Molecular marker for identifying tartary buckwheat grain width, molecular marker primer group and application of molecular marker primer group

Abstract

The invention provides a molecular marker for identifying tartary buckwheat grain width, a primer group for identifying the molecular marker and application of the molecular marker. On the basis of the molecular marker, a KASP technology is utilized, and through simple experimental steps, a sample can be identified, tartary buckwheat germplasm resources with different grain widths can be rapidly and efficiently screened, the breeding efficiency of wide-grain tartary buckwheat germplasm is improved, and cultivation of large-grain high-yield tartary buckwheat varieties is accelerated.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a molecular marker for identifying the width of tartary buckwheat seeds, a molecular marker primer set and applications thereof. Background Art

[0002] Tartary buckwheat is an annual dicotyledonous plant of the Polygonaceae family, and is one of the two major cultivated species of buckwheat. Tartary buckwheat is both a medicine and food, has a short growth period, is resistant to barrenness, and has a wide adaptability. It is a major food crop and disaster relief crop in ecologically fragile areas such as the central and western regions, and has a special position in agricultural production. Compared with major crops, the research foundation of tartary buckwheat is weak and the yield level is low, which seriously restricts the development of the tartary buckwheat industry. Cultivating high-yield and high-quality new varieties is the long-term goal of tartary buckwheat breeding. As the origin of tartary buckwheat, my country has rich germplasm resources, which lays the foundation for the excavation of excellent resources.

[0003] Molecular markers are genetic markers based on nucleotide sequence variation in genetic material between biological individuals. With the rapid development of genome sequencing technology, the third-generation molecular marker technology represented by single nucleotide polymorphisms (SNP) markers has been widely used in the field of agricultural production research, such as gene positioning, germplasm resource identification and molecular marker-assisted breeding. Competitive allele-specific PCR (KASP) technology can use allele-specific fluorescence to genotype SNP markers. It has the advantages of high throughput, low cost, high specificity and wide application. Thousand-grain weight is an important component of buckwheat yield, among which the grain length and grain width, which are related to grain size, are significantly positively correlated with thousand-grain weight. Therefore, the development of KASP markers closely linked to buckwheat grain size can significantly improve breeding efficiency, which is of great significance for breeding large-grain and high-yield buckwheat varieties. Summary of the invention

[0004] In view of the defects of the prior art, the present invention provides a molecular marker for identifying the width of tartary buckwheat grains, a molecular marker primer set and its application, which can quickly screen and identify wide-grain tartary buckwheat germplasm resources and accelerate the cultivation of large-grain and high-yield tartary buckwheat varieties.

[0005] A molecular marker for identifying the grain width of tartary buckwheat, wherein the molecular marker is located at 22,515,278bp of chromosome 1 of tartary buckwheat, and the single nucleotide polymorphism is T / G. The present invention uses the molecular marker as a basis and utilizes KASP technology for genotyping.

[0006] A DNA fragment for identifying the width of tartary buckwheat seeds, wherein the nucleotide sequence of the DNA fragment is shown in SEQ ID NO.1, wherein k in the nucleotide sequence represents a T / G mutation.

[0007] A molecular marker primer set for identifying the molecular marker or the DNA fragment of the present invention, the molecular marker primer set comprising a forward primer 1 having a nucleotide sequence as shown in SEQ ID NO.2, a forward primer 2 having a nucleotide sequence as shown in SEQ ID NO.3, and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.4; and the 5' end of the nucleotide sequence of the forward primer 1 comprises a FAM fluorescent label sequence as shown in SEQ ID NO.5, and the 5' end of the nucleotide sequence of the forward primer 2 comprises a HEX fluorescent label sequence as shown in SEQ ID NO.6.

[0008] Preferably, in the molecular marker primer set, the concentrations of forward primer 1, forward primer 2 and reverse primer are all 100 μmol / L.

[0009] The molecular marker primer set is used in buckwheat breeding.

[0010] The molecular marker primer set is used in identifying the width of tartary buckwheat seeds.

[0011] Preferably, the use of the molecular marker primer set in identifying the width of tartary buckwheat seeds comprises the following steps: (1) Extract the genomic DNA of the tested buckwheat germplasm resources and adjust it to the concentration required for the machine; (2) using the genomic DNA adjusted to the upper concentration as a template, and using the molecular marker primer set to perform PCR amplification to obtain an amplified product; (3) Performing genotyping detection on the amplified product. When the genotyping result is G / G, the seed is identified as a wide-grained tartary buckwheat grain; when the genotyping result is G / T or T / T, the seed is identified as a narrow-grained tartary buckwheat grain.

[0012] Preferably, the PCR amplification is specifically as follows: The reaction system of the PCR amplification is: based on a total reaction volume of 1.6 μL, comprising 0.8 μL of genomic DNA adjusted to the upper concentration, and 0.8 μL of a mixture of 2×KASP Master mix and KASP Assay mix, wherein the volume ratio of 2×KASP Master mix to KASP Assay mix in the mixture of 2×KASP Master mix and KASP Assay mix is ​​1:1, and the KASP Assay mix is ​​a molecular marker primer set; The PCR amplification procedure is as follows: in the first stage, pre-denaturation at 94°C for 15 min, for a total of 1 cycle; in the second stage, denaturation at 94°C for 20 sec, annealing at 55-61°C for 60 sec, for a total of 10 cycles, with the temperature of each subsequent cycle being 0.6°C lower than that of the previous cycle; in the third stage, denaturation at 94°C for 20 sec, annealing at 55°C for 60 sec, for a total of 26 cycles.

[0013] Preferably, in the molecular marker primer set, the volume ratio of forward primer 1, forward primer 2, and reverse primer is 2:2:5.

[0014] Preferably, the concentration in step (1) is 5-10 ng / μL.

[0015] Advantages of the present invention: The present invention develops a molecular marker that is closely linked to the trait of tartary buckwheat grain width, and provides a KASP primer set for identifying the molecular marker. The KASP technology can be used to complete the identification of samples through simple experimental steps, so that tartary buckwheat germplasm resources with different grain widths can be screened quickly and efficiently, the breeding efficiency of wide-grain tartary buckwheat germplasm can be improved, and the cultivation of large-grain and high-yield tartary buckwheat varieties can be accelerated. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is a genotyping diagram for detecting a natural population of tartary buckwheat according to the present invention; Figure 2 It is a box plot of grain width of three genotypes of Tartary Buckwheat varieties. DETAILED DESCRIPTION

[0017] Example 1 The present invention provides a molecular marker for identifying the grain width of tartary buckwheat, wherein the molecular marker is located at 22,515,278 bp of chromosome 1 of tartary buckwheat, and the single nucleotide polymorphism is T / G. The molecular marker is obtained by genome-wide association study (GWAS). Based on the molecular marker, the present invention uses KASP technology for genotyping.

[0018] The chromosome position information of the molecular markers described in the present invention is based on the reference genome of Tartary Buckwheat "Pinku1" (https: / / www.mbkbase.org / Pinku1 / ).

[0019] A DNA fragment for identifying the width of tartary buckwheat seeds, wherein the nucleotide sequence of the DNA fragment is shown in SEQ ID NO.1, wherein k in the nucleotide sequence represents a T / G mutation.

[0020] A molecular marker primer set for identifying the molecular marker or the DNA fragment of the present invention, the molecular marker primer set comprising a forward primer 1 having a nucleotide sequence as shown in SEQ ID NO.2, a forward primer 2 having a nucleotide sequence as shown in SEQ ID NO.3, and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.4; and the 5' end of the nucleotide sequence of the forward primer 1 comprises a FAM fluorescent label sequence as shown in SEQ ID NO.5, and the 5' end of the nucleotide sequence of the forward primer 2 comprises a HEX fluorescent label sequence as shown in SEQ ID NO.6.

[0021] The nucleotide sequences SEQ ID NO.1 to 6 of the present invention are shown below: SEQ ID NO.1: 5'-tgtaccacaaacattgcttttgttggagataaaaatcaaatgttactttcttatatatttttttagtgaatgagtcagaggtcttctacatatttgaatkcact tttaataaatgtaaaatgggctagttgatattcatttgaatataatatgactcttaaattgcaagaaaaggttcgttatactctcttagaagtata-3'; where k represents the T / G mutation site; SEQ ID NO.2: 5'-gaaggtgaccaagttcatgctcagaggtcttctacatatttgaatt-3'; SEQ ID NO.3: 5'-gaaggtcggagtcaacggattcagaggtcttctacatatttgaatg-3'; SEQ ID NO.4: 5'-atatcaactagcccattttaca-3'; SEQ ID NO.5: 5'-gaaggtgaccaagttcatgct-3'; SEQ ID NO. 6: 5'-gaaggtcggagtcaacggatt-3'.

[0022] Preferably, in the molecular marker primer set, the concentrations of forward primer 1, forward primer 2 and reverse primer are all 100 μmol / L.

[0023] The molecular marker primer set is used in buckwheat breeding.

[0024] The molecular marker primer set is used in identifying the width of tartary buckwheat seeds.

[0025] Preferably, the use of the molecular marker primer set in identifying the width of tartary buckwheat seeds comprises the following steps: (1) Extract the genomic DNA of the tested buckwheat germplasm resources and adjust it to the concentration required for the machine; (2) using the genomic DNA adjusted to the upper concentration as a template, and using the molecular marker primer set to perform PCR amplification to obtain an amplified product; (3) Performing genotyping detection on the amplified product. When the genotyping result is G / G, the seed is identified as a wide-grained tartary buckwheat grain; when the genotyping result is G / T or T / T, the seed is identified as a narrow-grained tartary buckwheat grain.

[0026] Preferably, step (1) uses a plant DNA extraction kit or a conventional CTAB method to extract genomic DNA from the tested tartary buckwheat germplasm resources. The extraction is carried out using young leaves of tartary buckwheat as the material.

[0027] Preferably, the PCR amplification is specifically as follows: The reaction system for PCR amplification is: with a total reaction volume of 1.6 μL, comprising 0.8 μL of genomic DNA adjusted to the upper concentration, and 0.8 μL of a mixture of 2×KASP Master mix and KASP Assay mix, wherein the volume ratio of 2×KASP Master mix to KASP Assay mix in the mixture is 1:1, and the KASP Assay mix is ​​a molecular marker primer set, i.e., a premix of forward primer 1, forward primer 2, and reverse primer in a volume ratio of 2:2:5, wherein the concentrations of forward primer 1, forward primer 2, and reverse primer are all 100 μmol / L; the 2×KASP Master mix is ​​purchased from Shanghai Gene Co., Ltd., and the forward primer 1, forward primer 2, and reverse primer are synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0028] The procedure of the PCR amplification is: The first stage was pre-denaturation at 94°C for 15 min, for a total of 1 cycle; The second stage was denaturation at 94 °C for 20 sec and annealing at 55-61 °C for 60 sec, for a total of 10 cycles, with the temperature of each subsequent cycle decreasing by 0.6 °C compared with the previous cycle; The third stage was denaturation at 94°C for 20 sec and annealing at 55°C for 60 sec, for a total of 26 cycles.

[0029] Preferably, the concentration in step (1) is 5-10 ng / μL.

[0030] Example 2 1. Test materials 118 samples of Tartary Buckwheat germplasm resources collected from all over the country.

[0031] 2. DNA Sample Preparation The genomic DNA of the tested buckwheat varieties was extracted by CTAB extraction method and adjusted to the concentration for the machine. The specific steps are as follows: (1) Take 0.2 g of young buckwheat leaves stored in a -80°C ultra-low temperature refrigerator and quickly transfer them to a 2 mL centrifuge tube. Add a 4 mm diameter steel ball and freeze in liquid nitrogen for 5 seconds. Grind the leaves into powder using a tissue grinder. (2) Add 1 mL of CTAB extract to the centrifuge tube, incubate at 65°C for 2 hours, and g Centrifuge at 4°C for 10 minutes. (3) Transfer the supernatant to a new centrifuge tube, add an equal volume of chloroform / isoamyl alcohol (24:1) mixture, mix thoroughly, and then add 12,000× g Centrifuge at 4°C for 10 minutes. (4) Take the supernatant and transfer it to a new centrifuge tube, add 2 times the volume of anhydrous ethanol, mix well, place at -20℃ for 30min, and heat at 12,000× g Centrifuge at 4°C for 10 minutes and discard the supernatant; (5) Add 1 mL of pre-cooled (-20°C) 70% ethanol solution, shake well, rinse the precipitate, and then add 12,000 × g Centrifuge at 4°C for 10 minutes and discard the supernatant; repeat this step twice; (6) Dry at room temperature until the precipitate becomes colorless and transparent, then add 50 μL of sterile ddH2O to dissolve the DNA precipitate; (7) Use the BioDrop uLite Nucleic Acid Micro-Analyzer to measure the DNA concentration and quality of the samples to be tested, and dilute all the samples to a suitable concentration of 10 ng / μL based on the test results.

[0032] 3. Perform genotyping detection on the amplified product Primers were designed for the SNP site at 22,515,278 bp on chromosome 1 of the buckwheat genome, and PCR amplification was performed using the DNA sample prepared in the above steps as a template; The nucleotide sequences of the primers for the above PCR amplification are as follows: Forward primer 1 (SEQ ID NO. 2): 55′-gaaggtgaccaagttcatgctcagaggtcttctacatatttgaatt-3′; Forward primer 2 (SEQ ID NO. 3): 5′-gaaggtcggagtcaacggattcagaggtcttctacatatttgaatg-3′; Reverse primer (SEQ ID NO. 4): 5′-atatcaactagcccattttaca-3′; The 5' end of the nucleotide sequence of the forward primer 1 contains a FAM fluorescent label sequence (SEQ ID NO.5): 5'-gaaggtgaccaagttcatgct-3'; The 5' end of the nucleotide sequence of the forward primer 2 contains a HEX fluorescent tag sequence (SEQ ID NO.6): 5'-gaaggtcggagtcaacggatt-3'; The working concentrations of the forward primer 1, forward primer 2 and reverse primer are all 100 μmol / L; The reaction system of the above PCR amplification is as follows: (1) DNA template (10 ng / μL): 0.8 μL; (2) 2×KASP Master mix + KASP Assay mix (1:1): 0.8 μL Total reaction volume 1.6 μL; The KASP Assay mix is ​​a premixed solution in which forward primer 1, forward primer 2 and reverse primer are mixed in a volume ratio of 2:2:5; The procedure of the PCR amplification is: The first stage was pre-denaturation at 94°C for 15 min, for a total of 1 cycle; The second stage was denaturation at 94 °C for 20 sec and annealing at 55-61 °C for 60 sec, for a total of 10 cycles, with the temperature of each subsequent cycle decreasing by 0.6 °C compared with the previous cycle; The third stage was denaturation at 94°C for 20 sec and annealing at 55°C for 60 sec, for a total of 26 cycles; After the PCR amplification reaction is completed, the IntelliQube (LGC) genotyping detection platform is used to read and analyze the fluorescence data of the amplified product to obtain the FAM and HEX fluorescence values ​​of each PCR well, wherein the excitation light and emission light wavelengths of the FAM fluorescent label are 485nm and 520nm, respectively, and the excitation light and emission light wavelengths of the HEX fluorescent label are 535nm and 556nm, respectively. The detection results are as follows: Figure 1 shown.

[0033] Depend on Figure 1It can be seen that the 118 bitter buckwheat germplasm resources contain three genotypes, namely genotype G / G (blue circle; 26 resources); genotype G / T (purple circle; 79 resources); genotype T / T (red circle; 13 resources). The black circle represents NTC (negative control, using ddH2O as a template).

[0034] The Wanshen automatic seed analysis system (SC-G type) was used to perform phenotypic determination on the seeds of all buckwheat varieties (five plants were randomly selected for each variety), and the seed width data of 118 buckwheat varieties were obtained. The average value was 3.15 mm. If the seed width was higher than the average value, it was considered that the seed width of the buckwheat variety was larger, i.e., wide-grained buckwheat seeds; if the seed width was lower than the average value, it was considered that the seed width of the buckwheat variety was smaller, i.e., narrow-grained buckwheat seeds. The results of the seed phenotypic determination of the buckwheat varieties were compared with the above-mentioned KASP marker gene typing results. t The test was performed to analyze whether the difference in grain width between different genotypes of buckwheat varieties reached a significant level. The results are as follows Figure 2 As shown, * and ** represent significant differences at the 0.05 and 0.01 levels, respectively.

[0035] Depend on Figure 2 It can be seen that the average grain width of the bitter buckwheat varieties with genotype G / G is 3.40mm; the average grain width of the bitter buckwheat varieties with genotype G / T is 3.08mm; and the average grain width of the bitter buckwheat varieties with genotype T / T is 3.08mm. Figure 2 As shown in the figure, the grain width of the G / G genotype Tartary buckwheat variety is significantly larger than that of the G / T genotype and the T / T genotype. This shows that the typing quality of the KASP marker is good, and it can effectively screen out the genotype with larger grain width and complete the identification of Tartary buckwheat germplasm resources.

[0036] In summary, the KASP marker developed by the present invention can realize rapid and efficient screening of tartary buckwheat germplasm resources with different grain widths, improve the breeding efficiency of wide-grain tartary buckwheat germplasm, and has important significance in the breeding work of cultivating large-grain and high-yield tartary buckwheat varieties.

Claims

1. A molecular marker for identifying the width of buckwheat seeds, characterized in that: The molecular marker is located at 22,515,278 bp of chromosome 1 of buckwheat, and the single nucleotide polymorphism is T / G.

2. A DNA fragment for identifying the width of tartary buckwheat seeds, characterized in that: The nucleotide sequence of the DNA fragment is shown in SEQ ID NO. 1, wherein k in the nucleotide sequence represents a T / G mutation.

3. A molecular marker primer set for identifying the molecular marker according to claim 1 or the DNA fragment according to claim 2, characterized in that: The molecular marker primer set includes a forward primer 1 having a nucleotide sequence as shown in SEQ ID NO.2, a forward primer 2 having a nucleotide sequence as shown in SEQ ID NO.3, and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.4; and the 5' end of the nucleotide sequence of the forward primer 1 contains a FAM fluorescent label sequence as shown in SEQ ID NO.5, and the 5' end of the nucleotide sequence of the forward primer 2 contains a HEX fluorescent label sequence as shown in SEQ ID NO.

6.

4. The molecular marker primer set according to claim 3, characterized in that: In the molecular marker primer set, the concentrations of forward primer 1, forward primer 2 and reverse primer are all 100 μmol / L.

5. Use of the molecular marker primer set according to claim 3 or 4 in buckwheat breeding.

6. Use of the molecular marker primer set according to claim 3 or 4 in identifying the width of buckwheat seeds.

7. The use according to claim 6, characterized in that: The following steps are involved: (1) Extract the genomic DNA of the tested buckwheat germplasm resources and adjust it to the concentration required for the machine; (2) using the genomic DNA adjusted to the upper concentration as a template, and using the molecular marker primer set to perform PCR amplification to obtain an amplified product; (3) Performing genotyping detection on the amplified product. When the genotyping result is G / G, the seed is identified as a wide-grained tartary buckwheat grain; when the genotyping result is G / T or T / T, the seed is identified as a narrow-grained tartary buckwheat grain.

8. The application according to claim 7, characterized in that: The PCR amplification is specifically as follows: The reaction system of the PCR amplification is: based on a total reaction volume of 1.6 μL, comprising 0.8 μL of genomic DNA adjusted to the upper concentration, and 0.8 μL of a mixture of 2×KASP Master mix and KASP Assay mix, wherein the volume ratio of 2×KASP Master mix to KASP Assay mix in the mixture of 2×KASP Master mix and KASP Assay mix is ​​1:1, and the KASP Assay mix is ​​a molecular marker primer set; The PCR amplification procedure is as follows: in the first stage, pre-denaturation at 94°C for 15 min, for a total of 1 cycle; in the second stage, denaturation at 94°C for 20 sec, annealing at 55-61°C for 60 sec, for a total of 10 cycles, with the temperature of each subsequent cycle being 0.6°C lower than that of the previous cycle; in the third stage, denaturation at 94°C for 20 sec, annealing at 55°C for 60 sec, for a total of 26 cycles.

9. The use according to claim 8, characterized in that: In the molecular marker primer set, the volume ratio of forward primer 1, forward primer 2, and reverse primer is 2:2:

5.

10. The use according to claim 7, characterized in that: The concentration in step (1) is 5-10 ng / μL.

Images