Protein proximity labeling method activated by near-infrared light

Abstract

The invention discloses a near-infrared light activated protein proximity labeling method. The method comprises the following steps: stably expressing dL5 protein plasmids in MCF-7 cells; the method comprises the following steps: co-incubating MCF-7 cells, an MG2I substrate and m-aminophenylacetylene, and applying illumination with the wave band of 660 nm to the cells; the dL5 protein plasmids are dL5 protein plasmids positioned in cell nucleuses or dL5 protein plasmids positioned in mitochondria. The problems of poor biocompatibility, long marking time and too high marking background in the current proximity marking technology can be effectively solved through the proximity marking technology mediated by the fluorescence activated protein dL5 and the substrate MG2I specifically combined with the fluorescence activated protein dL5.

Description

Technical Field

[0001] The invention belongs to the field of biomedical technology, and in particular relates to a protein proximity labeling method activated by near-infrared light. Background Art

[0002] Proximity labeling techniques label biomolecules (usually proteins or RNA) that are in close proximity to a protein of interest. By creating a genetic fusion between the protein of interest and an engineered labeling enzyme in living cells, the biomolecule is brought into spatial proximity to the protein. The substance of interest can then be selectively labeled with biotin for pull-down and analysis. Proximity labeling has been used to identify components of novel cellular structures and to determine protein-protein interactions.

[0003] Among the existing proximity labeling technologies, APEX proximity labeling technology requires cells to be co-incubated with hydrogen peroxide. The toxicity of hydrogen peroxide will lead to poor biocompatibility of this technology. Due to its inefficient enzyme catalytic activity, BioID proximity labeling technology takes a long time to obtain effective labeling signals, making it difficult to effectively label transient protein interactions. RinID proximity labeling technology is also a reactive oxygen mediated proximity labeling technology, but the illumination wavelength required for its photosensitive protein miniSOG is in the 400nm band, which leads to its poor biocompatibility and high labeling signal background. Summary of the invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies in the prior art and provide a method for protein proximity labeling activated by near-infrared light.

[0005] In order to solve the above technical problems, the present invention provides a method for near-infrared light-activated protein proximity labeling, the method comprising the following steps:

[0006] (1) Stably express dL5 protein plasmid in MCF-7 cells;

[0007] (2) co-incubating the MCF-7 cells with the MG2I substrate and m-aminophenylacetylene, and applying light at a wavelength of 660 nm to the cells;

[0008] The dL5 protein plasmid is a dL5 protein plasmid localized in the cell nucleus or a dL5 protein plasmid localized in the mitochondria. The DNA sequence of the dL5 protein plasmid localized in the cell nucleus is shown in SEQ ID NO.1, and the DNA sequence of the dL5 protein plasmid localized in the mitochondria is shown in SEQ ID NO.2;

[0009] The MG2I substrate has the following structural formula I;

[0010]

[0011] In the above method, further, the MG2I substrate is prepared by a method comprising the following steps:

[0012] S1, dissolving 3,5-diiodo-4-hydroxybenzaldehyde, ethyl 4-bromobutyrate and potassium carbonate in an organic solution, and heating to react to obtain compound A;

[0013] S2, dissolving the compound A, N,N-dimethylaniline and zinc chloride in anhydrous ethanol, and heating to react to obtain compound B;

[0014] S3, dissolving the compound B and chlorobenzoquinone in acetonitrile, and heating the mixture to obtain MG2I;

[0015] The compound A has the following structural formula II:

[0016]

[0017] The compound B has the following structural formula II:

[0018]

[0019] The above method, further, the molar concentration ratio of 3,5-diiodo-4-hydroxybenzaldehyde, ethyl 4-bromobutyrate, and potassium carbonate in S1 is: 1:1.2:1;

[0020] And / or, the organic solution is DMF;

[0021] And / or, the stirring reaction specifically comprises: stirring the reaction at 90° C. for 3 to 6 hours.

[0022] The above method, further, the molar concentration ratio of the compound A, N,N-dimethylaniline, and zinc chloride in S2 is: 1:2:1;

[0023] And / or, the stirring reaction is specifically: reacting at 80° C. for 24 to 48 hours.

[0024] In the above method, further, the molar concentration ratio of compound B and chloranil in S3 is: 1:1;

[0025] And / or, the stirring reaction is specifically: reacting at 80° C. for 3 to 6 hours.

[0026] In the above method, further, the step (1) is as follows: mixing the dL5 protein plasmid with PAX, PMD and p3000 to obtain a lentivirus; and infecting MCF-7 cells with the lentivirus.

[0027] In the above method, further, said (2) is specifically: incubating 500nmol / L MG2I and 1mmol / L m-aminophenylacetylene with MCF-7 cells for one hour; and irradiating the MCF-7 cells with light at 660nm for 20 minutes.

[0028] Compared with the prior art, the advantages of the present invention are:

[0029] (1) Provided is a proximity labeling method activated by near-infrared light: FAP-TAP, which consists of a fluorescent activated protein dL5 and a substrate MG2I that specifically binds thereto. FAP-TAP-mediated proximity labeling technology can effectively solve the problems of poor biocompatibility, long labeling time, and excessive labeling background in current proximity labeling technology. Under irradiation with 660nm near-infrared light, singlet oxygen can be generated quickly and efficiently. The singlet oxygen generated can oxidize the histidine residues of neighboring proteins, which enables some amine protein labeling probes to covalently react with the oxidized histidine residues to achieve proximity protein labeling. In summary, FAP-TAP-mediated proximity labeling technology can effectively solve the problems of poor biocompatibility, long labeling time, and excessive labeling background in current proximity labeling technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to make the purpose, technical solution and advantages of the embodiments of the present invention more clear, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention.

[0031] Figure 1 This is a diagram of the plasmid structure used to express nucleus-localized dL5 in Example 1 of the present invention.

[0032] Figure 2 This is a diagram of the plasmid structure used to express mitochondrial localization dL5 in Example 2 of the present invention.

[0033] Figure 3 The synthetic route of the fluorescence activated protein substrate MG2I in Example 3 of the present invention.

[0034] Figure 4 These are the results of the in vitro labeling verification test of BSA by the various components of FAP-TAP in Experiment 1 of the present invention.

[0035] Figure 5 This is the result of the change of the in vitro labeling effect of FAP-TAP on BSA with the illumination time in Experiment 2 of the present invention.

[0036] Figure 6The results of the variation of the proximity labeling effect of FAP-TAP on the target protein in living cells with the illumination time in Experiment 3 of the present invention; A in the figure is the Rhodamine graph; and B in the figure is the Coomassie Blue Staining graph.

[0037] Figure 7 The results of the proximity labeling effect of FAP-TAP on the target protein in living cells in Experiment 4 of the present invention vary with the concentration of m-aminophenylacetylene; A in the figure is the Rhodamine graph; and B in the figure is the Coomassie Blue Staining graph.

[0038] Figure 8 The results of the variation of the proximity labeling effect of FAP-TAP on the target protein in living cells with the concentration of MG2I in Experiment 5 of the present invention; A in the figure is the Rhodamine graph; and B in the figure is the Coomassie Blue Staining graph.

[0039] Fig. 9 The immunofluorescence imaging results of the proximity labeling effect of FAP-TAP on the target protein in living cells in Experiment 6 of the present invention; A in the figure is the immunofluorescence imaging result of MCF-7 cells stably expressing mito-dL5. B in the figure is the immunofluorescence imaging result of MCF-7 cells stably expressing H2B-dL5. DETAILED DESCRIPTION

[0040] The present invention is further described below in conjunction with specific preferred embodiments, but the protection scope of the present invention is not limited thereby.

[0041] The materials, reagents, and instruments used in the following examples can all be purchased from commercial channels. The experimental methods in the following examples, unless otherwise specified, are conventional methods in the art. The ultracentrifuge was purchased from ThermoFisher Scientific; the flow cytometer was purchased from BD; and the ultra-high resolution confocal microscope was purchased from ZEISS.

[0042] All plasmids used in this article were synthesized by Anhui General Biotechnology Co., Ltd. Bovine serum albumin (BSA) was purchased from Solarbio. Dulbecco's Modified Eagle Medium (DMEM) and 1*Phosphate Buffered Saline (PBS) were purchased from Servicebio. Fetal bovine serum (FBS) was purchased from Biological Industries. Trypsin was purchased from Gbico. Penicillin-streptomycin was purchased from Wuhan Punosai Life Science Technology Co., Ltd. BCA protein quantification kit was purchased from Beijing Dingguo Changsheng Biotechnology Co., Ltd. Horseradish peroxidase-labeled streptavidin was purchased from Beijing Solarbio Technology Co., Ltd. Lipofectamine TM 3000 transfection reagent, Ponceau red dye was purchased from Bio-Technology, Opti-MEM TM Reduced serum medium was purchased from Thermo Fisher Scientific. Other chemical reagents were purchased from Anaiji Chemical Co., Ltd.

[0043] MCF-7 cells were purchased from the National Collection of Authenticated cell cultures with STR analysis (Shanghai, China). 293T cells were purchased from Procell Life Science & Technology Co., Ltd (Wuhan, China).

[0044] Example 1

[0045] A plasmid for expressing nuclear localized dL5, Figure 1 It is a plasmid structure diagram, and its DNA sequence is shown in SEQ ID NO.1, specifically:

[0046] GGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGCAGGCCGTCGTTACCCAAGAACCTAGTGTTACCGTTAGCCCAGGTGGTACTGTTATACTTACTTGTGGAAGTGGTACGGGTGCCGTCACATCTGGTCATTATGCAAATTGGTTTCAACAAAAACCAGGACAAGCTCCAAGAGCTTTGATTTTTGATACTGATAAGAAGTATTCTTGGACCCCAGGTAGATTTTCTGGATCTTTGCTGGGAGCAAAGGCAGCTTTGACAATATCAGATGCTCAGCCTGAGGACGAAGCCGAGTATTACTGTTCTCTTAGCGACGTGGATGGCTACTTGTTTGGCGGTGGAACACAACTGACGGTTCTGTCCGGTGGTGGCGGCTCTGGTGGCGGTGGCAGCGGCGGTGGTGGTTCCGGAGGCGGCGGTTCTCAGGCTGTGGTGACTCAGGAGCCGTCAGTGACTGTGTCCCCAGGAGGGACAGTCATTCTCACTTGTGGCTCCGGCACTGGAGCTGTCACCAGTGGTCATTATGCCAACTGGTTCCAGCAGAAGCCTGGCCAAGCCCCCAGGGCACTTATATTTGACACCGACAAGAAGTATTCCTGGACCCCTGGCCGATTCTCAGGCTCCCTCCTTGGGGCCAAGGCTGCCCTGACCATCTCGGATGCGCAGCCTGAAGATGAGGCTGAGTATTACTGTTCGCTCTCCGACGTTGACGGTTATCTGTTCGGAGGAGGCACCCAGCTGACCGTCCTCTCCCACCACCACCACCACCACGGAGGAGGTGGAAGCGGAGGAGGAGGAAGCGGAGGAGGAGGTAGCATGCCAGAGCCAGCGAAGTCTGCTCCCGCCCCGAAAAAGGGCTCCAAGAAGGCGGTGACTAAGGCGCAGAAGAAAGGCGGCAAGAAGCGCAAGCGCAGCCGCAAGGAGAGCTATTCCATCTATGTGTACAAGGTTCTGAAGCAGGTCCACCCTGACACCGGCATTTCGTCCAAGGCCATGGGCATCATGAATTCGTTTGTGAACGACATTTTCGAGCGCATCGCAGGTGAGGCTTCCCGCCTGGCGCATTACAACAAGCGCTCGACCATCACCTCCAGGGAGATCCAGACGGCCGTGCGCCTGCTGCTGCCTGGGGAGTTGGCCAAGCACGCCGTGTCCGAGGGTACTAAGGCCATCACCAAGTACACCAGCGCTAAG。

[0047] Example 2

[0048] A plasmid for expressing mitochondrially-localized dL5, Figure 2 is a plasmid structure diagram, and its DNA sequence is shown in SEQ ID NO.2, specifically:

[0049] ATGTTGGCTACCAGGGTATTTAGCCTAGTTGGCAAGCGAGCAATTTCCACCTCTGTGTGTGTACGAGCTGGAGGAGGTGGAAGCGGAGGAGGAGGAAGCGGAGGAGGAGGTAGCGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGCAGGCCGTCGTTACCCAAGAACCTAGTGTTACCGTTAGCCCAGGTGGTACTGTTATACTTACTTGTGGAAGTGGTACGGGTGCCGTCACATCTGGTCATTATGCAAATTGGTTTCAACAAAAACCAGGACAAGCTCCAAGAGCTTTGATTTTTGATACTGATAAGAAGTATTCTTGGACCCCAGGTAGATTTTCTGGATCTTTGCTGGGAGCAAAGGCAGCTTTGACAATATCAGATGCTCAGCCTGAGGACGAAGCCGAGTATTACTGTTCTCTTAGCGACGTGGATGGCTACTTGTTTGGCGGTGGAACACAACTGACGGTTCTGTCCGGTGGTGGCGGCTCTGGTGGCGGTGGCAGCGGCGGTGGTGGTTCCGGAGGCGGCGGTTCTCAGGCTGTGGTGACTCAGGAGCCGTCAGTGACTGTGTCCCCAGGAGGGACAGTCATTCTCACTTGTGGCTCCGGCACTGGAGCTGTCACCAGTGGTCATTATGCCAACTGGTTCCAGCAGAAGCCTGGCCAAGCCCCCAGGGCACTTATATTTGACACCGACAAGAAGTATTCCTGGACCCCTGGCCGATTCTCAGGCTCCCTCCTTGGGGCCAAGGCTGCCCTGACCATCTCGGATGCGCAGCCTGAAGATGAGGCTGAGTATTACTGTTCGCTCTCCGACGTTGACGGTTATCTGTTCGGAGGAGGCACCCAGCTGACCGTCCTCTCC。

[0050] Example 3

[0051] The fluorescent activation protein substrate MG2I has the structural formula of the following formula I,

[0052]

[0053] Its synthetic route can be found in Figure 3 , specifically including the following steps:

[0054] (1) 10 mmol 3,5-diiodo-4-hydroxybenzaldehyde, 12 mmol ethyl 4-bromobutyrate, and 10 mmol potassium carbonate were added to a 250 ml round-bottom flask, and 100 ml DMF was added. The mixture was stirred at 90° C. for 3 hours. The mixture was filtered, distilled under reduced pressure, and sampled. The mixture was filtered through a column (column model: flash chromatography column outer diameter: 46 mm, effective length: 457 mm, tetrafluoroethylene gate aperture: 2 mm, 24 / 40. Column parameters: petroleum ether: ethyl acetate = 5:1) to obtain compound A.

[0055] (2) Add 10 mmol of compound A, 20 mmol of N,N-dimethylaniline, and 10 mmol of zinc chloride to a 250 ml round-bottom flask, add 100 ml of anhydrous ethanol, and react at 80°C for 24 hours. Distill under reduced pressure, prepare the sample, and pass through a column (column model: flash chromatography column outer diameter: 46 mm, effective length: 457 mm, tetrafluoroethylene gate aperture: 2 mm, 24 / 40. Column parameters: petroleum ether: ethyl acetate = 10:1) to obtain compound B.

[0056] (3) 10 mmol of compound B and 10 mmol of tetrachlorobenzoquinone were added to a 250 ml round-bottom flask, and 100 ml of acetonitrile was added, and the mixture was reacted at 80°C for 4 hours. The mixture was distilled under reduced pressure, and the sample was prepared and passed through a column (column model: flash chromatography column outer diameter: 46 mm, effective length: 457 mm, tetrafluoroethylene gate aperture: 2 mm, 24 / 40. Column parameters: dichloromethane: methanol = 10:1) to obtain MG2I.

[0057] Example 4

[0058] A method for near-infrared light-activated protein proximity labeling (FAP-TAP), the method comprising: constructing a plasmid of a dL5 protein localized in a cell nucleus, stably expressing the plasmid in a cell line, adding a dL5 protein substrate MG2I and applying 660nm band light to the cells to achieve proximity labeling of cell nucleus-related proteins.

[0059] The specific steps include:

[0060] (1) Stably expressing the plasmid of the dL5 protein localized in the cell nucleus in MCF-7 cells. The specific steps include:

[0061] 1.1. The constructed plasmid of dL5 protein localized in the cell nucleus was mixed with PAX, PMD and p3000 to obtain lentivirus;

[0062] 1.2. Infect MCF-7 cells with the lentivirus.

[0063] S2, co-incubate MCF-7 cells stably expressing dL5 protein with MG2I, a substrate of dL5 protein, and m-aminophenylacetylene, and apply light of 660 nm to the cells. The specific steps include:

[0064] 2.1. Incubate the cells with 500 nmol / L MG2I and 1 mmol / L m-aminophenylacetylene for one hour;

[0065] 2.2. Irradiate the cells with light at 660 nm for 20 minutes.

[0066] Example 5

[0067] A method for near-infrared light-activated protein proximity labeling (FAP-TAP), the method comprising: constructing a plasmid of a dL5 protein localized in mitochondria, stably expressing the plasmid in a cell line, adding a dL5 protein substrate MG2I and applying 660nm band light to the cells to achieve proximity labeling of nucleus-related proteins.

[0068] The specific steps include:

[0069] (1) Stably express the plasmid of dL5 protein localized in mitochondria in MCF-7 cells. The specific steps include:

[0070] 1.1. The constructed plasmid of dL5 protein localized in mitochondria was mixed with PAX, PMD and p3000 to obtain lentivirus;

[0071] 1.2. Infect MCF-7 cells with lentivirus.

[0072] S2, co-incubate MCF-7 cells stably expressing dL5 protein with MG2I, a substrate of dL5 protein, and m-aminophenylacetylene, and apply light of 660 nm to the cells. The specific steps include:

[0073] 2.1. Incubate the cells with 500 nmol / L MG2I and 1 mmol / L m-aminophenylacetylene for one hour;

[0074] 2.2. Irradiate the cells with light at 660 nm for 20 minutes.

[0075] Experiment 1: Investigate the in vitro labeling verification test of BSA by each component of FAP-TAP.

[0076] Experimental group (100 μl reaction system): 100 μmol / L biotin aniline, 0.1 mg / mL bovine serum albumin, 10 μmol / L dL5, 10 μmol / L MG2I.

[0077] Control group 1 without dL5: 100 μmol / L biotin aniline, 0.1 mg / mL bovine serum albumin, PBS, 10 μmol / LMG2.

[0078] Control group 2 without MG2I: 100 μmol / L biotin aniline, 0.1 mg / mL bovine serum albumin, 10 μmol / L dL5, DMSO.

[0079] Blank control group: 100 μmol / L biotin aniline, 0.1 mg / mL bovine serum albumin, the same volume of PBS as that of the experimental group 10 μmol / LdL5, and the same volume of DMSO as that of the experimental group 10 μmol / L MG2I.

[0080] The above samples were illuminated with a 660nm LED lamp for 2 minutes (or dark treatment). Take 20μl of each sample, add 5μl5×loading buffer and incubate at 100℃ for 10min. The samples were first run at 70V for 20min in a 10% SDS-PAGE protein gel, and then run at 150V for 60min. Next, transfer the membrane at a voltage of 300mA for 80min. After the transfer, the membrane was incubated in Ponceau red dye solution for 2 minutes, and the excess Ponceau red dye was washed off with ultrapure water, and the total protein map was obtained by taking a photo. The membrane was placed in 1×PBS and incubated on a shaker for 5 minutes to wash off the Ponceau red dye bound to the protein. Use 5% BSA to block for 5 hours, wash 3 times with 1×TBST, and incubate with streptavidin-HRP antibody for 30 minutes. The membrane after antibody incubation was washed 3 times with 1×TBST, each time for 10min. ECL developer was dripped on the membrane for exposure and development.

[0081] Results Figure 4 , it can be seen from the figure that the target protein BSA can be labeled only when and only when light, dL5** protein, and MG2I exist at the same time.

[0082] Experiment 2: Investigate the changes of FAP-TAP labeling effect on BSA in vitro with illumination time.

[0083] Prepare 100ul reaction system, including: 100μmol / L biotin aniline, 0.1mg / mL bovine serum albumin, 10μmol / L dL5, 10μmol / L MG2I.

[0084] The above samples were illuminated with a 660nm LED lamp for 1, 2, 5, 10, 15, and 20 minutes (or dark treatment). Take 20ul of each sample, add 5ul 5×loading buffer and incubate at 100℃ for 10min. The samples were first run at 70V for 20min in a 10% SDS-PAGE protein gel, and then run at 150V for 60min. Next, transfer the membrane at a voltage of 300mA for 80min. After the transfer, the membrane was incubated in Ponceau dye for 2 minutes, and the excess Ponceau dye was washed off with ultrapure water, and the total protein map was obtained by taking a photo. The membrane was placed in 1×PBS and incubated on a shaker for 5 minutes to wash off the Ponceau dye bound to the protein. Use 5% BSA to block for 5 hours, wash 3 times with 1×TBST, and incubate with streptavidin-HRP antibody for 30 minutes. The membrane after antibody incubation was washed 3 times with 1×TBST, each time for 10min. ECL developer was dripped on the membrane for exposure and development.

[0085] Results Figure 5 ,It can be seen from the figure that the signal intensity of the labeled BSA protein gradually increases with the extension of the illumination time.

[0086] Experiment 3: Investigate how the proximity labeling effect of FAP-TAP on target proteins in living cells changes with illumination time.

[0087] A solution containing 1 mmol / L of m-aminophenylacetylene and 500 nmol / L MG2I prepared by HBSS was added to MCF-7 cells stably expressing mito-dL5 and ordinary MCF-7 cells, and incubated in a cell culture incubator at 37 degrees for 60 minutes. After the incubation, the cells were washed once with 1×PBS solution and HBSS solution was added. The above cells were illuminated with 660nm LED for 10, 20, 30, 40, 50, and 60 minutes (or dark treatment). The treated cells were scraped with a cell scraper and resuspended with 1×PBS. Centrifuge at 1200g for 3 minutes, discard the supernatant, add 200μl ddH2O and 2μl EDTA-free protease inhibitors, and disrupt the cells with an ultrasonic disruptor. Centrifuge at 15000g for 15 minutes and take the supernatant. The concentration of all protein samples was determined using the BCA kit. All protein samples were diluted to 1mg / ml, and click chemistry reaction solution was added to the protein samples to make the final volume 100μl and the final concentrations of each component were 1mmol / L CuSO4, 0.1mmol / L TBTA, 1mmol / L TCEP, and 0.1mmol / L TAMRAazide. The samples were reacted at room temperature for one hour. After the reaction, 500ul acetone was added to the samples and placed in a -20℃ refrigerator for 20 minutes. Centrifuge at 4℃15000g for 10 minutes, discard the supernatant and add 20ul 1×loading buffer and incubate at 100℃ for 10min. The samples were run at 70V for 20min in a 10% SDS-PAGE protein gel, and then at 150V for 60min. The protein gel was placed in an imaging system and imaged using the Cy3 channel to obtain a Rhodamine image. The protein gel was then stained with Coomassie Brilliant Blue, and the protein gel was placed in an imaging system and photographed to obtain a Coomassie Blue Staining image.

[0088] Figure 6 The results of the change of the proximity labeling effect of FAP-TAP on the target protein in living cells with the illumination time. A in the figure is the Rhodamine graph; B in the figure is the Coomassie Blue Staining graph. It can be seen from the figure that the signal intensity of the protein labeled in the MCF-7 cells stably expressing mito-dL5 gradually increases with the extension of the illumination time.

[0089] Experiment 4: Investigate the effect of FAP-TAP on the proximity labeling of target proteins in living cells as the concentration of m-aminophenylacetylene changes.

[0090] A solution containing 0, 0.1, 0.2, 0.5, 1, 2, 5 mmol / L of m-aminophenylacetylene and 500 nmol / L MG2I prepared by HBSS was added to MCF-7 cells stably expressing mito-dL5 and ordinary MCF-7 cells, respectively, and incubated in a cell culture incubator at 37 degrees for 60 minutes. After the incubation, the cells were washed once with 1×PBS solution and HBSS solution was added. The above cells were illuminated with 660nm LED for 20 minutes. The treated cells were scraped with a cell scraper and resuspended with 1×PBS. Centrifuged at 1200g for 3 minutes, the supernatant was discarded, 200ul ddH2O and 2ul EDTA-free protease inhibitor were added, and the cells were broken by ultrasonic disruptor. Centrifuged at 15000g for 15 minutes and the supernatant was taken. The concentration of all protein samples was determined using the BCA kit. All protein samples were diluted to 1mg / ml, and click chemistry reaction solution was added to the protein samples to make the final volume 100ul and the final concentrations of each component were 1mmol / L CuSO4, 0.1mmol / L TBTA, 1mmol / L TCEP, and 0.1mmol / LTAMRAazide. The samples were reacted at room temperature for one hour. After the reaction, 500ul acetone was added to the samples and placed in a -20℃ refrigerator for 20 minutes. Centrifuge at 4℃15000g for 10 minutes, discard the supernatant and add 20ul 1×loading buffer and incubate at 100℃ for 10min. The samples were run at 70V for 20min in a 10% SDS-PAGE protein gel, and then at 150V for 60min. The protein gel was placed in an imaging system and imaged using the Cy3 channel to obtain a Rhodamine image. The protein gel was then stained with Coomassie Brilliant Blue, and the protein gel was placed in an imaging system and photographed to obtain a Coomassie Blue Staining image.

[0091] Figure 7 The results of the proximity labeling effect of FAP-TAP on the target protein in living cells as the concentration of m-aminophenylacetylene changes. A in the figure is the Rhodamine graph; B in the figure is the Coomassie Blue Staining graph. It can be seen from the figure that the signal intensity of the protein labeled in MCF-7 cells stably expressing mito-dL5 gradually increases with the increase of m-aminophenylacetylene concentration.

[0092] Experiment 5: Investigate the effect of FAP-TAP on the proximity labeling of target proteins in living cells as the concentration of MG2I changes.

[0093] A solution containing 1mmol / L m-aminophenylacetylene and 0, 0.1, 0.2, 0.3, 0.4, 0.5, 1umol / L MG2I prepared by HBSS was added to MCF-7 cells stably expressing mito-dL5 and ordinary MCF-7 cells, and incubated in a cell culture incubator at 37 degrees for 60 minutes. After incubation, the cells were washed once with 1×PBS solution and HBSS solution was added. The above cells were illuminated with 660nm LED for 20 minutes. The treated cells were scraped with a cell scraper and resuspended with 1×PBS. Centrifuge at 1200g for 3 minutes, discard the supernatant, add 200ul ddH2O and 2ul EDTA-free protease inhibitor, and disrupt the cells with an ultrasonic disruptor. Centrifuge at 15000g for 15 minutes and take the supernatant. The concentration of all protein samples was determined using the BCA kit. All protein samples were diluted to 1mg / ml, and click chemistry reaction solution was added to the protein samples to make the final volume 100ul and the final concentrations of each component were 1mmol / L CuSO4, 0.1mmol / L TBTA, 1mmol / L TCEP, and 0.1mmol / LTAMRAazide. The samples were reacted at room temperature for one hour. After the reaction, 500ul acetone was added to the samples and placed in a -20° refrigerator for 20 minutes. Centrifuge at 4°15000g for 10 minutes, discard the supernatant and add 20ul 1×loading buffer and incubate at 100℃ for 10min. The samples were first run at 70V for 20min in a 10% SDS-PAGE protein gel, and then run at 150V for 60min. The protein gel was placed in an imaging system and imaged using the Cy3 channel to obtain a Rhodamine image. The protein gel was then stained with Coomassie Brilliant Blue, and the protein gel was placed in an imaging system and photographed to obtain a Coomassie Blue Staining image.

[0094] Figure 8 The results of the proximity labeling effect of FAP-TAP on the target protein in living cells as the concentration of MG2I changes. A in the figure is the Rhodamine graph; B in the figure is the Coomassie Blue Staining graph. It can be seen from the figure that the signal intensity of the protein labeled in MCF-7 cells stably expressing mito-dL5 gradually increases with the increase of the concentration of MG2I.

[0095] Experiment 6: Immunofluorescence imaging to investigate the proximity labeling effect of FAP-TAP on target proteins in living cells.

[0096] A solution containing 1mmol / L m-aminophenylacetylene and 500nmol / L MG2I (or no MG2I) prepared by HBSS was added to MCF-7 cells stably expressing mito-dL5 and ordinary MCF-7 cells, respectively, and incubated in a cell culture incubator at 37 degrees for 60 minutes. After incubation, the cells were washed once with 1×PBS solution and HBSS solution was added. The above cells were illuminated with a 660nm LED for 20 minutes. The cells were rinsed with PBS three times, and then 500μL 4% paraformaldehyde was added to fix for 15 minutes and then removed. They were rinsed with PBS three times for 5 minutes each. 100ul click chemistry reaction solution was added, and the concentrations of each component were 50umol / LCy3-azide, 2mmol / L CuSO4, 1mmol / L TBBAA, and 0.5mg / mL sodium ascorbate. The reaction was carried out at room temperature in the dark for 30 minutes. Rinse with PBS 6 times. 200μL membrane permeate was added and incubated at room temperature for 1h and then removed. The membrane permeate was made by mixing 167μL fetal bovine serum (FBS), 10μL TritonX-100 and 3.17μL PBS. 100μL primary antibody (1﹕100) was added and incubated at 4℃ overnight. After rinsing with PBS for 5 minutes each time, the secondary antibody (1﹕300) was added and incubated at room temperature in the dark for 2 hours. After rinsing with PBS, Hoechest staining was added for 10 minutes and confocal imaging was observed.

[0097] Fig. 9 The immunofluorescence imaging results of the proximity labeling effect of FAP-TAP on the target protein in living cells. As shown in Figure A, the fluorescence displayed by the labeled protein in the MCF-7 cells stably expressing mito-dL5 has a good co-localization result with the fluorescence displayed by V5-tag, indicating that the proximity labeling of the protein is mitochondrial specific. As shown in Figure B, the fluorescence displayed by the labeled protein in the MCF-7 cells stably expressing H2B-dL5 has a good co-localization result with the fluorescence displayed by V5-tag, indicating that the proximity labeling of the protein is nucleus specific.

[0098] The above is only a preferred embodiment of the present invention and does not limit the present invention in any form. Although the present invention has been disclosed as above in the preferred embodiment, it is not used to limit the present invention. Any technician familiar with the art can make many possible changes and modifications to the technical solution of the present invention by using the methods and technical contents disclosed above without departing from the spirit and technical solution of the present invention, or modify it into an equivalent embodiment of equivalent changes. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention, still fall within the scope of protection of the technical solution of the present invention.

Claims

1. A method for near-infrared light-activated protein proximity labeling, characterized in that: The method comprises the following steps: (1) Stably express dL5 protein plasmid in MCF-7 cells; (2) co-incubating the MCF-7 cells with the MG2I substrate and m-aminophenylacetylene, and applying light at a wavelength of 660 nm to the cells; The dL5 protein plasmid is a dL5 protein plasmid localized in the cell nucleus or a dL5 protein plasmid localized in the mitochondria. The DNA sequence of the dL5 protein plasmid localized in the cell nucleus is shown in SEQ ID NO.1, and the DNA sequence of the dL5 protein plasmid localized in the mitochondria is shown in SEQ ID NO.2; The MG2I substrate has the following structural formula I; 2. The method according to claim 1, characterized in that The MG2I substrate is prepared by a method comprising the following steps: S1, dissolving 3,5-diiodo-4-hydroxybenzaldehyde, ethyl 4-bromobutyrate and potassium carbonate in an organic solution, and heating to react to obtain compound A; S2, dissolving the compound A, N,N-dimethylaniline and zinc chloride in anhydrous ethanol, and heating to react to obtain compound B; S3, dissolving the compound B and chlorobenzoquinone in acetonitrile, and heating the mixture to obtain MG2I; The compound A has the following structural formula II: The compound B has the following structural formula II:

3. The method according to claim 2, characterized in that The molar concentration ratio of 3,5-diiodo-4-hydroxybenzaldehyde, ethyl 4-bromobutyrate and potassium carbonate in S1 is: 1:1.2:1; And / or, the organic solution is DMF; And / or, the stirring reaction specifically comprises: stirring the reaction at 90° C. for 3 to 6 hours.

4. The method according to claim 2, characterized in that: The molar concentration ratio of the compound A, N,N-dimethylaniline and zinc chloride in S2 is 1:2:1; And / or, the stirring reaction is specifically: reacting at 80° C. for 24 to 48 hours.

5. The method according to claim 2, characterized in that: The molar concentration ratio of compound B and chloranil in S3 is 1:1; And / or, the stirring reaction is specifically: reacting at 80° C. for 3 to 6 hours.

6. The method according to any one of claims 1 to 5, characterized in that The (1) specifically comprises: mixing and packaging the dL5 protein plasmid with PAX, PMD, and p3000 to obtain a lentivirus; and infecting MCF-7 cells with the lentivirus.

7. The method according to any one of claims 1 to 5, characterized in that The method (2) is specifically as follows: incubating 500 nmol / LMG2I and 1 mmol / L m-aminophenylacetylene with MCF-7 cells for one hour; and irradiating the MCF-7 cells with light at a wavelength of 660 nm for 20 minutes.

Images