Nucleic acid molecule for DNA methylation conversion rate evaluation or quality control, kit and quality control method

Abstract

The invention discloses a nucleic acid molecule for DNA methylation conversion rate evaluation or quality control, a kit and a quality control method, and relates to the technical fields of biochemistry, epigenetics and molecular biology. The nucleic acid molecule and the quality control method provided by the invention can be completed only by two steps of PCR amplification and electrophoresis, are simple and convenient, can well evaluate the BS transformation condition on the experimental level, and can better assist related research of DNA methylation.

Description

Technical Field

[0001] The present invention relates to the technical fields of biochemistry, epigenetics and molecular biology, and in particular to a nucleic acid molecule, a kit and a quality control method for evaluating or controlling DNA methylation conversion rate. Background Art

[0002] At present, DNA methylation is an epigenetic mechanism that transfers a methyl group from S-adenylmethionine (SAM) to the fifth carbon of cytosine residues under the action of DNA methyltransferases (Dnmts) family to form 5mC. DNA methylation regulates gene expression by recruiting proteins involved in gene repression or by inhibiting the binding of transcription factors to DNA. DNA methylation has important applications in mental illness, early cancer screening, assisted reproduction and other fields.

[0003] There are two main methods for studying DNA methylation, enzyme treatment and chemical reagent bisulfite (BS) treatment. Although the enzyme method causes less damage to DNA than the chemical reagent method, the chemical reagent method is time-saving and cheaper. Under the action of BS, unmethylated cytosine C will be deaminated to uracil U, and then amplified to thymine T, while methylated 5mC and 5hmC will not change. The change of C base is used to study and analyze the methylation level in the whole genome through high-throughput sequencing.

[0004] All C bases in the λDNA sequence are not methylated, so it is often used as a standard sequence to sequence the BS conversion rate for quality control. Since the λDNA sequence is long, the amount of data for target sample sequencing is increased invisibly. Although some companies have launched commercial standards with shorter sequences, these are all quality controls for BS conversion rates at the sequencing level. However, due to the storage stability of BS conversion reagents, possible errors in the experimental operation process, and the huge amount of data from whole-genome methylation sequencing, the need for BS conversion rate quality control at the experimental level has gradually become prominent. Moore, Lisa D et al. designed a 104bp Spike-in sequence containing an unmethylated C base in the middle of the sequence. The sequence was added to the sample at a certain ratio for BS library construction. The BS conversion rate detection process is as follows: 1) Amplify the Spike-in sequence after BS conversion, 2) 2× magnetic bead purification of the amplified product, 3) Digestion of the purified product with restriction endonuclease TaqⅠ, 4) Agarose gel electrophoresis of the digested product, 5) The gel image is used to see whether the amplified product is digested to evaluate the BS conversion. Although this method can effectively evaluate methylation conversion, the overall process is cumbersome, costly, and time-consuming.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The object of the present invention is to provide a nucleic acid molecule, a kit and a quality control method for evaluating or controlling DNA methylation conversion rate to solve the above technical problems.

[0007] The present invention is achieved in that:

[0008] In a first aspect, the present invention provides a nucleic acid molecule for evaluating or controlling DNA methylation conversion rate, comprising: a spike in forward sequence, a methylated forward primer, a non-methylated forward primer and a reverse primer, wherein the nucleotide sequence of the methylated forward primer is: 5'-(N)nTBT-3', N is selected from G, A or T, n is 18-25; B is T, C or G; the nucleotide sequence of the non-methylated forward primer is: 5'-(N)nCBC-3', the (N)n sequence in the methylated forward primer is the same as the (N)n in the non-methylated forward primer; the spike in forward sequence comprises:

[0009] (N)nCG / A / TC-Y-reverse complementary sequence of the reverse primer; Y represents a 70-200 bp ribonucleotide sequence; the 19th and 21st positions in the forward sequence of the Spike in are non-methylated C bases.

[0010] In a second aspect, the present invention further provides a reagent or a kit, which comprises the above-mentioned nucleic acid molecule for evaluating or controlling the DNA methylation conversion rate.

[0011] In a third aspect, the present invention also provides a nucleic acid molecule for evaluating or controlling DNA methylation conversion rate or the use of the above-mentioned reagent or kit in the quality control of DNA methylation conversion rate, and the application is not for the purpose of diagnosis or treatment of disease.

[0012] In a fourth aspect, the present invention further provides a method for quality control of DNA methylation conversion rate, comprising the following steps:

[0013] S1: The sample to be tested is mixed with the annealed Spike in sequence;

[0014] S2: BS library construction, including: enzyme digestion, end repair and adding "A"; ligation of methylated adapters and purification; BS conversion, the conversion time is 30-90 minutes; PCR amplification of the BS converted product; methylation library purification;

[0015] S3: Evaluation of Spike in BS conversion in BS library: The methylated library obtained in step S2 was amplified by PCR using the methylated forward primer and reverse primer as well as the unmethylated forward primer and reverse primer mentioned above.

[0016] The present invention has the following beneficial effects:

[0017] The present invention optimizes the Spike-in sequence and primers, designs an unmethylated base C at the primer junction at the 5' end of the Spike-in sequence, designs a methylated forward primer and a non-methylated forward primer at the same time, the -1 position and -3 position at the 3' end of the methylated forward primer are both set from C bases to T bases, and the -1 position and -3 position at the 3' end of the non-methylated forward primer both maintain the C base unchanged.

[0018] If the BS conversion rate meets the standard, the C base of the Spike in sequence is deaminated to become uracil U. The reverse primer is used to complement the sequence after BS conversion to amplify the complementary chain of the BS conversion product, and then the methylated forward primer can anneal and extend with the complementary chain; however, the non-methylated forward primer cannot anneal and extend with the complementary chain due to the C base sequence setting at the 3' end. Therefore, when the BS conversion rate meets the standard, only the methylated forward primer amplification product has a band, while the non-methylated forward primer amplification product has no band.

[0019] If the BS conversion rate does not meet the standard, (1) the C base of the Spike in sequence is maintained, and the 5' end of the converted sequence is (N)n-CGC, so that the sequence after complementary pairing amplification with the reverse primer (i.e., the complementary chain of the BS product) at the 3' end of the subsequent forward primer binding position is the reverse complementary sequence of GCG-reverse primer, so that it can complement the unmethylated forward primer (when B is T, the 3' end of the forward primer is CTC), but not the methylated forward primer (when B is T, the 3' end of the forward primer is TTT). Therefore, by judging that the product amplified by the non-methylated forward primer has a band, while the product amplified by the methylated forward primer has no band, it can be judged that the BS conversion rate does not meet the standard; (2) the C base of the Spike-in sequence is partially maintained, and the sequence that cannot be normally converted has (N)n-CGC at the 5' end of the converted sequence; the sequence that is normally converted has (N)n-UGU at the 5' end of the converted sequence; in this way, there will be a situation where both the non-methylated forward primer and the methylated forward primer can partially pair with the complementary chain of the BS product, so that both primers can amplify the target band, which can also be used to judge that the BS conversion rate does not meet the standard.

[0020] This nucleic acid molecule and quality control method can be completed in just two steps: PCR amplification and electrophoresis. It is simple and convenient, and can well evaluate BS conversion at the experimental level, and better assist DNA methylation-related research. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0022] Figure 1 Schematic diagram of the Spike-in sequence amplification designed for the present invention;

[0023] Figure 2 This is the gel image of the conversion evaluation of different BS treatment times in Example 1;

[0024] Figure 3 This is the first generation sequencing image of the amplified products of MF and UM-F in Example 1;

[0025] Figure 4 This is a gel image of evaluating the BS methylation conversion rate using the quality control method provided in Example 2. DETAILED DESCRIPTION

[0026] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0027] The BS conversion in the present invention refers to: bisulfite (BS) treatment method. Under the action of BS, unmethylated cytosine C will be deaminated to become uracil U, and then amplified to become thymine T, while methylated 5mC and 5hmC will not change. The change of C base is used to study and analyze the methylation level in the whole genome through high-throughput sequencing.

[0028] In a first aspect, the present invention provides a nucleic acid molecule for evaluating or controlling DNA methylation conversion rate, comprising: a spike in forward sequence, a methylated forward primer, a non-methylated forward primer and a reverse primer, wherein the nucleotide sequence of the methylated forward primer is: 5'-(N)nTBT-3', N is selected from G, A or T, n is 18-25; B is T, C or G; the nucleotide sequence of the non-methylated forward primer is: 5'-(N)nCBC-3', the (N)n sequence in the methylated forward primer is the same as the (N)n in the non-methylated forward primer; the spike in forward sequence comprises:

[0029] (N)nCG / A / TC-Y-reverse complementary sequence of the reverse primer; Y represents a 70-200 bp ribonucleotide sequence; the 19th and 21st positions in the forward sequence of the Spike in are non-methylated C bases.

[0030] The 19th and 21st positions in the forward sequence of the spike in are non-methylated C bases; thus, during BS conversion, C is converted to U, which facilitates subsequent amplification and quality control evaluation.

[0031] The present invention provides a simple and rapid method for evaluating BS conversion, which can control the key steps of the experiment and improve the experimental efficiency. By evaluating the BS conversion at the experimental level, it can also effectively avoid invalid sequencing caused by sequencing that does not meet the BS conversion standards, thereby wasting sequencing data.

[0032] The present invention only requires two steps, PCR amplification and agarose gel electrophoresis, and reduces the steps of product purification and enzyme cutting compared to the existing method. The time cost and economic cost are better than the existing method, and the BS conversion situation can be better evaluated at the experimental level.

[0033] The present invention, through the designed system, can clearly distinguish samples with substandard BS conversion (e.g., <99.0%) and qualified BS conversion (≥99.0%) from the agarose gel electrophoresis diagram. Traditional methods have a low resolution at this critical threshold and cannot sensitively perform quality control on high-quality methylation sequencing data.

[0034] In addition, in experiments without sequencing, when the target methylated sequence is amplified after BS treatment, the Spike-in sequence can also provide a reference for the BS conversion status; in short, the present invention can assist DNA methylation research to a great extent.

[0035] The length of the N sequence in the middle of the Spike in sequence can be adjusted according to the quality control requirements, such as 70bp, 71bp, 75bp, 80bp, 85bp, 90bp, 95bp, 100bp, 105bp, 110bp, 115bp, 120bp, 130bp, 140bp, 150bp, 160bp, 180bp, 190bp or 200bp. The N sequence can be a modified or unmodified nucleotide.

[0036] When B in the methylated forward primer and the non-methylated forward primer is C, the forward sequence of the Spike in is: (N)nCAC-Y-reverse complementary sequence of the reverse primer; at this time, the reverse primer uses the positive strand as a template to amplify the negative strand 5'...ATA...-3', and the methylated forward primer / non-methylated forward primer combines with the amplified negative strand to form a strong CT mutation, thereby ensuring that when the BS conversion rate reaches the standard, only the methylated forward primer amplification product has a band, while the non-methylated forward primer amplification product has no band. However, medium or weak mutations will result in that when the BS conversion rate reaches the standard, only the methylated forward primer amplification product has a band, while the non-methylated forward primer amplification product has a band, making it impossible to effectively judge whether the BS conversion rate reaches the standard.

[0037] When B in the methylated forward primer and the unmethylated forward primer is G, the forward sequence of the Spike in is: (N)nCTC-Y-the reverse complementary sequence of the reverse primer; the amplified negative chain is 5'...AAA...-3', and the methylated forward primer / unmethylated forward primer combines with the amplified negative chain to form a strong GA mutation, thereby ensuring that when the BS conversion rate reaches the standard, only the product amplified by the methylated forward primer has a band, while the product amplified by the unmethylated forward primer has no band.

[0038] When B in the methylated forward primer and the unmethylated forward primer is T, the forward sequence of the Spike in is: (N)nCGC-Y-the reverse complementary sequence of the reverse primer;

[0039] The forward sequence of the spike in includes: GAGTATAGAGTGATAGATCGC-Y-GGGTAGTAGTGAGTAGATTGTA; Y represents a nucleotide sequence with a length of 70-200 bp.

[0040] The nucleotide sequence of the methylated forward primer is shown in SEQ ID NO: 1, and the nucleotide sequence of the unmethylated forward primer is shown in SEQ ID NO: 2; the Spike in forward sequence includes:

[0041] GAGTATAGAGTGATAGATCGC-Y-GGGTAGTAGTGAGTAGATTGTA; Y represents a nucleotide sequence with a length of 70-200 bp.

[0042] SEQ ID NO: 1: GAGTATAGAGTGATAGATTTT; SEQ ID NO: 2: GAGTATAGAGTGATAGATCTC.

[0043] In a preferred embodiment of the present invention, at least one of the 22nd to 150th positions or the 22nd to 170th positions of the Spike in forward sequence is a non-methylated C base; in an optional embodiment, a person skilled in the art can adjust the number and position of non-methylated C bases and methylated C bases in the Spike in forward sequence according to the level of methylation in the genome to be simulated, so as to more realistically simulate the level of genomic methylation, thereby better evaluating or controlling the DNA methylation conversion rate.

[0044] In a preferred embodiment of the present invention, at least one of the 22nd to 70th positions or the 22nd to 120th positions in the forward sequence of the Spike in is a non-methylated C base;

[0045] In a preferred embodiment of the present invention, at least one of the 58th, 65th, 67th, 71st, 74th, 80th, 83rd, and 90th positions in the forward sequence of Spike in is a non-methylated C base;

[0046] In a preferred embodiment of the present invention, positions 21, 58, 65, 67, 71, 74, 80, 83 and 90 in the forward sequence of Spike in are non-methylated C bases.

[0047] In a preferred embodiment of the present invention, at least one G base in the forward sequence of the Spike in is preceded by a methylated C base; referring to the whole genome methylation sequencing data, the common bases after methylated C and unmethylated C (such as: the common G base after methylated C), setting the above position to an unmethylated C base helps to better simulate the genome sequence.

[0048] In a preferred embodiment of the present invention, the forward sequence of Spike in is shown as SEQ ID NO:3.

[0049] The sequence of SEQ ID NO:3 is as follows:

[0050] GAGTATAGAGTGATAGATCGCATGTGGTTAGTTATAAAGTTGTTAGTATGATACGTTCTAACTTCTCAAACTACTATAGCTTCAATATGCACGTTCTAGGGTAGTAGTGAGTAGATTGTA.

[0051] In a preferred embodiment of the present invention, the forward sequence of the Spike in has at least one methylated C base;

[0052] In a preferred embodiment of the present invention, at least one of the 54th, 62nd, 92nd and 96th positions in the forward sequence of Spike in is a methylated C base;

[0053] In a preferred embodiment of the present invention, the 54th, 62nd, 92nd and 96th positions in the forward sequence of Spike-in are methylated C bases.

[0054] The forward sequence of the Spike-in includes methylated C and unmethylated C bases, which can completely simulate the normal gene sequence and eliminate the problem of uneven BS conversion caused by sequence base preference.

[0055] In a preferred embodiment of the present invention, the nucleic acid molecule further comprises a Spike in reverse sequence complementary to the Spike in forward sequence, and the 3' end of the Spike in reverse sequence may or may not have an A.

[0056] For example, the reverse sequence of Spike in is shown in SEQ ID NO:4:

[0057] ACAATCTACTCACTACTACCCTAGAACGTGCATATTGAAGCTATAGTAGTTTGAGAAGTTAGAACGTATCATACTAACAACTTTATAACTAACCACATGCGATCTATCACTCTATACTCA.

[0058] The reverse primer is shown in SEQ ID NO:5:

[0059] ACAATCTACTCACTACTACCC.

[0060] In a second aspect, the present invention further provides a reagent or a kit, which comprises the above-mentioned nucleic acid molecule for evaluating or controlling the DNA methylation conversion rate.

[0061] The reagents may be lyophilized powders, liquids or semisolids.

[0062] The kit, for example, also includes instructions for use, water, PCR Buffer, DNA polymerase, and dNTPs.

[0063] In a third aspect, the present invention also provides a nucleic acid molecule for evaluating or controlling DNA methylation conversion rate or the use of the above-mentioned reagent or kit in the quality control of DNA methylation conversion rate, and the application is not for the purpose of diagnosis or treatment of disease.

[0064] In a fourth aspect, the present invention further provides a method for evaluating or quality controlling the DNA methylation conversion rate, comprising the following steps:

[0065] S1: The sample to be tested is mixed with the annealed Spike in sequence;

[0066] S2: BS library construction, including: enzyme digestion, end repair and adding "A"; ligation of methylated adapters and purification; BS conversion, the conversion time is 30-90 minutes; PCR amplification of the BS converted product; methylation library purification;

[0067] S3: Evaluation of Spike in BS conversion in BS library: The methylated library obtained in step S2 was amplified by PCR using the methylated forward primer and reverse primer as well as the unmethylated forward primer and reverse primer mentioned above.

[0068] In a preferred embodiment of the present invention, the Spike in BS conversion evaluation includes at least one of the following methods:

[0069] (1) Perform electrophoresis on the amplified product and evaluate whether the DNA methylation conversion meets the standard based on the presence or absence of bands;

[0070] (2) Sequencing the amplified product and evaluating the DNA methylation conversion rate based on the sequencing results; the sequencing results can also further confirm the sequence of the amplified product.

[0071] In a preferred embodiment of the present invention, if the electrophoresis results show that only the amplification product of the methylated forward primer has a band, while the amplification product of the non-methylated forward primer has no band, then the BS conversion (rate) is evaluated to be up to standard;

[0072] If the electrophoresis results show that both the methylated forward primer amplification product and the non-methylated forward primer amplification product have bands; or only the non-methylated forward primer amplification product has a band, while the methylated forward primer amplification product has no band, then it is assessed that the BS conversion (rate) does not meet the standard.

[0073] The BS conversion time affects the BS conversion rate. If the BS time is too short, the BS conversion may not be completed. For example, the C in some Spike-in sequences is converted to U, while the C in other Spike-in sequences still maintains the C base, which makes it impossible to accurately evaluate the DNA conversion rate later.

[0074] The DNA conversion rate represents the total BS conversion rate of the DNA sequence: 1. First calculate the BS conversion rate of each non-methylated C site of the sequence. The calculation method is: the number of times the site is sequenced to measure T / the total number of sequencing times for the site; 2. Calculate the DNA conversion rate. The calculation method is: the average BS conversion rate of all non-methylated C sites of the DNA sequence.

[0075] In a preferred embodiment of the present invention, the BS conversion time is 60-90 min; under the above conversion time, the DNA conversion rate is ≥99.0%, and the BS conversion time is, for example, 60 min, 70 min, 80 min or 90 min.

[0076] In a preferred embodiment of the present invention, the PCR amplification procedure includes: 95°C-98°C, 1-2 min; 95°C-98°C, 10 s, 55°C, 20 s, 70°C-72°C, 20 s, 30-35 cycles; 72°C, 5 min;

[0077] In a preferred embodiment of the present invention, the PCR amplification system includes: 5-30 ng of BS-converted product, a methylated forward primer with a final concentration of 0.2 uM, a non-methylated forward primer with a final concentration of 0.2 uM, a reverse primer with a final concentration of 0.2 uM, dNTP with a final concentration of 0.2 mM, a DNA polymerase and a PCR buffer;

[0078] In a preferred embodiment of the present invention, in step S1, the annealed Spike-in sequence accounts for 0.5%-1% of the input mass of the sample to be tested; preferably, the Spike-in accounts for 0.5% of the input mass of the sample to be tested.

[0079] If it is not within this range, firstly, too many Spike-ins will occupy the sequencing data; secondly, it will also have a certain impact on the amplification of methylated and non-methylated primers, which may lead to inaccurate detection. Too few Spike-ins will affect amplification, and methylated primers / non-methylated primers may not be amplified, thus affecting the detection results.

[0080] The samples to be tested include but are not limited to: DNA samples from animals, plants or microorganisms, especially DNA samples from peripheral blood and tissues of mammals (such as humans).

[0081] Annealing means: reacting the forward sequence of Spike-in and the reverse sequence of Spike-in under the annealing procedure so that the two form a double-stranded DNA molecule. The annealing procedure is, for example:

[0082]

[0083] In the annealing program, -0.2* means that the temperature decreases by 0.2°C in each cycle.

[0084] In a preferred embodiment of the present invention, in step S2, the final concentration of the methylated linker is 0.5-1uM, preferably 0.8uM.

[0085] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0086] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0087] "Spike-in" in the present invention is synonymous with "Spike in".

[0088] Example 1

[0089] This embodiment provides a method for evaluating or quality controlling the DNA methylation conversion rate.

[0090] 1. Sample Primer Preparation

[0091] 1) Sample information:

[0092] λDNA solution (Sangon Biotechnology, catalog number: B600011-0050).

[0093] 2) Spike-in sequence (biosynthesis), see the schematic diagram of Spike-in sequence amplification Figure 1 As shown:

[0094] Spike-in forward sequence (SEQ ID NO: 3):

[0095] 5'-p-GAGTATAGAGTGATAGATCGCATGTGGTTAGTTATAAAGTTGTTAGTATGATAmCGTTCTAAmCTTCTCAAACTACTATAGCTTCAATATGCAmCGTTmCTAGGGTAGTAGTGAGTAGATTGTA-3'; wherein the 54th, 62nd, 92nd and 96th positions in the forward sequence of Spike in are methylated C bases (mC), and p indicates modification of the 5' phosphate group of the base.

[0096] Spike-in reverse sequence (SEQ ID NO: 4):

[0097] 5'-p-ACAATCTACTCACTACTACCCTAGAACGTGCATATTGAAGCTATAGTAGTTTGAGAAGTTAGAACGTATCATACTAACAACTTTATAACTAACCACATGCGATCTATCACTCTATACTCA-3'

[0098] 3) Primer sequence:

[0099] MF:5'-GAGTATAGAGTGATAGATTTT-3'(SEQ ID NO:1)

[0100] UM-F:5'-GAGTATAGAGTGATAGATCTC-3'(SEQ ID NO:2)

[0101] R: 5'-ACAATCTACTCACTACTACCC-3' (SEQ ID NO: 5).

[0102] 2. Spike-in sequence annealing

[0103] 1) Prepare the annealing system according to the following table:

[0104] name Volume (μL) Spike-in forward sequence 2.5 Spike-in reverse sequence 2.5 <![CDATA[NF H2O]]> 25 Total 30

[0105] 2) Annealing according to the following procedure:

[0106]

[0107] Note: * indicates a decrease of 0.2℃ per cycle.

[0108] 3) After annealing, use Qubit to measure the concentration for later use

[0109] 3. BS library preparation

[0110] 1) Sample preparation:

[0111] 140 ng of λDNA was taken and mixed into 5 samples at a ratio of Spike-in / λDNA=0.5%, and numbered C0, C1, C2, C3, and C4.

[0112] 2) Enzyme digestion, end repair and "A" (Yisheng Biological, catalog number: 12195ES24)

[0113] ① Prepare enzyme digestion, end repair and "A" system according to the table below:

[0114]

[0115]

[0116] ②After mixing, centrifuge immediately and react according to the procedure in the following table:

[0117]

[0118] 3) Connector ligation and purification

[0119] ① Prepare the reaction system according to the table below, where Ligation Enhancer 2.0 and Rapid DNA Ligase 2.0 were purchased from Yisheng Biotechnology, catalog number: 12195ES24, and Methylate DNA Adapter was synthesized by Sangon Biotechnology.

[0120]

[0121] ②After mixing, centrifuge immediately and react according to the procedure in the following table:

[0122]

[0123] ③ Add 30 μL of balanced Hieff magnetic beads to the ligation product, vortex to mix, and incubate at room temperature for 5 minutes;

[0124] ④ Centrifuge briefly and place the PCR tube on a magnetic rack. After the solution becomes clear (2-3 minutes), discard the supernatant.

[0125] ⑤ Add 200 μL of freshly prepared 80% ethanol, incubate at room temperature for 30 seconds, discard the supernatant, and repeat the washing once;

[0126] ⑥Keep the PCR tube on the magnetic rack and dry at room temperature for 2-3 minutes;

[0127] ⑦ Remove the PCR tube and use 20 μL NF H2O for elution. C0 is directly used for subsequent PCR reaction, and C1, C2, C3, and C4 are used for BS conversion at different BS times.

[0128] 4) BS conversion (Kangwei Century, product number: CWY105M)

[0129] ① Prepare the following system in a 200 μL PCR tube:

[0130]

[0131] ② Use vortex mixing and centrifugation to react as follows: C1 sample BS 10min, C2 sample BS 30min, C3 sample BS 60min, C4 sample BS 90min (the BS time for the conversion rate to reach the standard according to the kit instructions is 60min).

[0132]

[0133] ③ Take a new 1.5mL centrifuge tube, add 600μL buffer CL, 220μL conversion product and 15μL magnetic bead solution in sequence, shake and mix well, place on a constant temperature mixer, and incubate at room temperature 25℃ 1700rpm for 10min;

[0134] ④ Centrifuge instantly, place the centrifuge tube on a magnetic rack and let it stand for 30 seconds, then discard the waste liquid;

[0135] ⑤ Add 500 μL of washing buffer WB, vortex and mix well, centrifuge instantly, place on a magnetic stand for 30 seconds, and discard the waste liquid;

[0136] ⑥ Add 200 μL of buffer DB, vortex and mix, place on a constant temperature mixer, incubate at room temperature at 1700 rpm for 15 min, centrifuge instantly, place on a magnetic stand and let stand for 30 s, and discard the waste liquid;

[0137] ⑦ Add 500 μL of washing buffer 1, vortex to mix, centrifuge briefly, place on a magnetic rack and let stand for 30 seconds, then discard the waste liquid;

[0138] ⑧ Add 500 μL of washing buffer WB, vortex and mix, centrifuge briefly, place on a magnetic rack and let stand for 30 seconds, discard the waste liquid as much as possible, and dry at room temperature for 5-10 minutes;

[0139] ⑨ Add 13 μL NF H2O water, vortex to mix, place on a constant temperature mixer, incubate at 65℃ 1700 rpm for 10 min, centrifuge briefly, place on a magnetic rack and let stand for 30 s, transfer the eluted product to a new centrifuge tube.

[0140] 5) PCR amplification to expand the BS library yield (Yisheng Biotechnology, catalog number: 12620ES96T)

[0141] ① Prepare the PCR reaction system according to the following table:

[0142]

[0143] ②After mixing, centrifuge immediately and perform PCR reaction according to the procedure in the following table:

[0144]

[0145]

[0146] ③Add 22.5 μL of balanced Hieff magnetic beads to the PCR product, vortex to mix, and incubate at room temperature for 5 minutes;

[0147] ④ Centrifuge briefly and place the PCR tube on a magnetic rack. After the solution becomes clear (2-3 minutes), discard the supernatant.

[0148] ⑤ Add 200 μL of freshly prepared 80% ethanol, incubate at room temperature for 30 seconds, discard the supernatant, and repeat the washing once;

[0149] ⑥Keep the PCR tube on the magnetic rack and dry at room temperature for 2-3 minutes;

[0150] ⑦ Remove the PCR tube and add 20 μL NF H2O for elution.

[0151] 6) Library quality control

[0152] The library concentration was determined by Qubit, as shown in the following table:

[0153] Sample No. C0 C1 C2 C3 C4 BS library yield (ng) 612 696 692 756 720

[0154] The results showed that the yield of BS library was normal and in line with expectations.

[0155] 4. Evaluation of Spike-in BS transformation in BS library

[0156] 1) The method provided by the present invention evaluates the BS conversion compliance:

[0157] ① Use hot-start Taq DNA polymerase (Sangon Biotechnology, catalog number: B600002-0200) to amplify the Spike-in sequence and prepare the reaction system according to the following table:

[0158]

[0159]

[0160] ② Amplify according to the following amplification procedure:

[0161]

[0162] ③ Take 10uL of the amplified product and perform 4% agarose gel electrophoresis. Figure 2 As shown: C0 did not meet the BS standard, UM-F primers produced bands of amplified products, MF primers did not amplify, and no amplified product bands were produced; C1 and C2 BS did not meet the standard, MF and UM-F primers both amplified and produced bands; C3 and C4 BS met the standard, MF primers amplified, and UM-F primers did not amplify.

[0163] 2) First-generation sequencing to verify BS conversion:

[0164] The first generation sequencing verified the BS conversion and obtained the conclusion consistent with the method of the present invention (see Appendix Figure 3 shown).

[0165] C0 was not BS-converted, and all non-methylated Cs were C (indicated by arrows);

[0166] The BS conversion of C1 and C2 did not reach the target, the non-methylated C was not completely converted to T, and there was a small residual C peak at the bottom (indicated by the arrow);

[0167] The BS conversion of C3 and C4 reached the target, and the unmethylated C was completely converted to T (indicated by arrows).

[0168] 3) Analysis of λDNA conversion rate in next-generation sequencing.

[0169] The conversion rate of λDNA was obtained after the BS library was analyzed by next-generation sequencing.

[0170] Calculation of λDNA conversion rate: (1) Calculate the BS conversion rate of each C site on λDNA (the number of times T is detected at this site / the total number of sequencing times for this site); (2) Calculate the average BS conversion rate of all C sites, which is the conversion rate of λDNA. The conversion rate of λDNA is shown in the following table:

[0171] Sample No. C0 C1 C2 C3 C4 λDNA conversion rate 0.2％ 92.8％ 96.9％ 99.0％ 99.6％

[0172] Combined with the analysis of the conversion rate of λDNA, the BS conversion evaluated by the method of the present invention meets the standard and is considered to be a λDNA conversion rate ≥ 99.0%.

[0173] Example 2

[0174] This example uses the Spike-in sequence and primer information of Example 1 to evaluate the DNA methylation conversion rate of normal human genomic DNA.

[0175] The 5 samples are the whole genome of a person with an input of 200ng and a Spike-in of 1ng. The mixed samples and Spike-in are numbered S1, S2, S3, S4, and S5.

[0176] During the BS library construction process, the BS processing time of all samples was set to 60 min, and the remaining steps were the same as in Example 1.

[0177] The operation process of evaluating the conversion rate of Spike in BS is the same as that of Example 1.

[0178] The results of agarose gel electrophoresis for evaluating BS conversion are shown in the attached Figure 4 As shown, the results showed that: in S1-S5, a band was produced after amplification with the M primer, but no band was produced after amplification with the UM primer.

[0179] It can be judged that after adding quality control nucleic acid molecules to the five human genomic DNA samples S1, S2, S3, S4, and S5, BS methylation libraries were constructed according to the method of the present invention, and the BS conversion rates of the quality control nucleic acid molecules in the libraries were evaluated and analyzed. The agarose electrophoresis methylated primer amplification products all had bands, and the non-methylated primer amplification products all had no bands, indicating that the BS conversion rates of the quality control nucleic acid molecules all met the standards, further indicating that the five BS methylation libraries can be subsequently sequenced. Therefore, the present invention can perform quality control on the BS methylation library at the experimental end.

[0180] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A nucleic acid molecule for evaluating or controlling DNA methylation conversion rate, characterized in that: The invention comprises: a spike in forward sequence, a methylated forward primer, a non-methylated forward primer and a reverse primer, wherein the nucleotide sequence of the methylated forward primer is: 5'-(N)nTBT-3', N is selected from G, A or T, n is 18-25, and B is T, C or G; the nucleotide sequence of the non-methylated forward primer is: 5'-(N)nCBC-3', and the (N)n sequence in the methylated forward primer is the same as the (N)n in the non-methylated forward primer; the spike in forward sequence comprises: (N)nCG / A / TC-Y-reverse complementary sequence of the reverse primer; Y represents a 70-200 bp ribonucleotide sequence; the 19th and 21st positions in the Spike in forward sequence are non-methylated C bases.

2. The nucleic acid molecule for evaluating or controlling DNA methylation conversion rate according to claim 1, characterized in that: When B in the methylated forward primer and the unmethylated forward primer is C, the Spike in forward sequence is: (N)nCAC-Y-reverse complementary sequence of the reverse primer; When B in the methylated forward primer and the unmethylated forward primer is G, the Spike in forward sequence is: (N)nCTC-Y-reverse complementary sequence of the reverse primer; When B in the methylated forward primer and the unmethylated forward primer is T, the Spike in forward sequence is: (N)nCGC-Y-reverse complementary sequence of the reverse primer; Preferably, the forward sequence of Spike in includes: GAGTATAGAGTGATAGATCGC-Y-GGGTAGTAGTGAGTAGATTGTA; Y represents a nucleotide sequence with a length of 70-200 bp; Preferably, the nucleotide sequence of the methylated forward primer is as shown in SEQ ID NO: 1, and the nucleotide sequence of the unmethylated forward primer is as shown in SEQ ID NO: 2; Preferably, the reverse primer is as shown in SEQ ID NO:

5.

3. The nucleic acid molecule for evaluating or controlling DNA methylation conversion rate according to claim 1, characterized in that: At least one of the 22nd to 150th or 22nd to 170th positions of the Spike in forward sequence is a non-methylated C base; Preferably, at least one of the 22nd to 70th positions or the 22nd to 120th positions in the forward sequence of the Spike in is a non-methylated C base; Preferably, at least one of the 58th, 65th, 67th, 71st, 74th, 80th, 83rd and 90th positions in the forward sequence of the Spike in is a non-methylated C base; Preferably, the 21st, 58th, 65th, 67th, 71st, 74th, 80th, 83rd and 90th positions in the forward sequence of the Spike in are non-methylated C bases; Preferably, the Spike in forward sequence is shown as SEQ ID NO:

3.

4. The nucleic acid molecule for evaluating or controlling DNA methylation conversion rate according to claim 1, characterized in that: The Spike in forward sequence has at least one methylated C base; Preferably, at least one G base in the forward sequence of the Spike in is preceded by a methylated C base; Preferably, at least one of the 54th, 62nd, 92nd and 96th positions in the forward sequence of the Spike in is set to a methylated C base; Preferably, the 54th, 62nd, 92nd and 96th positions in the Spike in forward sequence are methylated C bases.

5. The nucleic acid molecule for evaluating or controlling DNA methylation conversion rate according to claim 1, characterized in that: The nucleic acid molecule further comprises a Spike in reverse sequence complementary to the base of the Spike in forward sequence, and the 3' end of the Spike in reverse sequence may or may not have an A.

6. A reagent or a kit, characterized in that: It includes the nucleic acid molecule for evaluating or controlling DNA methylation conversion rate according to any one of claims 1 to 5.

7. Use of the nucleic acid molecule for DNA methylation conversion rate assessment or quality control according to any one of claims 1 to 5 or the reagent or kit according to claim 6 in DNA methylation conversion rate quality control, characterized in that: The application is not intended for the diagnosis or treatment of disease.

8. A method for evaluating or quality controlling DNA methylation conversion rate, characterized in that: It includes the following steps: S1: The sample to be tested is mixed with the annealed Spike in sequence; S2: BS library construction, including: enzyme digestion, end repair and "A" addition; methylation linker connection and purification; BS conversion, the conversion time is 30-90min; PCR amplification of the BS conversion product; methylation library purification; S3: Evaluation of Spike in BS conversion in BS library: PCR amplification is performed on the methylated library obtained in step S2 using the methylated forward primer and reverse primer described in any one of claims 1 to 5 and the unmethylated forward primer and reverse primer, respectively.

9. The method for evaluating or controlling DNA methylation conversion rate according to claim 8, characterized in that: The Spike in BS conversion evaluation includes at least one of the following methods: (1) Perform electrophoresis on the amplified product and evaluate whether the DNA methylation conversion meets the standard based on the presence or absence of bands; (2) sequencing the amplified products and evaluating the DNA methylation conversion rate based on the sequencing results; Preferably, if the electrophoresis results show that only the amplification product of the methylated forward primer has a band, while the amplification product of the non-methylated forward primer has no band, then the BS conversion rate is evaluated to be up to standard; If the electrophoresis results show that both the methylated forward primer amplification product and the non-methylated forward primer amplification product have bands; or only the non-methylated forward primer amplification product has a band, while the methylated forward primer amplification product has no band, then the BS conversion rate is assessed to be substandard.

10. The method for evaluating or controlling DNA methylation conversion rate according to claim 8, characterized in that: In the step S3, when the Spike in BS conversion is evaluated, the BS conversion time is 60-90 minutes; Preferably, the PCR amplification procedure in step S3 includes: 95°C-98°C, 1-2 min; 95°C-98°C, 10 s, 55°C, 20 s, 70°C-72°C, 20 s, 30-35 cycles; 72°C, 5 min; Preferably, the PCR amplification system comprises: 5-30 ng of BS-converted product, a methylated forward primer with a final concentration of 0.2 uM, a non-methylated forward primer with a final concentration of 0.2 uM, a reverse primer with a final concentration of 0.2 uM, dNTP with a final concentration of 0.2 mM, a DNA polymerase and a PCR buffer; Preferably, in step S1, the annealed Spike in sequence accounts for 0.5%-1% of the input mass of the sample to be tested; Preferably, in step S2, the final concentration of the methylated linker is 0.5-1 uM, preferably 0.8 uM.

Images