Application of rice brown planthopper resistance gene OsCYT2 in rice brown planthopper resistance

Abstract

The invention discloses application of a rice brown planthopper resistant gene OsCYT2 in rice brown planthopper resistance, and relates to the technical field of brown planthopper resistant transgenic rice. According to the invention, through agrobacterium-mediated genetic transformation, the OsCYT2 gene is transferred into an insect-susceptible rice variety Nipponbare, and the resistance of a plant over-expressed with the OsCYT2 gene to brown planthopper is enhanced. After the brown planthopper eats the transgenic plant, the survival rate of the brown planthopper is reduced, the weight gain of the brown planthopper is reduced, and the amount of secreted honeydew is reduced. The new insect-resistant function of the gene OsCYT2 found by the invention has reference significance for researching gene molecular functions and breeding.

Description

Technical Field

[0001] The invention relates to the technical field of brown planthopper-resistant transgenic rice, and in particular to application of a rice brown planthopper-resistant gene OsCYT2 in rice brown planthopper resistance. Background Art

[0002] Brown planthoppers are the largest pests in rice production. Adults or nymphs of brown planthoppers gather at the base of rice bushes, sucking sap from the phloem and consuming nutrients from rice plants. When brown planthoppers break out, the lower part of rice plants turns black, paralyzed and fall over, and rice fields wither in large areas, eventually leading to reduced or even total crop failure. Therefore, curbing the development and harm of brown planthoppers is a major need to ensure the safety of rice production.

[0003] Plant cysteine ​​protease inhibitors (also known as cystatins) are competitive and reversible inhibitors of cysteine ​​proteases that have been found to be widely present in different plant species. Most cysteine ​​proteases have been shown to inhibit the activity of L-like cysteine ​​proteases in the peptidase C1A family (Alvarez-Fernandez et al., 1999; Martínez et al., 2007). It competitively interacts with the active site of the target protease and blocks the access of its protein substrate. Some studies have demonstrated that plant cysteine ​​proteases can effectively inhibit nematode (Chan et al., 2010) and fungal infections (ValdesRodriguez et al., 2010); environmental stresses that trigger plant gene expression and physiological responses also lead to the differential expression of plant cystatins to overcome stress and improve plant tolerance (Benchabane et al., 2010). These studies have shown that plant cystatins play a vital role in several basic processes of plant development.

[0004] Therefore, identifying and discovering new resistance genes and germplasm resources is of great significance for the breeding and cultivation of new rice varieties resistant to brown planthoppers. Summary of the invention

[0005] The present invention provides an application of the rice cysteine ​​proteinase inhibitor gene OsCYT2 in rice resistance to brown planthoppers. After in-depth research, the present invention found that after brown planthoppers feed on rice leaf sheaths, when the control rice plants die, the OsCYT2 overexpression plants grow normally; after brown planthoppers feed on the leaf sheaths of overexpression plants, the survival rate decreases, the weight gain decreases, and the amount of honeydew secreted decreases. This shows that the overexpression of the gene OsCYT2 can enhance the brown planthopper resistance of rice. Specifically, the present invention is achieved by the following technologies.

[0006] In a first aspect of the present invention, a rice cysteine ​​protease inhibitor gene OsCYT2 for resistance to brown planthoppers is provided, wherein the gene OsCYT2 is used to encode a protein as shown in SEQ ID NO.1; or, is used to encode a protein in which one or more amino acids are substituted, deleted or added to the amino acid sequence shown in SEQ ID NO.1 and which has the same function as the amino acid sequence shown in SEQ ID NO.1.

[0007] Cysteine ​​proteinase inhibitors are an important class of plant cystatins, which can inhibit the proteolytic function of papaya-like cysteine ​​proteinases and participate in regulating rice growth, aging, seed germination, reproduction and defense. The present invention uses the rice brown planthopper resistance gene OsCYT2 encoding cysteine ​​proteinase inhibitors for functional research on plant resistance to brown planthoppers, which is the first time in the industry. It was finally found that after the gene OsCYT2 was overexpressed in insect-susceptible rice plants, the resistance of rice to brown planthoppers was significantly enhanced.

[0008] Furthermore, the nucleotide sequence of the CDS of the gene OsCYT2 is as shown in SEQ ID NO.2; or, the nucleotide sequence as shown in SEQ ID NO.2 is replaced, deleted and / or added with one or more nucleotides and expresses a nucleotide sequence of a protein with the same function.

[0009] The gene OsCYT2 studied in the present invention is derived from the cDNA of japonica rice Nipponbare. The ORF sequence of the gene is shown in SEQ ID NO.2. The full length of the ORF is 456 bp and encodes 151 amino acids.

[0010] It should be understood that, according to the amino acid sequence shown in SEQ ID NO.1 or the nucleotide sequence shown in SEQ ID NO.2, one or more nucleotides are replaced, deleted and / or added to obtain an amino acid sequence with the same function as the protein of SEQ ID NO.1. For example, in the sequences under different rice backgrounds, one or more nucleotides are replaced or deleted, and the encoded amino acid sequence has no frameshift mutation, and only some amino acids are deleted or point mutations occur. Therefore, the protein and the corresponding encoding gene of the present invention also include the amino acid sequence shown in SEQ ID NO:1 or the nucleotide sequence shown in SEQ ID NO.2, which is replaced, deleted and / or added with one or more nucleotides, and has the same function.

[0011] The present invention discovered a gene OsCYT2 in rice resistant to brown planthoppers that was upregulated by brown planthopper feeding in rice resistant to brown planthoppers through transcriptome analysis. An OsCYT2 gene overexpression vector was further constructed, and the vector backbone was a pCXUN vector containing a Ubiquinti promoter; the overexpression vector was introduced into the insect-susceptible rice variety Nipponbare by using an Agrobacterium EHA105-mediated genetic transformation method, and transgenic plants were screened to finally obtain positive transgenic rice plants with overexpression of the OsCYT2 gene. Then, quantitative PCR analysis was performed on the plants of the T2 generation, and two representative strains (CYT2OE-1 and CYT2OE-2) with relatively high expression levels were selected for functional verification. The transgenic plants of the T2 generation were identified for insect resistance, including the seedling group method, survival rate, insect weight gain and honeydew amount, and it was finally found that the resistance of the two strains to brown planthoppers was significantly enhanced.

[0012] The second aspect of the present invention provides a biological material for enhancing the brown planthopper resistance of rice, wherein the biological material contains any one of the above-mentioned rice brown planthopper resistance genes OsCYT2, and the biological material overexpresses the gene OsCYT2; the biological material is recombinant DNA, an expression cassette, a transposon, a recombinant overexpression vector, a viral vector or an engineered bacterium.

[0013] The third aspect of the present invention provides a method for constructing a recombinant overexpression vector for enhancing the brown planthopper resistance of rice, wherein a forward primer and a reverse primer are designed for both ends of the ORF region of any one of the above-mentioned genes OsCYT2; the nucleotide sequence of the forward primer is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.4; and a fragment of the ORF region of the gene OsCYT2 is added with A and connected to a basic vector to obtain the recombinant overexpression vector.

[0014] The fourth aspect of the present invention provides an application of any one of the above-mentioned genes OsCYT2, or the above-mentioned biological material for enhancing the brown planthopper resistance of rice, specifically: for enhancing the brown planthopper resistance of rice, or for improving rice varieties, or for cultivating transgenic rice varieties.

[0015] The fifth aspect of the present invention provides a method for enhancing rice's resistance to brown planthoppers, by promoting overexpression of the gene OsCYT2 in rice plants through genetic engineering.

[0016] Furthermore, the method for promoting overexpression of the gene OsCYT2 in rice plants is: by introducing a recombinant overexpression vector of the gene OsCYT2; or, by increasing the copy number of the gene OsCYT2 in the chromosome of the rice plant; or, by changing the promoter sequence of the gene OsCYT2 on the chromosome of the rice plant; or, by operably linking a strong promoter to the gene OsCYT2; or, by introducing an enhancer.

[0017] A sixth aspect of the present invention is a method for preparing transgenic rice with resistance to brown planthoppers, which uses the above method for enhancing rice's resistance to brown planthoppers to obtain transgenic rice with resistance to brown planthoppers.

[0018] A seventh aspect of the present invention provides a use of a transgenic rice plant obtained by the above-mentioned preparation method in rice breeding.

[0019] Compared with the prior art, the present invention is beneficial in that:

[0020] The present invention increases the expression of OsCYT2 gene in the insect-susceptible rice variety Nipponbare, and finds that the over-expressed transgenic rice material has enhanced insect resistance; it is the first time to reveal that the OsCYT2 gene enhances the resistance of rice to brown planthoppers, and can be used for the study of plant insect resistance. The present invention uses gene editing / transgenic technology to over-express the gene OsCYT2 in rice, which can reduce the survival rate of brown planthoppers that feed on the rice plant while the rice plant grows normally, reduce its weight gain, and reduce the amount of honeydew secreted.

[0021] There are many OsCYT2 gene members in plant cells, which are involved in a variety of biological functions. Therefore, the functional study of the OsCYT2 gene in the present invention has important guiding significance for studying the effects of plant cystatins on plant insect resistance and disease resistance, and also has good reference value for subsequent research on other cysteine ​​protease inhibitor members. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The results of quantitative PCR of transgenic materials show the relative expression levels of OsCYT2 gene in overexpressed transgenic materials CYT2OE-1 and CYT2OE-2. **, P < 0.01; ***, P < 0.001, ****, P < 0.0001.

[0023] Figure 2 It is the insect-resistant phenotype of transgenic rice lines CYT2OE-1 and CYT2OE-2. Figure 2 A indicates that when brown planthoppers feed on Nipponbare and cause it to wither and die, the transgenic plants still survive; Figure 2 B indicates the level of rice resistance to brown planthoppers. The smaller the value, the stronger the resistance. **, P < 0.01; ***, P < 0.001, ****, P < 0.0001.

[0024] Figure 3 The changes in survival rate, insect weight gain and honeydew amount after brown planthoppers fed on different transgenic strains in the preferred embodiment of the present invention are shown. Compared with the control Nipponbare, the survival rate ( Figure 3 A), insect weight gain ( Figure 3 B) and honeydew amount ( Figure 3 C) Significantly decreased. **, P < 0.01; ***, P < 0.001, ****, P < 0.0001. DETAILED DESCRIPTION

[0025] The technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0026] In some implementation cases of the present invention, the japonica rice variety Nipponbare is selected as the test object. The method for constructing the overexpression vector of the OsCYT2 gene includes: amplifying the OsCYT2 gene from the cDNA of Nipponbare by PCR amplification, and connecting it into the plant expression vector (basic vector) pCXUN.

[0027] The recombinant overexpression vector carrying the above-mentioned target gene can be introduced into plant cells by using conventional biotechnology methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc.

[0028] Example 1: Obtaining the Rice OsCYT2 Gene

[0029] Through the transcriptome sequencing ID, the full-length sequence of the OsCYT2 gene in the Nipponbare database was found. Primers were designed according to the ORF, and PCR amplification was performed using the Nipponbare rice cDNA as a template. The high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme) 50 µl reaction system was used for amplification. The PCR conditions were: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 58℃ annealing extension for 30 s / kb, 30 cycles. The PCR system is shown in Table 1.

[0030] Table 1

[0031]

[0032] After the PCR product was recovered, it was connected to the pMD18-T vector, and the positive clones were screened and sequenced. The sequencing results showed that the sequence of the PCR product was as shown in SEQ ID NO:2.

[0033] Example 2: Construction of OsCYT2 gene overexpression vector and Agrobacterium-mediated genetic transformation

[0034] 1. Construction of OsCYT2 gene overexpression vector

[0035] A primer was designed by cutting a section at each end of the ORF of the OsCYT2 gene. The sequence is as follows:

[0036] F(5'-3'): cccgggggatccccaatactatgcgggcatcatctctctt, as shown in SEQ ID NO.3.

[0037] R(5'-3'):aacccgctgttatccccaatactggcggtggcgtcgtcgaggggc, as shown in SEQ ID NO.4.

[0038] The vector used was pCXUN (kindly donated by Professor Wang Guoliang of Ohio State University, USA, GenBank: FJ905215.1, from a paper published in Plant Pathlology in 2009 by Songbiao Chen, Pattavipha Songkumarn, JianliLiu, and Guo-Liang Wang, titled "A Versatile ZeroBackground T-Vector System for Gene Cloning and Functional Genomics"). The pCXUN vector was cut with XcmI, and the exogenous fragment could be directly ligated after adding A.

[0039] After sequencing verification, the obtained vector is the Os01g41460 gene overexpression vector, which is electrotransformed into Agrobacterium EHA105. A single clone is picked for expansion and culture, and after PCR verification, an equal volume of 50% glycerol is added and mixed, and stored at -80°C for later use.

[0040] 2. Genetic transformation

[0041] The OsCYT2 gene overexpression vector was introduced into the japonica rice variety Nipponbare using the Agrobacterium EHA105-mediated genetic transformation method (Hiei et al., 1994, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal 6:271-282) to obtain transgenic plants. The positive plants were detected using the universal primers Hyg-L and Hyg-R for hygromycin.

[0042] RNA was extracted from the flag leaves of the T2 positive plants and converted into cDNA. The expression level was detected by quantitative PCR. Figure 1 As shown, the overexpression effects of two different transgenic rice lines (CYT2OE-1 and CYT2OE-2) were obvious.

[0043] Example 3: Phenotypic analysis of OsCYT2 gene overexpressing plants

[0044] 1. Seedling Group Method

[0045] Take the overexpressed transgenic materials (rice lines CYT2OE-1 and CYT2OE-2) and the control materials (rice line material Nipponbare), and the transgenic background rice lines are susceptible to insects; sow them in milk tea cups, 15 seeds per cup, and repeat 3 times for each rice line. When the plants grow to the three-leaf stage, start to release insects to ensure that there are 8 2-3 year old brown planthopper nymphs per rice seedling. When the mortality rate of brown planthoppers in the susceptible control is more than 90%, take pictures and read the resistance level of each plant in each cup of material. The average value is the insect resistance level of the transgenic line, such as Figure 2 As shown in A and 2B.

[0046] 2. Determination of survival rate, insect weight gain and honeydew amount

[0047] Similarly, transgenic materials CYT2OE-1, CYT2OE-2, and control material Nipponbare were sown in tea cups. Ten cups were used for each material, with one plant in each cup. When the material grew to the five-leaf stage, 20 2-3-year-old brown planthopper nymphs were inoculated into each cup. The number of brown planthoppers surviving on different materials was recorded every day, and their survival rates were calculated. The results are as follows: Figure 3 As shown in A.

[0048] Each material has 3 cups, and each cup has 6 seeds. When the rice grows to the five-leaf stage, tie a folded wax bag on the rice stem, two wax bags per plant, and put a brown planthopper in each wax bag. After feeding for 48 hours, take down the wax bag, weigh the brown planthopper and the wax bag, and calculate the difference in weight before and after feeding, which is the insect weight gain of the brown planthopper (the result is shown in Figure 3 B), and calculate the difference in wax bags, which is the amount of honeydew secreted by brown planthoppers ( Figure 3 C).

[0049] The present invention studies the transcriptome analysis of resistant and susceptible rice before and after brown planthopper feeding, and finds that the OsCYT2 gene is significantly upregulated in the insect-resistant rice after being fed by brown planthopper, but there is no obvious change in the insect-susceptible rice, suggesting that the OsCYT2 gene may play a certain role in the rice insect resistance mechanism pathway. In order to study the specific role of this gene in rice resistance to brown planthopper, the overexpression vector is transferred into the insect-susceptible rice variety Nipponbare through Agrobacterium-mediated genetic transformation. The overexpressed transgenic plants show stronger resistance to brown planthoppers than the control Nipponbare plants, which is mainly manifested in that after brown planthopper feeding, when the control Nipponbare plants wither and die, the transgenic plants still survive well, and the survival rate, insect weight gain and secreted honeydew amount after brown planthopper feeding on the transgenic plants are significantly reduced. The present invention has a good reference significance for studying gene molecular functions and breeding work.

[0050] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. A rice brown planthopper resistance gene OsCYT2, characterized in that: The gene OsCYT2 is used to encode the protein shown in SEQ ID NO.1; or, it is used to encode a protein in which one or more amino acids are replaced, deleted or added to the amino acid sequence shown in SEQ ID NO.1 and has the same function as the amino acid sequence shown in SEQ ID NO.

1.

2. The rice brown planthopper resistance gene OsCYT2 according to claim 1, characterized in that: The nucleotide sequence of the CDS of the gene OsCYT2 is shown in SEQ ID NO.2; or, the nucleotide sequence shown in SEQ ID NO.2 is replaced, deleted and / or added with one or more nucleotides and expresses a nucleotide sequence of a protein with the same function.

3. A biological material for enhancing rice's resistance to brown planthoppers, characterized in that: The biological material contains the rice brown planthopper resistance gene OsCYT2 according to claim 1 or 2, and the biological material overexpresses the gene OsCYT2; the biological material is recombinant DNA, expression cassette, transposon, recombinant overexpression vector, virus vector or engineered bacteria.

4. A method for constructing a recombinant overexpression vector for enhancing rice resistance to brown planthoppers, characterized in that: A forward primer and a reverse primer are designed for both ends of the ORF region of the gene OsCYT2 according to claim 1 or 2; the nucleotide sequence of the forward primer is shown in SEQ ID NO.3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.4; and the fragment of the ORF region of the gene OsCYT2 is added with A and connected to the basic vector to obtain the recombinant overexpression vector.

5. An application of the rice brown planthopper resistance gene OsCYT2 according to claim 1 or 2, or the biomaterial according to claim 3, characterized in that: Used to enhance rice's resistance to brown planthoppers, or for improving rice varieties, or for cultivating transgenic rice varieties.

6. A method for enhancing rice resistance to brown planthoppers, characterized in that: Genetic engineering is used to promote overexpression of the gene OsCYT2 in rice plants.

7. The method for enhancing rice resistance to brown planthoppers according to claim 6, characterized in that: The method for promoting the overexpression of the gene OsCYT2 in rice plants is: by introducing a recombinant overexpression vector of the gene OsCYT2; or, by increasing the copy number of the gene OsCYT2 in the chromosome of the rice plant; or, by changing the promoter sequence of the gene OsCYT2 on the chromosome of the rice plant; or, by operably linking a strong promoter to the gene OsCYT2; or, by introducing an enhancer.

8. A method for preparing transgenic rice with brown planthopper resistance, characterized in that: The method of claim 6 or 7 is used to obtain transgenic rice with resistance to brown planthoppers.

9. Use of the transgenic rice plant obtained by the preparation method of claim 8 in rice breeding.

Images