Application of ATOH8 in preparation of tumor adjuvant therapy drug for promoting ferroptosis treatment sensitivity

Abstract

The invention relates to application of ATOH8 in preparation of a tumor adjuvant therapy drug for promoting ferroptosis treatment sensitivity. The invention finds that after exogenous direct up-regulation of ATOH8 expression, the sensitivity of tumor cells including but not limited to prostatic cancer to ferroptosis activators (including but not limited to RSL3, Erastin and the like) can be enhanced by inhibiting expression of target genes such as downstream SCD and the like. By applying the molecular mechanism of ATOH8 for promoting ferroptosis sensitivity, ATOH8 is used as a new target for preparing a new medicine for treating tumor ferroptosis, and direct and / or indirect up-regulation of ATOH8 expression can be used as a brand-new adjuvant therapy for improving the ferroptosis curative effect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of ATOH8 in the preparation of tumor auxiliary therapeutic drugs that promote ferroptosis therapeutic sensitivity. Background Art

[0002] Adjuvant tumor therapy drugs are drugs used to support and enhance the effects of primary treatments (such as surgery, radiotherapy, and chemotherapy). These drugs include immunotherapy drugs (such as PD-1 / PD-L1 inhibitors), targeted therapy drugs (such as tyrosine kinase inhibitors), hormone therapy drugs (such as tamoxifen), anti-angiogenic drugs (such as bevacizumab), and chemotherapy adjuvant drugs (such as anti-nausea drugs). They help control tumor growth, reduce side effects, and improve patients' quality of life through different mechanisms. The selection of appropriate adjuvant therapy drugs needs to be determined based on the patient's specific situation and tumor type.

[0003] Ferroptosis is an iron-dependent programmed cell death caused by the accumulation of lipid peroxides and lipid reactive oxygen species in cells. Tumor growth and metastasis can be effectively inhibited by exogenously inducing ferroptosis using ferroptosis activators. Studies have reported that the use of ferroptosis activators can effectively slow the growth and metastasis of prostate cancer, but there is also a phenomenon of tumor cells resisting ferroptosis. Studies have shown that ferroptosis can be effectively induced in liver cancer cells, thereby inhibiting tumor growth. Ferroptosis also shows significant anti-tumor effects in pancreatic cancer cells. Some breast cancer cells are sensitive to ferroptosis, and these cancer cells can be effectively killed by inducing ferroptosis. Glioblastoma has also been found to respond to ferroptosis. However, the specific mechanism of regulating ferroptosis biological responses and forming ferroptosis treatment resistance in prostate cancer cells and other tumor cells is still unclear.

[0004] ATOH8 is a member of the basic helix-loop-helix (bHLH) protein transcription factor family. ATOH8 is reported to play an important role in embryonic development, regulating the development of nerves, kidneys, pancreas, muscles, bones and cartilage. In tumors, ATOH8 is often lowly expressed, showing the characteristics of a tumor suppressor gene. Existing patent inventions CN103736103A and CN105420195A report that ATOH8 is lowly expressed in liver cancer. Overexpression of ATOH8 can inhibit the growth and migration of liver cancer cells, as well as inhibit the generation of liver cancer tumor stem cells and restore the sensitivity of cancer stem cells to traditional chemotherapy drugs such as cisplatin and 5-fluorouracil, but it has not been explained whether and how ATOH8 regulates the response of tumor cells to ferroptosis therapy. Summary of the invention

[0005] 1. Technical issues to be resolved

[0006] At present, there is a lack of relevant adjuvant therapies that can promote the efficacy of ferroptosis in tumor treatment. In view of the shortcomings of the existing technology, the present invention takes prostate cancer as an example and explores for the first time the role of ATOH8 in the preparation of tumor adjuvant therapeutic drugs that promote ferroptosis therapeutic sensitivity.

[0007] (II) Technical solution

[0008] To achieve the above objectives, the present invention is implemented through the following technical solutions:

[0009] In one aspect, the present invention provides an application of a eukaryotic cell ferroptosis-related transcription factor ATOH8 in the preparation of a tumor adjuvant therapy drug that promotes ferroptosis therapy sensitivity. The ATOH8 is upregulated, and the cDNA sequence of the ATOH8 is shown in SEQ ID NO: 1. The upregulated expression of ATOH8 is achieved by overexpressing ATOH8 or an inhibitor of the key ubiquitin ligase UBR5.

[0010] In one aspect, the present invention provides a use of an inhibitor of a key ubiquitin ligase UBR5 in the preparation of a tumor adjuvant therapeutic drug that promotes ferroptosis therapeutic sensitivity.

[0011] In one aspect, the present invention provides a pharmaceutical composition for treating prostate cancer, characterized in that the pharmaceutical composition comprises ATOH8 and a ferroptosis activator.

[0012] In one aspect, the present invention provides a pharmaceutical composition for treating prostate cancer, characterized in that the pharmaceutical composition comprises an inhibitor of UBR5 and a ferroptosis activator. The amino acid sequence of UBR5 is shown in SEQ ID NO:2.

[0013] In one aspect, the present invention provides use of the above-mentioned pharmaceutical composition in preparing a drug for treating tumors.

[0014] In one embodiment, the tumor includes prostate cancer, liver cancer, lung cancer, pancreatic cancer, breast cancer, glioblastoma, etc.

[0015] In one embodiment, the ferroptosis treatment is to administer a ferroptosis activator to the subject. The ferroptosis activator includes but is not limited to RSL3 and Erastin.

[0016] In one embodiment, the UBR5 inhibitor includes siRNA, dsRNA, miRNA, shRNA targeting the UBR5 gene, a gene editing system targeting the UBR5 gene, and / or an antibody, antigen binding fragment or other small molecule drug targeting the UBR5 protein.

[0017] In one embodiment, ATOH8 is endogenously low expressed in tumor cells including but not limited to prostate cancer. Exogenously directly upregulating its expression can enhance the sensitivity of tumor cells including but not limited to prostate cancer to ferroptosis activators (including but not limited to RSL3, Erastin, etc.) by inhibiting the expression of downstream target genes including but not limited to SCD.

[0018] In one embodiment, UBR5, a key ubiquitination ligase for protein ubiquitination degradation of ATOH8, is highly expressed in tumor cells including but not limited to prostate cancer, leading to ubiquitination degradation of ATOH8, causing ATOH8 to be endogenously low expressed in tumor cells, thereby causing tumor cells to resist ferroptosis therapy.

[0019] In one embodiment, the expression of UBR5 or its biological function is targetedly inhibited exogenously in tumor cells, and the specific methods include but are not limited to 1) using a technology for targeted knockout of UBR5 (such as the CRISP / Cas9 system); 2) using a technology for targeted knockdown of the UBR5 gene (such as expressing shRNA that targets and inhibits the expression of UBR5 through a lentiviral vector); 3) using various small molecule inhibitors that inhibit the function of UBR5 (including but not limited to the function of UBR5 in ubiquitination and degradation of ATOH8). These methods inhibit UBR5 expression, thereby maintaining the content of ATOH8 in tumor cells and retaining its function of transcriptionally inhibiting downstream target genes (including but not limited to target genes such as SCD), thereby enhancing the sensitivity of tumor cells to ferroptosis activators. On this basis, the combined use of ferroptosis activators (concentration: 10 μM) (including but not limited to RSL3, Erastin, etc.) can improve the tumor killing effect of ferroptosis therapy, and can be applied to the treatment of tumors including but not limited to prostate cancer.

[0020] (III) Beneficial effects

[0021] The present invention provides the use of ATOH8 in the preparation of a tumor adjuvant therapeutic drug that promotes ferroptosis therapeutic sensitivity. Compared with the prior art, it has the following beneficial effects:

[0022] Regarding ferroptosis therapy, a tumor treatment method different from traditional chemotherapy and radiotherapy, the present invention reveals the molecular mechanism by which the tumor suppressor gene ATOH8 regulates ferroptosis of tumor cells, and provides a new method to increase the expression level of ATOH8 in tumor cells and enhance its function as a new auxiliary therapeutic drug to promote the efficacy of ferroptosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0024] Figure 1 It was shown that overexpression of ATOH8 promoted ferroptosis of prostate cancer cells, liver cancer cells and lung cancer cells in vitro.

[0025] Figure 2 The results showed that under the treatment of ferroptosis activator RSL3, the tumor-forming ability of nude mice subcutaneously implanted with DU145 cells overexpressing ATOH8 was significantly reduced.

[0026] Figure 3 Overexpression of ATOH8 was shown to inhibit the expression of SCD in prostate cancer.

[0027] Figure 4 showed that knockdown of UBR5 promoted ferroptosis in prostate cancer in vitro.

[0028] Figure 5 Knockdown of UBR5 promotes ferroptosis sensitivity in prostate cancer cells in vivo.

[0029] Figure 6 SCD was shown to reverse the increased ferroptosis sensitivity of prostate cancer caused by ATOH8.

[0030] In the above figures, * indicates p<0.05, ** indicates p<0.01, and *** indicates p<0.001. DETAILED DESCRIPTION

[0031] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are clearly and completely described. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] The embodiments of the present invention reveal the molecular mechanism by which ATOH8 regulates the response of tumor cells to ferroptosis, indicating that directly and / or indirectly upregulating ATOH8 expression can be used to prepare related auxiliary therapeutic drugs that promote the efficacy of ferroptosis.

[0033] The technical solution in the embodiment of the present application is to solve the above technical problems, and the overall idea is as follows:

[0034] 1. The present invention first discovered that ATOH8 inhibits the transcription of SCD, a gene related to ferroptosis resistance. Since ATOH8 is in a low-expression state in tumors, the transcription of SCD increases, which in turn causes tumor cells to resist ferroptosis therapy. Therefore, the present invention provides a method for exogenously upregulating ATOH8 expression for the preparation of auxiliary drugs that promote the efficacy of ferroptosis.

[0035] 2. The present invention screened immunoprecipitated proteins that may interact with ATOH8 through mass spectrometry analysis, and found that UBR5, an E3 ubiquitin ligase, can specifically ubiquitinate and degrade ATOH8, which is in a state of high expression in tumor cells, thereby reducing the content of its substrate ATOH8. Therefore, by specifically inhibiting the expression or function of UBR5, the degradation of ATOH8 can be reduced, and the content of ATOH8 in tumor cells can be indirectly increased. Based on this, the present invention also provides a method for exogenous specific knockout / knockdown of UBR5 expression or inhibition of its function to indirectly upregulate ATOH8 expression for the preparation of auxiliary drugs that promote the efficacy of ferroptosis.

[0036] 3. The present invention also provides relevant evidence to confirm that overexpression of ATOH8 can exert a transcriptional inhibitory effect on downstream target genes, among which the target gene SCD is an important molecule known to have the effect of resisting ferroptosis.

[0037] In order to better understand the above technical solution, the above technical solution will be described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0038] Example 1: Overexpression of ATOH8 in vitro promotes ferroptosis of prostate cancer cells, liver cancer cells and lung cancer cells

[0039] (1) Construct an expression plasmid for exogenous overexpression of ATOH8.

[0040] The ATOH8 cDNA sequence (SEQ ID NO: 1) obtained by PCR was homologously recombined into the plenti vector to obtain plenti-ATOH8.

[0041] Overexpression plasmids.

[0042] (2) Production of lentivirus: The target plasmid was mixed with the viral packaging plasmid psPAX2, pMD2G (purchased from addgene, catalog number 12260, 12259) at a mass ratio of 3:2:1, and then 3 volumes of polybrene (1 μg / μl) were added, vortexed and allowed to stand for 15 min. 293T cells (purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences, catalog number: SCSP-502) were plated on a 10 cm dish and replaced with serum-free medium before transfection. After 6 h of transfection, the medium was replaced with complete medium containing 10% FBS. After 48 h, the cell supernatant was collected and centrifuged at 2000 rpm for 5 min to obtain the supernatant. After filtering with a 0.4 μM filter, the virus solution was stored in a -80°C refrigerator for subsequent use.

[0043] (3) Transfection of tumor cells: The virus solution and 10% FBSDMEM culture medium were added in a 1:1 ratio to human prostate cancer DU145 cells, liver cancer cells Hep-3B or lung cancer cells Calu-1 (purchased from Shanghai Cell Bank of Chinese Academy of Sciences, DU145 catalog number: SCSP-5024, Hep-3B catalog number: SCSP-5045, Calu-1 catalog number: TCHu192), and polybrene (millipore, TR-1003-G) with a final concentration of 8 μg / ml was added. The medium was changed after 16 hours; after 48 hours, puromycin (purchased from Biosharp, BS111) with a final concentration of 0.1 μg / ml was added for screening. After 2 weeks of screening, a stable monoclonal cell line was obtained.

[0044] (4) Determination of cell activity: Cells overexpressing ATOH8 (named ATOH8 OE cells)

[0045] The DU145 cells and the control DU145 cells (named as Vector cells) were plated into 96-well plates. After overnight attachment, gradient concentrations of RSL3 (purchased from MCE, catalog number HY-100218A) or Erastin (purchased from MCE, catalog number HY-15763) were added for treatment for 24 hours. The original culture medium was discarded, and serum-free DMEM culture medium containing 10% CCK8 (purchased from Biosharp, BS350C) was added. The reaction was carried out at 37°C for 1 hour. The absorbance was measured at 450nM with an enzyme reader, and the absorbance of the treatment group and the control group was compared to obtain the percentage of cell activity.

[0046] The results showed that the survival rate of ATOH8-overexpressing prostate cancer cells DU145 decreased from 54.6%±2.8% to 21.1%±3.8% after treatment with RSL3 (4μM) and decreased from 46.6%±3.9% to 27.7%±5.1% after treatment with Erastin (40μM) compared with the control group. The survival rate of ATOH8-overexpressing liver cancer cells Hep-3B decreased from 38.1±2.1% to 14.6±2.6% after treatment with RSL3 (4μM) and decreased from 51.9±2.4% to 28.1±1.0% after treatment with Erastin (20μM) compared with the control group. Compared with the control group, the survival rate of lung cancer cells Calu-1 overexpressing ATOH8 decreased from 47.19±1.2% to 25.14±1.1% after treatment with RSL3 (800nM), and decreased from 68.5±1.3% to 41.05±3.5% after treatment with Erastin (40μM). These experimental results suggest that overexpression of ATOH8 in a variety of tumor cells can increase the sensitivity of tumor cells to ferroptosis activators.

[0047] Example 2: Overexpression of ATOH8 promotes ferroptosis in prostate cancer in vivo

[0048] Tumor formation in nude mice: Ten male BALB / c nude mice were divided into two groups. Each group was subcutaneously injected with 3x10^6 DU145 Vector or DU145 ATOH8 OE cells and a 1:1 mixture of Matrigel (purchased from Corning, 354234). After 2 weeks, the tumor grew to 100 mm 3 The model was successfully established. In each group of nude mice, DMSO (n=5) or RSL3 (n=5) was intraperitoneally injected. The dose of RSL3 was 5 mg / kg each time, and it was injected once every other day for 14 days. After the administration, the nude mice were killed, the tumor tissues were collected, and the tumor weight was measured.

[0049] The experimental results showed that under the treatment of ferroptosis activator RSL3, the tumor-forming ability of nude mice subcutaneously implanted with DU145 cells overexpressing ATOH8 was significantly reduced (OE-ATOH8+RSL3 group). It can be seen that overexpression of ATOH8 promotes ferroptosis of prostate cancer cells.

[0050] Example 3: Overexpression of ATOH8 inhibits the expression of prostate cancer SCD

[0051] (1) The GEPIA2 online website was used to explore the relationship between ATOH8 expression and SCD expression in the TCGA prostate cancer dataset, and both showed a significant negative correlation.

[0052] (2) DU145 Vector was extracted using RNAfast200 kit (purchased from Fastagen, catalog number 220011), and total RNA of DU145 ATOH8 OE cells was reverse transcribed to obtain total cDNA as PCR template, and the mRNA expression of SCD was detected by fluorescence quantitative PCR. When DU145 cells overexpressed ATOH8, the mRNA expression of SCD was reduced.

[0053] (3) The primer sequences for related gene expression detection are shown in Table 1.

[0054] Table 1 Primer sequences for related gene expression detection

[0055] serial number name sequence SEQ ID NO:4 SCD-F CCTGGTTTCACTTGGAGCTGTG SEQ ID NO:5 SCD-R TGTGGTGAAGTTGATGTGCCAGC SEQ ID NO:6 ACTB-F CACCATTGGCAATGAGCGGTTC SEQ ID NO:7 ACTB-R AGGTCTTTGCGGATGTCCACGT

[0056] (4) RIPA with protease inhibitor (purchased from Bio-Tech, catalog number P1005)

[0057] Lysis buffer (purchased from Biyuntian, product number P0013B) was used to extract DU145 Vector, DU145

[0058] The total protein of ATOH8 OE cells was detected by western blot to detect the expression of SCD protein. When DU145 cells overexpressed ATOH8, the protein expression of SCD was reduced.

[0059] The experimental results showed that the correlation analysis results of the TCGA-PRAD database showed that ATOH8 and SCD expression were negatively correlated. In DU145 cells overexpressing ATOH8, the mRNA and protein expression levels of SCD were significantly decreased. It can be seen that overexpression of ATOH8 inhibits SCD expression.

[0060] Example 4: Knockdown of UBR5 promotes the sensitivity of prostate cancer cells to ferroptosis in vitro. (1) Construction of DU145 shUBR5 cell line: Construct shUBR5 expression plasmid, the targeting sequence is: 5'-GGATACACCTCAACTAGAACG-3'. The sequence was cloned into the plko.1 vector (purchased from Addgene, catalog number 10878). According to the method of lentivirus production in Example 1 (2), the corresponding lentivirus was produced and DU145 cells were infected. After screening with puromycin (0.1 μg / ml), a subclone cell line stably expressing sh-UBR5 was obtained, which was named DU145 sh-UBR5 cell line. The corresponding control was named DU145

[0061] sh-CTRL cell line.

[0062] (2) Determination of cell activity: UBR5 knockdown and control DU145 cells were plated into 96-well plates. After overnight adherence, gradient concentrations of RSL3 (purchased from MCE, catalog number HY-100218A) or Erastin (purchased from MCE, catalog number HY-15763) were added for 24 h, and the medium was changed.

[0063] Serum-free DMEM medium containing 10% CCK8 (purchased from Biosharp, BS350C) was used for reaction at 37°C for 1 hour. The absorbance was measured at 450 nM using an enzyme reader. The absorbance of the treatment group and the control group was compared to obtain the percentage of cell activity.

[0064] The experimental results showed that, compared with the control group, the survival rate of DU145 prostate cancer cells with UBR5 knockdown decreased from 49.5%±1.1% to 36.8%±1.0% after treatment with RSL3 (8μM); and decreased from 60.4%±1.1% to 50%±0.6% after treatment with Erastin (40μM). These results suggest that the sensitivity of DU145 cells to ferroptosis activators increases after UBR5 knockdown.

[0065] Example 5: Knockdown of UBR5 promotes the sensitivity of prostate cancer cells to ferroptosis in vivo.

[0066] Subcutaneous tumor bearing experiment in nude mice: 10 male BALB / c nude mice were divided into 2 groups, and each group was subcutaneously injected with 3x10^6 DU145 sh-CTRL or DU145 sh-UBR5 cells and a 1:1 mixture of matrix gel (purchased from Corning, 354234). After 2 weeks, the tumor grew to 100mm 3 The model was successfully established. In each group of nude mice, DMSO (n=5) or RSL3 (n=5) was intraperitoneally injected. The dose of RSL3 was 5 mg / kg each time, and it was injected once every other day for 14 days. After the administration, the nude mice were killed, the tumor tissues were collected, and the tumor weight was measured.

[0067] The experimental results showed that after nude mice were subcutaneously inoculated with DU145 cells with UBR5 knocked down and treated with the ferroptosis activator RSL3, their tumor-forming ability in vivo was significantly reduced (sh-UBR5+RSL3 group).

[0068] Example 6: Exogenous restoration of SCD expression can reverse the increased ferroptosis sensitivity of prostate cancer caused by ATOH8

[0069] (3) Construction of DU145 SCD OE and ATOH8+SCD OE cell lines: Construct an SCD expression plasmid with the sequence of SEQ ID NO: 3. The sequence was cloned into the plenti-BSD vector (purchased from Miaoling Biotechnology, item number P35168). The corresponding lentivirus was produced and infected with DU145 or DU145 ATOH8 OE cells according to the method of lentivirus production (2) in Example 1. The subclone cell line stably expressing SCD was obtained by screening with blasticidin (10 μg / ml) and named DU145 SCD OE or DU145 ATOH8+SCDOE cell line. The corresponding control was named DU145 Vector cell line.

[0070] (4) Determination of cell activity: The above cells were plated into 96-well plates and allowed to adhere overnight. RSL3 (purchased from MCE, catalog number HY-100218A) with gradient concentrations was added for 24 h. After that, the medium was changed and serum-free DMEM medium containing 10% CCK8 (purchased from Biosharp, BS350C) was added. The plates were reacted at 37°C for 1 h. The absorbance was measured at 450 nM using an ELISA reader. The absorbance of the treatment group and the control group were compared to obtain the percentage of cell activity.

[0071] The experimental results showed that when prostate cancer cells DU145 overexpressed ATOH8 and SCD, the survival rate of tumor cells increased from 22.8%±2.1% to 32.8%±2.2% after treatment with RSL3 (4μM) compared with the control group. These results suggest that SCD can restore the resistance of prostate cancer to ferroptosis.

[0072] In summary, compared with the prior art, the present invention has the following beneficial effects:

[0073] 1. The present invention first discovered that ATOH8 can inhibit the transcription of downstream ferroptosis resistance-related gene SCD, but ATOH8 is in a low expression state in tumor cells. Therefore, direct exogenous overexpression of ATOH8 can enhance the sensitivity of tumor cells to ferroptosis therapy.

[0074] 2. The present invention first discovered that the specific ubiquitination degradation of ATOH8 by UBR5 is an important reason for the low expression of ATOH8 in tumor cells. Therefore, specific knockout or knockdown of UBR5 can indirectly upregulate the content of ATOH8 in tumor cells and enhance the sensitivity of tumor cells to ferroptosis therapy.

[0075] In general, the present invention provides ATOH8 and its upstream molecules as a new target for the development of auxiliary therapeutic drugs that can effectively enhance the efficacy of tumor ferroptosis.

[0076] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of a eukaryotic cell ferroptosis-related transcription factor ATOH8 in the preparation of tumor adjuvant therapeutic drugs that promote ferroptosis therapeutic sensitivity.

2. The use according to claim 1, characterized in that: The expression of ATOH8 is upregulated by overexpressing ATOH8 or using an inhibitor of the key ubiquitination ligase UBR5.

3. Application of an inhibitor of the key ubiquitin ligase UBR5 in the preparation of tumor adjuvant therapeutic drugs that promote ferroptosis therapeutic sensitivity.

4. The use according to any one of claims 1 to 3, characterized in that The tumors include prostate cancer, liver cancer, lung cancer, pancreatic cancer, breast cancer, and glioblastoma.

5. The use according to any one of claims 1 to 3, characterized in that: The ferroptosis treatment is administering a ferroptosis activator to the subject.

6. A pharmaceutical composition for treating tumors, characterized in that: The pharmaceutical composition comprises a eukaryotic cell ferroptosis-related transcription factor ATOH8 and a ferroptosis activator, and the tumors comprise prostate cancer, liver cancer, lung cancer, pancreatic cancer, breast cancer, and glioblastoma.

7. A pharmaceutical composition for treating tumors, characterized in that: The pharmaceutical composition comprises an inhibitor of UBR5 and an activator of ferroptosis, and the tumors comprise prostate cancer, liver cancer, lung cancer, pancreatic cancer, breast cancer, and glioblastoma.

8. The pharmaceutical composition according to any one of claims 5 to 7, characterized in that The ferroptosis activators include but are not limited to RSL3 and Erastin.

9. The use according to claim 2 or 3 or the pharmaceutical composition according to claim 7, characterized in that The UBR5 inhibitors include siRNA, dsRNA, miRNA, shRNA targeting the UBR5 gene, a gene editing system targeting the UBR5 gene, and / or antibodies, antigen-binding fragments or other small molecule drugs targeting the UBR5 protein.

10. Use of the pharmaceutical composition according to claim 7 or 8 in the preparation of a drug for treating tumors, wherein the tumors include prostate cancer, liver cancer, lung cancer, pancreatic cancer, breast cancer, and glioblastoma.

Images