Genetically engineered macrophage as well as preparation method and application thereof

Abstract

The invention provides a genetically engineered macrophage as well as a preparation method and application of the genetically engineered macrophage. A gene akr1b8 in the genetically engineered macrophage is knocked out or knocked down. The antennal proportion of the genetically engineered macrophage is remarkably increased, the content of a metabolite sorbitol of a polyol pathway is remarkably reduced, and the early apoptosis of the genetically engineered macrophage is remarkably reduced; a good cytology research platform is provided for researching the influence of the polyol pathway on inflammation immunity, the metabolism and functions of the polyol pathway on the macrophages, and the influence of the macrophage polyol pathway on the molecular mechanism of the bacteria or virus infected macrophages.

Description

Technical Field

[0001] The present invention relates to the field of molecular biology and biomedical technology, and in particular to a genetically engineered macrophage, a preparation method and an application thereof. Background Art

[0002] The polyol pathway is an important branch of sugar metabolism, which includes two steps: first, under the action of aldose reductase (AR), nicotinamide adenine dinucleotide phosphate (NADPH) is used to provide energy to reduce glucose and galactose to glucitol or galactitol respectively; then, under the action of sorbitol dehydrogenase (SODH), glucitol is oxidized to fructose and a molecule of nicotinamide adenine dinucleotide (NADH) is generated. The polyol pathway is particularly important for maintaining the homeostasis of sugars and sugar alcohols in the body. When the body has an inflammatory response, the balance of this pathway will be broken (the ratio of sugars / sugar alcohols). For example, in the case of L. monocytogenes trauma infection, the sugar level in the whole body lysate of adult fruit flies has decreased significantly. The serum and urine samples of HCV patients also showed the phenomenon of metabolic disorders of the polyol pathway. In patients with advanced diabetes, there is also a phenomenon of metabolic disorders in the polyol pathway, and the accumulation of sugar alcohols is accompanied by the activation of local immune responses. However, as one of the branches of sugar metabolism, little is known about when the polyol pathway is activated and participates in immune metabolic conversion, and how it participates in the regulation of natural immunity.

[0003] AR belongs to the aldo-keto reductase superfamily (AKR) and is an important rate-limiting enzyme in the polyol pathway. AR can reduce a variety of substrates, including aldehydes, aldoses, and glucocorticoids. The AKR superfamily consists of 15 families (AKR1-15), all of which are various NADPH-dependent oxidoreductases. These proteins are widely involved in carbonyl detoxification, procarcinogen activation, lipid metabolism, cell carcinogenesis, and cancer treatment. Human AR belongs to the AKR1B subfamily and is expressed in a variety of tissues, including kidney, adrenal gland, testis, blood vessels, placenta, lens, retina, nerve, heart, brain, skeletal muscle, liver, and skin. However, its family genes not only have obvious tissue specificity, but also have intracellular localization specificity. The most studied ones in humans are AKR1B1, AKR1B10 (also called aldose reductase-like protein 1, ARL-1), and AKR1B15. In mice, there are three AKR1B homologs, namely AKR1B3, AKR1B7 and AKR1B8. Among them, mouse Akr1b8 is the homolog of human AKR1B10.

[0004] In non-pathological conditions, AR expression is silent or low. When stimulated by external factors, AR expression will be significantly increased, which is closely related to the inflammatory response process. Inhibiting the accumulation of sugar alcohols by using AR inhibitors can effectively alleviate inflammatory responses in multiple parts of the body.

[0005] However, to date there is no good in vitro immune cell model that can provide a good cellular research platform for studying the effects of the polyol pathway on inflammatory immunity.

[0006] Therefore, there is an urgent need in the art to provide an in vitro immune cell model for studying the effects of the polyol pathway on inflammatory immunity. Summary of the invention

[0007] The present invention aims to provide a genetically engineered macrophage, wherein the genetic engineering is an in vitro immune cell model for studying the influence of polyol pathway on inflammatory immunity.

[0008] In a first aspect of the present invention, a genetically engineered macrophage is provided, wherein the gene akr1b8 is knocked out or knocked down in the genetically engineered macrophage.

[0009] In another preferred embodiment, the genetically engineered macrophages have one or more of the following characteristics:

[0010] (1) Compared with macrophages without akr1b8 gene knockout, the antenna ratio of the genetically engineered macrophages is significantly increased;

[0011] (2) compared with macrophages without akr1b8 gene knockout, the content of sorbitol, a metabolite of the polyol pathway of the genetically engineered macrophages, is significantly decreased; and

[0012] (3) Compared with macrophages without akr1b8 gene knockout, the early apoptosis of the genetically engineered macrophages was significantly reduced.

[0013] In another preferred embodiment, the significant improvement described in feature (1) means that the ratio of the antennae ratio of the genetically engineered macrophages to the antennae ratio of the macrophages without gene knockout is ≥3, preferably ≥4.

[0014] In another preferred embodiment, the significant improvement described in feature (2) means that the ratio of the concentration of sorbitol, a metabolite of the polyol pathway, C1 in the genetically engineered macrophages to the concentration of sorbitol, a metabolite of the polyol pathway, C0 in the macrophages without gene knockout is 0.3-0.6.

[0015] In another preferred embodiment, the significant improvement described in feature (3) means that the ratio of early apoptosis of the genetically engineered macrophages to early apoptosis of the macrophages without gene knockout is ≤2 / 3, preferably ≤1 / 2, and more preferably ≤1 / 3.

[0016] In another preferred embodiment, the genetically engineered macrophages are resistant to early macrophage apoptosis induced by hydrogen peroxide.

[0017] In another preferred embodiment, the genetically engineered macrophages are RAW264.7 cells in which the akr1b8 gene is knocked out or knocked down.

[0018] In another preferred embodiment, the knockout is a cell line obtained by knocking out with sgRNA1 and sgRNA2.

[0019] In a second aspect of the present invention, a method for down-regulating a polyol metabolic pathway in macrophages in vitro is provided, the method comprising the steps of:

[0020] The akr1b8 gene was knocked out in macrophages in vitro to obtain macrophages with downregulated polyol metabolism pathway.

[0021] In a third aspect of the present invention, a method for improving the resistance of macrophages to early apoptosis of macrophages induced by hydrogen peroxide in vitro is provided, the method comprising:

[0022] The gene akr1b8 in macrophages is knocked out in vitro to obtain genetically engineered macrophages, wherein, compared with macrophages without gene knockout, the genetically engineered macrophages have improved resistance to early macrophage apoptosis induced by hydrogen peroxide.

[0023] In another preferred embodiment, the resistance of the genetically engineered macrophages to early apoptosis of macrophages induced by hydrogen peroxide is increased by 30%-40% compared with macrophages without gene knockout.

[0024] In a fourth aspect of the present invention, a method for preparing the genetically engineered macrophages as described in the first aspect is provided, the method comprising the steps of:

[0025] (a) providing macrophages to be edited; and

[0026] (b) performing gene editing on the macrophages to obtain the genetically engineered macrophages described in the first aspect.

[0027] In another preferred embodiment, the knockout refers to removing the first exon of the akr1b8 gene transcript in macrophages to obtain akr1b8 gene knockout macrophages.

[0028] In another preferred embodiment, the method further comprises stably passage the genetically engineered macrophages to obtain a stable genetically engineered macrophage cell line.

[0029] In the fifth aspect of the present invention, there is provided a use of the genetically engineered macrophages as described in the first aspect, for studying the effects of the polyol pathway on inflammatory immunity, the effects of the polyol pathway on macrophage metabolism and function, and the molecular mechanism by which the macrophage polyol pathway affects bacteria or viruses infecting macrophages.

[0030] In the sixth aspect of the present invention, there is provided a use of the genetically engineered macrophages as described in the first aspect for constructing an in vitro immune cell model.

[0031] In a seventh aspect of the present invention, a reagent combination for preparing the genetically engineered macrophages described in the first aspect is provided, the reagent combination comprising:

[0032] (a) a gene editing protein or an expression vector thereof, wherein the gene editing protein is selected from the group consisting of CasRx, Cpf1, Cas9, Cas13a, Cas13b, Cas13c, or a combination thereof; and

[0033] (b) gRNA or its expression vector, wherein the gRNA is an RNA that guides the gene editing protein to specifically bind to the akr1b8 gene, wherein the targeting site sequence of the gRNA is sgRNA1 and sgRNA2, the targeting nucleic acid sequence of the sgRNA1 is shown in SEQ ID No: ID NO: 1, and the targeting nucleic acid sequence of the sgRNA2 is shown in SEQ ID No: ID NO: 2.

[0034] In another preferred example, the SEQ ID No: 1 is: GAGCTTCTTGACTTGGTTTG.

[0035] In another preferred example, the SEQ ID No: 2 is: GAGGCATACGCGCAGTCGATATGG.

[0036] In another preferred example, the sgRNA guides the gene editing protein to specifically bind to the nucleotide sequence of the akr1b8 gene.

[0037] In another preferred embodiment, the expression vector in step (a) is selected from: pX330.

[0038] In another preferred embodiment, the dosage form of the agent is selected from the following group: a lyophilized preparation, a liquid preparation, or a combination thereof.

[0039] In another preferred embodiment, the dosage form of the agent is a liquid preparation.

[0040] In another preferred embodiment, the dosage form of the agent is an injection form.

[0041] In the eighth aspect of the present invention, a genetically engineered macrophage is provided. The genetically engineered macrophage is obtained by treating the macrophage with the reagent described in the seventh aspect, and the akr1b8 gene in the genetically engineered macrophage is knocked out.

[0042] In another preferred embodiment, the cells are selected from cells of humans and / or non-human mammals.

[0043] In another preferred embodiment, the cells are selected from rodents, such as mice, and / or rats.

[0044] In another preferred embodiment, the cells include the cells described in any one of the first aspect to the sixth aspect and / or cells treated with the reagent.

[0045] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 Displays RAW264.7 akr1b8 KO Construction of stable cell lines, Figure 1 A: RAW264.7 before and after LPS stimulation akr1b8 KO Akr1b8 protein levels in cell lines; Figure 1 B: RAW264.7 after 24h of LPS treatment akr1b8KO The proportion of antennae appearing in stable cell lines and controls; Figure 1 C is RAW264.7 after 24h of LPS treatment akr1b8 KO Stable cell line production of polyol metabolite sorbitol.

[0047] Figure 2 RAW 264.7 is displayed akr1b8 KO The ratio of early Apoptosis to Apoptosis under 400UmH2O2 treatment.

[0048] Figure 3 The sgRNA insertion site and pX330 plasmid map are shown. Figure 3 A is the sgRNA insertion site map, and the pX330 plasmid map is as follows Figure 3B. DETAILED DESCRIPTION

[0049] After extensive and in-depth research and a large number of screenings, the inventors unexpectedly discovered for the first time a genetically engineered macrophage, in which the antenna ratio of the genetically engineered macrophage was significantly increased, the content of the metabolite sorbitol of the polyol pathway was significantly decreased, and the early apoptosis of the genetically engineered macrophage was significantly decreased. The genetically engineered macrophage provided by the present invention provides a good cytological research platform for studying the effects of the polyol pathway on inflammatory immunity, the effects of the polyol pathway on macrophage metabolism and function, and the molecular mechanism of the effects of the macrophage polyol pathway on bacteria or virus infection of macrophages. The present invention was completed on this basis.

[0050] Terminology

[0051] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0052] As used herein, when used in reference to a specific recited numerical value, the term "about" means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0053] As used herein, the term "comprising" or "including" may be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0054] AKR gene and protein

[0055] As described in this article, "AKR gene" refers to the rate-limiting enzyme in the polyol pathway. The AKR superfamily consists of 15 families (AKR1-15), all of which are various NADPH-dependent oxidoreductases. The most studied in humans are AKR1B1, AKR1B10 (also called aldose reductase-like protein 1, ARL-1), and AKR1B15. In mice, there are three AKR1B homologs, namely AKR1B3, AKR1B7, and AKR1B8. Among them, mouse Akr1b8 is a homolog of human AKR1B10.

[0056] In the present invention, "akr1b8 KO" means that the first exon of the akr1b8 gene transcript in the genome is removed from the endogenous akr1b8 gene by about 200 bp in RAW264.7 cells, thereby achieving a gene knockout effect.

[0057] Gene inactivation

[0058] There are many methods that can be used to study genes with unknown functions, such as inactivating the gene to be studied, analyzing the phenotypic changes of the resulting genetic modification, and then obtaining functional information of the gene. Another advantage of this research method is that it can associate gene function with disease, so that while obtaining gene function, it can also obtain disease information and disease animal models that can be treated by the gene as a potential drug or drug target. The method of gene inactivation can be accomplished by gene knockout, gene interruption or gene insertion. Among them, gene knockout technology is a very powerful means to study the function of human genes as a whole.

[0059] As used herein, the terms "gene inactivation" and "gene knockout" are used interchangeably and refer to a genetic operation such as interruption or knockout of a target gene, thereby significantly reducing or even completely losing the expression and / or activity of the target gene.

[0060] Gene Editor

[0061] In the present invention, the gene editor includes a DNA gene editor and an RNA gene editor. In a preferred embodiment, the gene editor of the present invention includes a gene editing protein and an optional gRNA.

[0062] Gene editing proteins

[0063] In the present invention, the nucleotides of the gene editing protein can be obtained by genetic engineering techniques, such as genome sequencing, polymerase chain reaction (PCR), etc., and its amino acid sequence can be derived from the nucleotide sequence. In a preferred embodiment of the present invention, the gene editing protein includes, but is not limited to, Cas 13 (such as CasRx), Cpf1, SaCas9, Cas 13a, Cas13b, and Cas13c.

[0064] CRISPR / Cas system

[0065] The CRISPR / Cas system (Clustered regularly interspaced short palindromicrepeats / CRISPR-associated protein) is an acquired immune defense mechanism in prokaryotes to resist the invasion of foreign genes. It has evolved from bacteria and archaea in the process of resisting the invasion of foreign viruses and bacteriophages. The system can integrate DNA fragments that invade the host into the CRISPR site, and then guide the Cas endonuclease to cut the foreign DNA sequence through the corresponding CRISPR RNAs (crRNAs), thereby resisting the invasion of viruses or bacteriophages. The CRISPR / Cas gene cluster consists of a series of Cas protein (Cas 1, Cas2, Cas4 and effector proteins such as Cas9, Cpf1, etc.) coding genes and a CRISPR sequence. The CRISPR sequence consists of a leader sequence, many short and conservative repeat sequence regions (repeat) and a spacer region (spacer). The repeat sequence region contains a palindromic sequence that can form a hairpin structure. The spacer is the foreign DNA sequence captured by the host. These captured exogenous DNA sequences are equivalent to the "blacklist" of the immune system. When these exogenous genetic materials invade the host again, the bacteria begin to transcribe CRISPR to form the primary transcription product pre-crRNA, which is then cut by ribonucleases or Cas proteins within the repetitive sequence site to form mature crRNA, which forms a ribonucleoprotein complex with specific CRISPR effector proteins to recognize and cut exogenous DNA that can complementarily pair with crRNA, causing double-strand breaks and triggering host

[0066] Cellular self-repair.

[0067] According to the composition of the Cas gene and the number of effector proteins, CRISPR is divided into 2 categories and 5 types, with a total of 16 subtypes. Category 1 is a CRISPR / Cas system that uses multiple effector protein complexes to interfere with target genes, including types I, III and IV; Category 2 is a CRISPR / Cas system that uses a single effector protein to interfere with target genes, including types II and V. Currently, the most widely studied and used is type II, namely the CRISPR / Cas9 system. This system successfully achieved gene editing in mammalian cells in 2013. The type II system can use a single Cas9 nuclease to accurately and fully cut the DNA target site through the guidance of crRNA. The system is simple to operate, has a short experimental cycle, high efficiency, and is widely applicable to multiple species. The system requires the design of a special guide RNA, namely sgRNA (single guide RNA). The sequence design of sgRNA is a 20nt nucleotide sequence in the PAM (NGG) region of the genome sequence. Under the guidance of sgRNA, Cas9 protein can achieve site-specific cutting of the genome, causing double-strand breaks in DNA and activating the cell's non-homologous end joining (NHEJ) or homologous recombination (HR) repair mechanisms, thereby achieving gene knockout, random fragment deletion or insertion, or using specific template repair to achieve permanent modification of the genome.

[0068] In one embodiment of the present invention, an sgRNA for knocking out the akr1b8 gene in the RAW264.7 stable cell line is constructed based on the CRISPR / Cas9 gene knockout technology, including sgRNA1 and sgRNA2, wherein the sgRNA1 targeting site nucleic acid sequence is shown in SEQ ID NO: 1, and the sgRNA2 targeting site nucleic acid sequence is shown in SEQ ID NO: 2.

[0069] Genetically engineered macrophages

[0070] In the genetically engineered macrophages of the present invention, the gene akr1b8 is knocked out or knocked down.

[0071] In the present invention, compared with macrophages without akr1b8 gene knockout, the antenna ratio of the genetically engineered macrophages is significantly increased.

[0072] Preferably, the ratio of the antennae ratio of the genetically engineered macrophages to the antennae ratio of the macrophages without gene knockout is ≥3, preferably ≥4.

[0073] In the present invention, compared with macrophages without akr1b8 gene knockout, the content of sorbitol, a metabolite of the polyol pathway in the genetically engineered macrophages, is significantly decreased.

[0074] Preferably, the ratio of the concentration of sorbitol, a metabolite of the polyol pathway, C1 in the genetically engineered macrophages to the concentration of sorbitol, a metabolite of the polyol pathway, C0 in the macrophages without gene knockout is 0.3-0.6.

[0075] In the present invention, compared with macrophages without akr1b8 gene knockout, the early apoptosis of the genetically engineered macrophages is significantly reduced.

[0076] Preferably, the ratio of early apoptosis of the genetically engineered macrophages to early apoptosis of the macrophages without gene knockout is ≤2 / 3, preferably ≤1 / 2, and more preferably ≤1 / 3.

[0077] The genetically engineered macrophages of the present invention are stably passaged to obtain a stable genetically engineered macrophage cell line.

[0078] RAW264.7 of the present invention akr1b8 KO Stable cell lines are genetically engineered macrophage cell lines.

[0079] Method for preparing genetically engineered macrophages

[0080] The method for preparing genetically engineered macrophages of the present invention comprises:

[0081] (a) providing macrophages to be edited; and

[0082] (b) performing gene editing on the macrophages to obtain the genetically engineered macrophages described in the first aspect.

[0083] Preferably, the knockout refers to the removal of the first exon of the akr1b8 gene transcript in macrophages to obtain akr1b8 gene knockout macrophages.

[0084] The present invention also includes stably passage the genetically engineered macrophages to obtain a stable genetically engineered macrophage cell line.

[0085] In one embodiment of the present invention, the method comprises:

[0086] 1. Determine the specific target site sgRNA1 and sgRNA2 of the akr1b8 gene to be knocked out in RAW264.7, and transcribe them into mRNA in vitro with Cas9 nuclease;

[0087] 2. Transfect active sgRNA and Cas9 mRNA into RAW264.7 cells via liposomes to obtain RAW264.7 akr1b8 KO Stable cell line; the sgRNA1 is shown as SEQ ID NO: 1, and the sgRNA2 is shown as SEQ ID NO: 2.

[0088] SEQ ID NO:1:GAGCTTTCTTTGACTTGGTTTG

[0089] SEQ ID NO:2:GAGGCATACGCGCAGTCGATATGG

[0090] Application of genetically engineered macrophages

[0091] The genetically engineered macrophages of the present invention can be used to study the effects of the polyol pathway on inflammatory immunity, the effects of the polyol pathway on macrophage metabolism and function, and the molecular mechanism by which the macrophage polyol pathway affects bacteria or viruses infecting macrophages.

[0092] The genetically engineered macrophages of the present invention can be used to construct an in vitro immune cell model.

[0093] Compared with the prior art, the present invention has the following beneficial effects:

[0094] 1. The present invention provides a genetically engineered macrophage, which has the same pathological manifestations as the silent or low expression of AR in the polyol pathway, and provides a good cytological research platform for studying the effects of the polyol pathway on inflammatory immunity.

[0095] 2. Glucose metabolism is not only closely related to macrophage-mediated inflammatory response, but also to cell autophagy or phagocytosis. The genetically engineered macrophages provided by the present invention can be used to study the effects of polyol pathways on macrophage metabolism and function.

[0096] 3. The genetically engineered macrophages provided by the present invention provide the possibility for studying aspects such as the molecular mechanism of macrophage polyol pathway affecting bacteria or viruses infecting macrophages: first, when responding to bacterial infection, it is possible to study which key molecules and signaling pathways are affected by macrophages through the polyol pathway; secondly, it can closely link and integrate inflammatory response, cell apoptosis to clear bacteria and glucose metabolism, thereby studying the molecular mechanism of host resistance to bacterial infection.

[0097] 4. The present invention provides a modeling scheme. On the one hand, the model yield is high, the quality of the entire somatic cell line is good, and it has the advantages of high knockout rate and no introduction of exogenous gene fragments. On the other hand, the pathological manifestations of genetically engineered macrophages are more similar to the silent or low expression of AR in the human polyol pathway.

[0098] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually based on conventional conditions or the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight.

[0099] Example 1 Construction of genetically engineered macrophage cell line

[0100] 1. Materials and Methods

[0101] 1.1 Cell culture

[0102] Raw 264.7 cell line was purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai). Raw264.7 cells were cultured in a 5% CO2, 37°C incubator using DMEM medium containing 10% FBS and 1% double antibody.

[0103] 1.2 Reagents

[0104] EZ Cell Transfection Reagent and EZ Trans cell transfection reagent (high efficiency) were purchased from Li Ji Biological Company, DMEM, G418 and mammalian DNA kit were purchased from Sigma, opti-MEM and FBS were purchased from Gibico, Sorbitol kit was purchased from BioAssay Systems, and Akr1b8 primary antibody was purchased from Biorbyt.

[0105] 1.3 RAW264.7 was constructed using crisp-cas9 technology akr1b8 KO Stable cell lines

[0106] 1.3.1 Design of sgRNA sequences

[0107] This experiment uses the relatively simple SYNTHEGO (https: / / design.synthego.com / # / ) for design. This experiment requires knocking out the Akr1b8 gene in the RAW264.7 cell line, so it is necessary to edit the exons of the Akr1b8 gene. According to the prompts on the page, select gene editing using nuclease, select the species, enter the official gene name (query on NCBI), and you can search in the database. Select 2-3 pairs of sgRNA sequences with high scores from the retrieved reference sequences, try to select non-shared sequences with Akr1b3 and akr1b10 genes, and record the position of each pair of sequences in the genome.

[0108] The CRISPR-Cas9 vector used in the laboratory is pX330-U6-Chimeric_BB-CBh-hSpCas9 (Plasmid#42230 in Addgene). According to Zhang's protocol, the base CACC needs to be added to the 5' end of the forward sequence, and the base AAAC needs to be added to the 5' end of the reverse sequence. In addition, the forward sequence 5'-AAAC needs to be followed by G, so if the first base of the sgRNA forward sequence is not G, the base to be added to the 5' end is AAACG; the corresponding reverse sequence adds the base CACC to the 5' end and the base C to the 3' end.

[0109] Schematic diagram of SgRNA insertion site Figure 3 A shows the pX330 plasmid map. Figure 3 As shown in B (from Addgene)

[0110] Table 1: sg sequences

[0111] Primers sequence SEQ ID NO m-akr1b8-sg1-F CACCGAGCTTCTTTGACTTGGTTTG 3 m-akr1b8-sg1-R AAACCAAACCAAGTCAAAGAAGCTC 4 m-akr1b8-sg2-F CACCGAGGCATACGCGCAGTCGATATGG 5 m-akr1b8-sg2-R AAACCCATATCGACTGCGCGTATGCCTC 6

[0112] 1.3.2 Construction of CRISPR-Cas9 plasmid vector

[0113] 1.3.2.1 Enzyme digestion of pX330

[0114] Add 2.5 μl of pX330 solution to 50 μl of competent E. coli DH5α melted in an ice bath, gently mix, and place on ice for 30 minutes. Place in a 42°C water bath for 60 seconds, and quickly place back on ice for 2 minutes. Add 1 ml of LB medium (no resistance), and resuscitate at 37°C, 200 rpm for 45 minutes. Centrifuge at 12000×g for 1 minute, retain about 50 μl of supernatant to resuspend the cells, and evenly spread on an LB plate (Amp+). Invert and culture at 37°C for 12-16 hours.

[0115] Pick 2-5 positive clones, culture them in 1ml LB medium at 37℃ for 3-6h, and sequence some of the bacterial solution. After sequencing and identification, if the plasmid sequence is correct, the corresponding positive clones can be expanded and cultured in 10-20ml LB medium at 37℃, 200rpm overnight (12-16h), and some of the bacterial solution can be frozen. Extract plasmid The concentration was measured and stored at -20°C.

[0116] Perform enzyme digestion according to the following system in a 37°C water bath for 2 h.

[0117]

[0118] After enzyme digestion, electrophoresis was performed on 1% agarose gel (adding nucleic acid dye YeaRed) at 150V for 25 min. The target band was quickly cut out under ultraviolet light, recovered by gel recovery using a kit, and stored at -20°C.

[0119] 1.3.2.2 Annealing of sgRNA

[0120] Annealing of sgRNA was performed according to the following system: 95°C for 5 min in a PCR instrument, then the temperature was gradually decreased to 25°C in intervals of 20°C, each gradient temperature was maintained for 5 min, and the sample was temporarily stored at 4°C for later use.

[0121]

[0122] 1.3.2.3 Ligation of pX330 and sgRNA

[0123] Perform enzyme ligation according to the following system and incubate at 16°C overnight.

[0124]

[0125] The enzyme-linked products were transformed and plated for screening.

[0126] Pick 2-5 positive clones, culture them in 1ml LB medium at 37℃ for 3-6h, and sequence some of the bacterial solution. After sequencing and confirming that the sgRNA is correctly inserted into the pX330 vector, the corresponding positive clones can be expanded and cultured in 10-20ml LB medium at 37℃, 200rpm overnight (12-16h). Take 1ml of bacterial solution, add 500μl 45% glycerol, and freeze at -20℃.

[0127] Extraction of plasmid The concentration was measured and stored at -20°C.

[0128] 1.3.3 Cell transfection and single clone selection

[0129] 1.3.3.1 Recovery and culture of RAW264.7 cell line

[0130] Add 4 ml of cell culture medium (DMEM with 10% FBS) to a 15 ml centrifuge tube and preheat in a 37°C water bath. Add 10 ml of DMEM culture medium to a 10 cm culture dish and preheat in a 37°C incubator. Remove the cells from liquid nitrogen and quickly place the entire tube of cells in a 37°C water bath. Shake or invert the cells by hand. Once all the cells have thawed, immediately transfer them to the preheated 4 ml culture medium (in a 15 ml tube). Centrifuge at 400-500 × g for 3 minutes and remove the supernatant. Take 5-6 ml of preheated culture medium (in a 10 cm culture dish) to a centrifuge tube to resuspend the cells, and then transfer all to the culture dish. The cell recovery can be observed under a microscope and cultured at 37°C and 5% CO2 for 2-3 days.

[0131] 1.3.3.2 Liposome transfection

[0132] method:

[0133] 1-2 days in advance, plate cells in a 6-well plate. The cell plating density is about 70-90%. According to the reagent instructions, add plasmid, liposome and transfection buffer in a 1.5EP tube, shake thoroughly for about 10 seconds, let stand for 10 minutes, and then add to the 6-well plate. Transfect 500ng of plasmid per well. After thorough mixing, place at 37℃, 5% CO2 for 1-2 days. Add drugs for screening and culture for 1-2 days. The specific process is as follows:

[0134] I. Prepare transfection complexes

[0135] (1) For each well of cells, dilute 1 μg of pX330-sgRNA plasmid DNA into 40 μL of serum-free high-glucose DMEM medium (or OPTI-MEMⅠ medium) and mix well.

[0136] (2) For each well of cells, dilute 3 μL of EZ Trans transfection reagent into 40 μL of serum-free high-glucose DMEM medium (or OPTI-MEMⅠ medium) and mix gently.

[0137] (3) Add all the diluted EZ Trans transfection reagent to the diluted plasmid DNA as quickly as possible and mix gently.

[0138] (4) Incubate at room temperature for 10-15 min to allow the EZ Trans-DNA complex to form.

[0139] II. Transfected cells

[0140] (1) Evenly drop 80 μL of the above EZ Trans-DNA transfection complex into the culture dish containing cells. Gently shake the culture dish or oscillate slightly to disperse the EZ Trans-DNA complex evenly. (2) Incubate in a 37°C, 5% CO2 incubator for 6-18 hours, remove the culture medium containing the EZ Trans-DNA complex, replace it with new culture medium, and continue culturing until the expression of the transferred gene is analyzed.

[0141] 1.3.3 Selection of cell clones

[0142] After the cells have been screened by drugs, the culture medium is removed and PBS is added to wash twice, about 5 ml each time. Add an appropriate amount of trypsin to digest for about 30 seconds, and remove the trypsin. Add 5 ml of DMEM culture medium to suspend the cells in a 15 ml centrifuge tube, centrifuge at 500×g for 5 minutes, and discard the supernatant. Add 5 ml of DMEM culture medium to resuspend the cells and determine the cell concentration. Use the single cell sorting mode of the sorting flow cytometer to culture single cells in a 96-well plate. After 2-3 weeks, transfer the monoclonal clones with better growth status from the 96-well plate to the 24-well plate and culture them at 37°C and 5% CO2 for 3-4 days. Afterwards, transfer the monoclonal clones to a 6-well plate and continue to culture at 37°C and 5% CO2. When the cell plating density is about 70%-90%, it can be identified and frozen.

[0143] 1.4 Screening of gene knockout cell lines

[0144] 1.4.1 Sequencing identification

[0145] Search the full sequence of the gene in NCBI. According to the location of the genome targeted by the sgRNA, query the sequence of 300 bp before and after the target site, a total of 600 bp. Use primer-BLAST in NCBI to design primers within 100 bp at the beginning and end of the sequence.

[0146] Extract cell genomic DNA, set up the PCR system according to the table below, and set the program to amplify the target sequence. Submit the PCR product to a biological company for sequencing, and the sequencing primers are the primers designed previously.

[0147]

[0148] PCR procedure:

[0149]

[0150] 1.4.2 Protein level detection

[0151] Plate cells in a 6-well plate and culture at 37°C, 5% CO2 for 1-2 days. Place on ice, discard the culture medium, and wash twice with pre-cooled 1×PBS, about 3 ml each time. Discard PBS, add 200 μl of cell lysis buffer (add protease inhibitors before use) to each well, and lyse on ice for 30 minutes. Use a pipette to fully suspend the cells and fragments, centrifuge at 4°C, 10,000×g for 10 minutes, and aspirate the supernatant. Quantify total protein using a BAC kit.

[0152] Dilute the total protein solution according to the quantitative results, take a certain amount of protein dilution and add it to loading buffer, cook the sample at 100℃ for 5min, perform SDS-PAGE electrophoresis (12% separation gel), 150V, 30-40min, transfer to membrane at 150V, 60min.

[0153] Block with 5% milk powder-TBST for 1 hour, wash the membrane three times with 1×TBST, 5 minutes each time. Incubate with primary antibody at 4℃ overnight, wash the membrane three times with 1×TBST, 5 minutes each time. Prepare secondary antibody with 5% milk powder-TBST, incubate with secondary antibody at room temperature for 1 hour, wash the membrane three times with 1×TBST, 5 minutes each time. Take out the membrane, add developer and put it into the instrument for development.

[0154] result

[0155] 1.5 Effects of the polyol pathway on macrophage function

[0156] This application uses crisp-cs9 technology to build RAW264.7 akr1b8 KO Stable cell lines ( Figure 1 A) and observed the effects of the polyol pathway on macrophage function.

[0157] Under the microscope, genetically engineered macrophages RAW264.7 akr1b8 KO The stable cell line has a more rounded cell morphology and less spindle-shaped cells. akr1b8 KO Stable cell line. The experimental results showed that after LPS treatment for 12h, RAW264.7 akr1b8 KO The proportion of stable cell lines with antennae was significantly higher than that of the control group ( Figure 1 B). RAW264.7 akr1b8 KO The content of sorbitol, a polyol metabolite, decreased significantly both in the cells and in the culture medium of the stable cell lines.

[0158] Effects of polyol pathway on macrophage function Figure 2 The experimental results show that compared with the control group, RAW264.7 akr1b8 KO Under the treatment of 400μMH2O2, the ratio of early apoptosis to apoptosis was significantly downregulated.

[0159] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A genetically engineered macrophage, characterized in that: In the genetically engineered macrophages, the akr1b8 gene is knocked out or knocked down.

2. The genetically engineered macrophage according to claim 1, characterized in that: The genetically engineered macrophages have one or more of the following characteristics: (1) Compared with macrophages without akr1b8 gene knockout, the antenna ratio of the genetically engineered macrophages is significantly increased; (2) compared with macrophages without akr1b8 gene knockout, the content of sorbitol, a metabolite of the polyol pathway in the genetically engineered macrophages, was significantly decreased; and (3) Compared with macrophages without akr1b8 gene knockout, the early apoptosis of the genetically engineered macrophages was significantly reduced.

3. The genetically engineered macrophage according to claim 1, characterized in that: The genetically engineered macrophages are resistant to early macrophage apoptosis induced by hydrogen peroxide.

4. The genetically engineered macrophage according to claim 1, characterized in that: The genetically engineered macrophages are RAW264.7 cells in which the akr1b8 gene is knocked out or knocked down.

5. A method for downregulating a polyol metabolic pathway in macrophages in vitro, characterized in that: The method comprises the steps of: The akr1b8 gene was knocked out in macrophages in vitro to obtain macrophages with downregulated polyol metabolism pathway.

6. A method for increasing the resistance of macrophages to early apoptosis of macrophages induced by hydrogen peroxide in vitro, characterized in that: The method comprises: In vitro, the akr1b8 gene in macrophages is knocked out to obtain genetically engineered macrophages, wherein the genetically engineered macrophages have improved resistance to early macrophage apoptosis induced by hydrogen peroxide compared with macrophages without gene knockout.

7. A method for preparing the genetically engineered macrophages according to claim 1, characterized in that: The method comprises the steps of: (a) providing macrophages to be edited; and (b) performing gene editing on the macrophages to obtain the genetically engineered macrophages according to claim 1.

8. The method according to claim 7, characterized in that The method further comprises stably passaging the genetically engineered macrophages to obtain a stable genetically engineered macrophage cell line.

9. A use of the genetically engineered macrophages as claimed in claim 1, characterized in that it is used to: study the effects of the polyol pathway on inflammatory immunity, the effects of the polyol pathway on macrophage metabolism and function, and study the molecular mechanism by which the macrophage polyol pathway affects bacteria or viruses infecting macrophages.

10. A use of the genetically engineered macrophage according to claim 1, characterized in that: Used to construct in vitro immune cell models.

Images