezer grinder (pay attention to balancing). Set the temperature of the freezer grinder to -50°C, set the frequency to 70Hz, work time to 70S, interval time to 8S, and cycle number to 3 times. After grinding, take it out, check whether it is completely ground, and weigh it;

[0045] (3) Add 600 μL of DNA extraction buffer to each tube (to fully expose the DNA of the ground tissue), shake thoroughly, and place in a 65°C water bath for 30 min;

[0046] (4) Place the tube on ice for 15 min, cool it to room temperature, add 300 μL of 6 mol / L ammonium acetate, mix well, and place in a 4°C refrigerator for 15 min;

[0047] (5) Centrifuge at 12000 rpm for 5 min and collect 600 μL of supernatant;

[0048] (6) Add 360 μL of isopropanol to a new 1.5 mL centrifuge tube, take 600 μL of the supernatant from the previous step and add it to mix well, let the DNA precipitate, and place it in a 4 °C refrigerator for 5 min;

[0049] (7) Centrifuge at 12000 rpm for 15 min to precipitate the DNA and remove the supernatant (this step should not take too long to prevent DNA loss);

[0050] (8) Add 500 μL of 75% alcohol to clean the DNA. Flick the DNA off the bottom of the tube to clean it.

[0051] (9) Centrifuge at 12000 rpm for 1 min and discard the supernatant;

[0052] (10) Repeat steps 8 and 9 once;

[0053] (11) Aspirate the supernatant, place a 1.5 mL centrifuge tube in a clean bench, open the lid, and blow dry;

[0054] (12) Use 100 μL of sterile water to dissolve the DNA. Leave it at room temperature for half a day until the DNA at the bottom dissolves.

[0055] The extracted sample DNA was diluted to a concentration of 100 ng / μL as a template, and the PCR reaction system (15 μL) was constructed according to the following conditions: 1 μL of genomic template, 1 μL of upstream primer with OD = 0.1, 1 μL of downstream primer with OD = 0.1, 7.5 μL of 2× Rapid Taq Master Mix, and 4.5 μL of ddH2O.

[0056] The PCR amplification program for 1B-AX-110439262 was as follows: pre-denaturation at 94°C for 5 min, cycle parameters of denaturation at 94°C for 30 s, annealing at 62°C for 30 s, extension at 72°C for 12 s, for 35 cycles, and full extension at 72°C for 10 min.

[0057] After the amplification, the amplified products were stored at 4°C. The amplified products were tested by 1% agarose gel electrophoresis and photographed under a UV gel imaging system. The electrophoresis results were as follows: Figure 2 shown.

[0058] Depend on Figure 2 It can be seen that all samples of 1B-AX-110439262 obtained an amplification product of 195 bp.

[0059] 4. Identification of material amplification products

[0060] The extracted genomic DNA was amplified using TIANGEN's 2×Taq PCR Mix, the primers used were the above-mentioned dCAPS primer pair, and the amplification system (15 μL) was: 2×Taq PCR Mix 7.5 μL, template DNA 1 μL, upstream primer 1 μL with OD=0.1, downstream primer 1 μL with OD=0.1, 4.5 μL ddH2O, and the amplification procedures were consistent with the above-mentioned amplification procedures.

[0061] Some PCR amplification products were selected and sent to the Bioengineering Sequencing Department for sequencing. The results showed that there were differences in the 1B-AX-110439262 sequences of the resistant and susceptible materials, the genotype of the resistant material was GG, and the genotype of the susceptible material was AA.

[0062] 5. Enzyme Digestion

[0063] The PCR product of 1B-AX-110439262 obtained in step 2 of this example was digested with restriction endonuclease Hph I from Thermo Fisher, and the digestion system (15 μL) was as follows: 7 μL of PCR product, 1 μL of 10×Tango Buffer, 0.5 μL of Hph I, and 6.5 μL of ddH2O. The digestion conditions were: 37° C. and 3 h of digestion time.

[0064] The above enzyme digestion products were subjected to 3% polyacrylamide gel electrophoresis, with a sample volume of 15 μL and electrophoresis conditions of 65 V, 100 mA, and 50 min. Figure 3 ) were subjected to electrophoresis respectively.

[0065] comprehensive Figure 2 and Figure 3It was found that the PCR product (R) of the disease-resistant material and the PCR product (S) of the susceptible material according to the marker 1B-AX-110439262 were both 195bp. After Hph I digestion, the agarose gel electrophoresis results (R1-R6) of the disease-resistant material had a main band of 195bp, and the electrophoresis results (S1-S6) of the susceptible parent had a main band of 169bp (the main band was significantly smaller than 195bp) and a short band of 26bp. The results showed that when the genotype was GG, i.e., the disease-resistant genotype, Hph I could not digest its PCR product, and only a main band of 195bp existed after digestion; when the genotype was AA, i.e., the disease-susceptible genotype, under the same conditions, the amplified product could be digested, and after digestion, there was a main band of 169bp and a short band of 26bp (the short band was not obvious, and the main band of 169bp was smaller than the band of 195bp after digestion of the disease-resistant material).

[0066] The above results show that the 1B-AX-110439262 locus genotypes of the resistant and susceptible materials are consistent with the genome and resequencing data. Amplification using the dCAPS primers in the patent application of the present invention, combined with the Hph I enzyme digestion results, can accurately distinguish the different genotypes of the resistant and susceptible materials.

[0067] Example 3 Verification Experiment

[0068] Wheat materials other than the 12 research materials were selected: HUBARA-5 / ANGI-1(S1'), Xinmai 9(S2'), Laizhou 953(S3'), ALTTAR 84 / AE.SQUARROSA(219) / / SERI / 3 / MASSIRA(S4'), Mianyang 79-2(S5'), oord(S6'), KATILA-7 / 4 / CROC-1 / AE.SQUARROSA(224) / / OPATA / 3 / PASTOR / 5 / PASTOR / / MUNIA / ALTAR 84(R1'), ATTILA*2 / CROW / 3 / KAUZ / / KAUZ / STAR / 4 / ATTILA 50Y / / ATTILA / BCN / 3 / SEKSAKA-1(R2'), KARAWAN-1 / TALLO 3 / / JADIDA-2(R3'), Ree ves (R4'), Heng 136 (R5'), Yumai 48 (R6') were used to verify the dCAPS molecular markers. The method was consistent with parts 3 and 4 of Example 2. The amplification results were as follows: Figure 4 As shown, the enzyme digestion results are as follows Figure 5 As shown, the experimental results are consistent with the conclusions.

[0069] In summary, the dCAPS molecular marker designed for this SNP site in the present invention can be effectively used for the molecular identification of wheat varieties with leaf rust resistance at different adult stages. The development of this dCAPS marker can significantly shorten the breeding period and reduce the cost of breeding work, which is of great significance in the cultivation of wheat varieties with leaf rust resistance at the adult stage using wheat germplasm resources.

[0070] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A SNP molecular marker tightly linked to wheat leaf rust resistance at adult stage, characterized in that: The SNP molecular marker is located at the 308011295th base on chromosome 1B of the wheat Chinese Spring reference sequence, and its polymorphic site is A / G.

2. A dCAPS molecular marker developed based on the SNP molecular marker according to claim 1, characterized in that: The nucleotide sequence of the dCAPS molecular marker is shown as SEQ ID NO.1 or 2.

3. The dCAPS molecular marker according to claim 2, characterized in that: The dCAPS molecular marker is obtained by amplifying the primers whose sequences are shown in SEQ ID NO.3-4.

4. Use of a reagent for detecting the SNP molecular marker according to claim 1 in identifying genetic loci for resistance to leaf rust in wheat adult plants, characterized in that: When the genotype of the SNP molecular marker is AA, the sample is determined to be a susceptible material; when the genotype of the SNP molecular marker is GG, the sample is determined to be a resistant material.

5. The use according to claim 4, characterized in that: The reagent contains primers with sequences as shown in SEQ ID NO.3-4.

6. A product for identifying genetic loci for resistance to leaf rust in wheat at the adult stage, characterized in that: The product contains a reagent for detecting the SNP molecular marker described in claim 1.

7. The product according to claim 6, characterized in that The product is a test kit.

8. The product according to claim 7, characterized in that The kit contains primers with sequences as shown in SEQ ID NO.3-4.

9. The product according to claim 8, characterized in that The kit also contains restriction endonuclease HphI.

10. A method for identifying genetic loci for resistance to leaf rust in wheat at the adult stage, characterized in that: The method comprises the following steps: (1) using the genomic DNA of the wheat to be tested as a template, and performing a PCR amplification reaction using primers with sequences as shown in SEQ ID NO.3 and SEQ ID NO.4; (2) using restriction endonuclease HphI to digest the PCR amplification product; if the digestion product contains two main bands of 169 bp and 26 bp, the wheat to be tested does not contain the disease resistance genetic locus; if the digestion product contains only one main band of 195 bp, the wheat to be tested contains the disease resistance genetic locus.

Images