Dermatophagoides pteronyssinus allergen Der p1 recombinant protein, preparation method, kit and application

Abstract

The invention discloses a dermatophagoides pteronyssinus allergen Der p 1 recombinant protein, a preparation method, a kit and application, relates to the technical field of biology, and solves the technical problem that a detection result is not accurate enough when a crude extract is used for allergen detection. The method comprises the following steps: designing a pair of specific primers for amplifying Der p 1, carrying out amplification through PCR (Polymerase Chain Reaction), recovering a target band, connecting the target band with a cloning vector, converting to competent cell culture, extracting to obtain a recombinant plasmid containing a target gene, cloning the recombinant plasmid to a prokaryotic expression vector to obtain an expression vector containing the target gene, and carrying out high-throughput screening on the expression vector containing the target gene. The method comprises the following steps: transforming an expression vector containing a target gene into a host cell, inducing expression, and purifying to obtain Der p 1 recombinant protein with an amino acid sequence as shown in SEQ ID NO.1; the recombinant protein is high in biological activity, can be applied to preparation of a magnetic particle chemiluminescence detection kit, and is high in detection accuracy and good in kit stability.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a dust mite allergen Der p 1 recombinant protein, a preparation method, a kit and applications. Background Art

[0002] At present, a large number of studies around the world have confirmed that dust mites are closely related to allergic diseases such as allergic asthma, allergic rhinitis, and eczema. Dust mites are distributed in various countries around the world, and the most common types of dust mites worldwide are house dust mites and dust mites. Immunological studies have shown that class I allergen proteins are the main factors that cause dust mite allergic diseases. More than 80% of dust mite allergy patients are positive for skin prick tests and serum specific IgE tests for class I allergen proteins (dust mite class I allergen Der f 1 and house dust mite class I allergen protein Der p1).

[0003] As a safe, effective and convenient detection method, serum specific IgE detection has been widely used in the diagnosis of allergic diseases. Allergen skin prick test is the first-line detection method for allergens when type I allergic diseases are suspected. It is also often used to understand the sensitization rate and allergen change trend of people in different regions. However, it has poor repeatability, cumbersome operation, invasive examination characteristics, and is easily affected by the operator's skills. The judgment results are subjective. Therefore, a diagnostic method with good repeatability, automation, high sensitivity and strong specificity is needed clinically. Chemiluminescent immunoassay technology is a non-radioimmunoassay technology that has developed very rapidly in the past two decades. It is the latest immunoassay technology developed after enzyme immunoassay technology, radioimmunoassay technology, fluorescence immunoassay technology and time-resolved immunoassay. It is divided into enzymatic chemiluminescence and non-enzymatic chemiluminescence; magnetic particle chemiluminescence is an emerging analytical method that combines magnetic separation technology, enzymatic chemiluminescence technology and immunoassay technology. In this method, the free energy released by the chemical reaction excites intermediates, such as alkaline phosphatase-adamantane, horseradish peroxidase-luminol derivatives, etc., from the excited state back to the ground state. In this process, the intermediates release photons of equal energy levels. By quantitatively analyzing the measurement of these photons, the sensitivity and specificity of the detection are improved. On the other hand, the use of magnetic particles instead of microplates makes the method automated, avoiding the tedious manual operation and poor repeatability.

[0004] Most allergen serum specific IgE detection reagents use crude extracts, and what is measured is the "total" of IgE bound to all protein components in the allergen. Due to differences in extraction methods, post-processing and storage methods, these crude extracts may have some missing components or more impurity proteins, which can easily lead to missed detections; in addition, the crude extracts may contain substances with similar antigenic epitopes to the real allergens, and these similar antigenic epitopes can cause cross-reactions and produce false positive results; because the crude extracts contain multiple allergen components, the content of the same component in different batches of products is inconsistent, which is not conducive to controlling the batch difference of the product.

[0005] Therefore, it is necessary to develop recombinant component allergens to identify the specific IgE that causes allergic reactions, making the diagnosis of allergic diseases more accurate. Summary of the invention

[0006] The present invention aims to solve the technical problem that the detection results are not accurate enough when crude extracts are used for allergen detection. The invention aims to provide a recombinant protein of dust mite allergen Der p 1, a preparation method, a kit and an application thereof. The recombinant protein has high biological activity and can be applied to the preparation of a magnetic particle chemiluminescence detection kit. The detection accuracy is high and the kit has good stability.

[0007] The present invention is achieved through the following technical solutions.

[0008] The first object of the present invention is to provide a dust mite allergen Der p 1 recombinant protein having an amino acid sequence as shown in SEQ ID NO.1.

[0009] The second object of the present invention is to provide a method for preparing a recombinant protein of dust mite allergen Der p 1, comprising the following steps: Design a pair of specific primers for amplifying Der p 1, amplify by PCR, and recover the target band; Connect the target band to the cloning vector, transform it into competent cell culture, extract and obtain the recombinant plasmid containing the target gene; clone the recombinant plasmid into the prokaryotic expression vector to obtain the expression vector containing the target gene; The expression vector containing the target gene is transformed into a host cell, the expression is induced, and the Der p 1 recombinant protein is obtained by purification.

[0010] Furthermore, the specific primers are: The upstream primer was 5′GGATCCGAATTCCTTTTTTTTTCTTTCTCTC3′; The downstream primer was 5'GCCCAAGCTTTAATTTTTGTGAATGAATTTATTC3'.

[0011] Furthermore, the recombinant plasmid is cloned into a prokaryotic expression vector to obtain an expression vector containing the target gene, including: The sticky ends of the recombinant plasmid containing the target gene and the prokaryotic expression vector were cut by restriction endonucleases NdeⅠ and PstⅠ, respectively, and the expression vector containing the target gene was constructed under the action of T4 DNA ligase.

[0012] Furthermore, the prokaryotic expression vector adopts pET28a.

[0013] The third object of the present invention is to provide a kit, comprising the Der p 1 recombinant protein.

[0014] Furthermore, the Der p 1 recombinant protein is nitrated using a peroxynitrite solution.

[0015] Furthermore, during nitration, ONOO - The molar concentration ratio of tyrosine in the Der p 1 recombinant protein is (1-15):1, the reaction temperature is 3-5°C, and the reaction time is 100-140 minutes.

[0016] Furthermore, it includes magnetic bead reagent, biotinylated Der p 1 recombinant protein, and alkaline phosphatase-labeled mouse anti-human IgE antibody.

[0017] The fourth object of the present invention is to provide an application of a recombinant protein of dust mite allergen Der p 1 for preparing a diagnostic reagent for detecting house dust mites or a biological product for desensitization treatment.

[0018] Compared with the prior art, the present invention has the following advantages and beneficial effects: The invention performs nitration treatment on Der p 1 recombinant protein to enhance the binding ability of nitration product with specific IgE, effectively enhances the sensitivity of Der p 1 detection kit, and solves the problems of reduced immunogenicity of naturally extracted allergens and low binding ability with specific IgE after protein coupling; adopts a combination of prokaryotic expression system and nitration to enhance the IgE binding of Der p 1 recombinant protein with natural protein, can further enhance the biological activity of protein, and improve the expression yield, shorten the expression cycle, and reduce the cost; meanwhile, the invention can be applied to the preparation of magnetic particle chemiluminescence detection kit, can effectively solve the problems of large batch difference of allergen crude extracts on the market, missed detection due to lack of allergen protein components, unclear allergy components of allergic patients, etc., achieves the purpose of providing stable raw materials, reducing batch difference of kit, and clarifying specific components of dust mite allergy of patients, and the kit has high accuracy and good stability. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and should not be regarded as limiting the scope. For those of ordinary skill in the art, other relevant drawings can be obtained based on these drawings without creative work. In the drawings: Figure 1 A map of the expression vector containing the target gene; Figure 2 is the electrophoresis diagram of the recombinant purified Der p 1 recombinant protein; Figure 3 This is a linear graph showing the correlation between theoretical concentration and measured concentration. DETAILED DESCRIPTION

[0020] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments and drawings. The exemplary embodiments of the present invention and their description are only used to explain the present invention and are not intended to limit the present invention.

[0021] For the detection of allergens, currently most of the domestic methods are to detect specific IgE of crude extracts of allergens. Due to differences in extraction methods, post-processing and storage methods, these crude extracts may have some missing components or more impurity proteins, which can easily lead to missed detection; there may be substances with similar antigenic epitopes to the real allergens in the crude extracts, and these similar antigenic epitopes can cause cross-reactions and false positive results; secondly, because the crude extracts contain multiple allergen components, the content of the same component in different batches of products is inconsistent, which is not conducive to controlling the batch difference of the product. Using crude extracts for testing can only identify which allergen is sensitized, but cannot clearly identify which specific component is it. For example, when an allergic reaction occurs after eating eggs, using crude extracts for testing can only determine whether it is allergic to egg white or egg yolk, and cannot confirm which component allergen in eggs it is allergic to. Therefore, it is impossible to make constructive suggestions for the patient's diet, and it is obviously unreasonable to let the patient blindly refuse to eat. If a component kit is used, the specific component to which it is allergic can be determined, thereby providing help for the patient's diet or treatment, making clinical diagnosis more accurate.

[0022] Component allergen proteins are currently commonly prepared by natural extraction and recombinant expression. However, the extraction of natural allergens has high requirements for equipment and poor operability. In addition, since there are more than 30 types of allergen proteins in dust mites, the molecular weight of each allergen component protein is similar, the natural extraction rate and purity are low. Recombinant allergens have the advantages of simple production process, high purity and large-scale acquisition. Therefore, the recombinant Der p 1 allergen protein can solve the problem of complex and changeable dust mite allergen components, low extraction content, and uneven content due to batch differences.

[0023] Since the expression system includes eukaryotic and prokaryotic expression systems, the use of eukaryotic expression system helps the protein fold to form a three-dimensional spatial conformation, which has higher biological activity, but exogenous glycosylation leads to false positives; the use of prokaryotic expression system is less likely to have false positives, but lacks post-translational modifications, so the activity is lower.

[0024] Tyrosine in proteins is nitrated to form 3-nitrotyrosine (3-NT). Nitration of allergens will affect their immunogenicity. Nitration may lead to enhanced allergenicity of proteins that are allergens, or lead to the exposure of cellular epitopes or the generation of new epitopes.

[0025] In summary, the present invention performs nitration treatment on Der p 1 recombinant protein to enhance the binding ability of nitration product with specific IgE, effectively improves the sensitivity of Der p 1 detection kit, solves the problems of reduced immunogenicity of naturally extracted allergens, low binding ability with specific IgE after protein coupling, etc.; adopts a combination of prokaryotic expression system and nitration to enhance the IgE binding of Der p 1 recombinant protein with natural protein, can further improve the biological activity of protein, and improve expression yield, shorten expression cycle, and reduce cost; at the same time, it can be applied to the preparation of magnetic particle chemiluminescence detection kit, can effectively solve the problems of large batch difference of allergen crude extracts on the market, missed detection due to lack of allergen protein components, unclear allergic components of allergic patients, etc., to achieve the purpose of providing stable raw materials, reducing batch difference of kit, and clarifying the specific components of dust mite allergy in patients, and the kit has high accuracy and good stability.

[0026] Example 1: Synthesis of Der p 1 recombinant protein.

[0027] 1.1. PCR amplification of target gene.

[0028] A pair of primers was designed based on the full coding region sequence of the Der p 1 coding gene and the multiple cloning site, reading frame and promoter action direction on the vector of the modified recombinant expression protein:

[0029] The upstream primer was 5'GGATCCGAATTCCTTTTTTTTTCTTTCTCTCTC3', and the downstream primer was 5'GCCCAAGCTTTAATTTTTGTGAATGAATTTATTC3'.

[0030] The PCR amplification program was 94°C pre-denaturation for 5 min, 94°C denaturation for 45 s, 60°C annealing for 30 s, 72°C extension for 80 s, 30 cycles, and a final extension at 72°C for 10 min.

[0031] 1.2. Detect and recover the target band by agarose gel electrophoresis.

[0032] Preparation of 2% agarose gel: Prepare gel (2%): weigh 1.6g agarose, add 76mL ultrapure water, 4mL 5x TBE electrophoresis buffer (54g Tris, 27.5g boric acid, 40mL, 0.5mol / L EDTA, dilute to 1L), heat to dissolve. Cool to 60℃. Mix well and pour into gel. Prepare samples: add 1μL fluorescent dye to each EP tube (25μl), mix well; gel must be pre-electrophoresed for 5min before loading, then add the sample to the loading well and electrophoresed at 5V / min for 1.5h. Observe the results under UV light. Detect PCR products by electrophoresis at 120V voltage, cut off the target band, and use gel recovery kit to recover and purify PCR products for later use.

[0033] The PCR product was recovered using the QIAquick Gel Extraction Kit. The main steps are as follows: 1) Cut the PCR target band under UV light, try to complete it as quickly as possible, and remove the excess gel part of the band as much as possible; 2) Add 3 times the volume of buffer QG and warm it at 50℃ for 10 minutes to completely melt the glue. Mix it constantly until the glue is completely melted. 3) If the target fragment is less than 500 bp or greater than 4000 bp, add one volume of isopropanol and mix thoroughly; 4) Add the sample to the QIAquick purification column, centrifuge for 2 minutes, and pour out the melted gel; 5) Add 750 μL of PE buffer to the QIA quick purification column and leave it for 2-5 minutes. Centrifuge at 12000 r / min for 1 minute, pour out the eluted liquid, and centrifuge again at 12000 r / min for 2 minutes to remove the residual Z alcohol in the PE buffer; 6) Place the QIAquick purification column in a clean 1.5 mL centrifuge tube, add 50 μL buffer EB to dissolve the DNA, centrifuge at 13,000 rpm for 1 min, recover the PCR product, and store at -20°C.

[0034] 1.3. Construction of cloning vector.

[0035] The recovered target band was connected with the cloning vector pET28a at room temperature for 10 min with 1 μL each according to the instructions, and then transferred into Escherichia coli using the KCM (0.5 mol / L KCl, 0.15 mol / L CaCl2, 0.25 mol / L MgCl2) method.

[0036] 1.4. Recombinant vector transformation.

[0037] Prepare LB plates (Amp) before transformation experiments and incubate the plates at 37°C for 30 min before plating. The main steps of vector transformation are as follows: 1) Centrifuge the ligation reaction at 4°C for 16 h to pool at the bottom of the tube, take out 2 mL of the ligation reaction and add it to a centrifuge tube containing 20 μL 5x KCM and 38 mL ddH2O, then add 100 mL of competent cells and gently shake the tube to mix, and place on ice for 20 min; 2) Heat shock in a water bath at exactly 42°C for 45 seconds; 3) Quickly move the tube to an ice bath and allow the cells to cool for 2 minutes; 4) Add 450 μL of LB medium equilibrated to room temperature to each tube of ligation reaction transformed cells. Incubate at 37°C with shaking for 1 hour; 5) Apply 200 μl of each transformation medium onto an LB plate and culture at 37°C overnight; 6) Select positive clones and transfer them to new LB plates to number the colonies and perform colony PCR reaction identification or extract plasmids for preliminary identification by enzyme digestion.

[0038] 1.5 Plasmid restriction enzyme digestion identification.

[0039] The sticky ends of the recombinant plasmid containing the target gene and the expression vector pET28a were cut by restriction endonucleases NdeⅠ and PstⅠ, respectively. Under the action of T4 DNA ligase, an expression vector containing the target gene (such as Figure 1 ).

[0040] The enzyme digestion system is shown in Table 1 below.

[0041] Table 1. Enzyme digestion system

[0042] 1.6. Expression and identification of Der p 1 recombinant protein.

[0043] Pick up the E.coli RosettaBlue carrying the recombinant plasmid Der p1 TMM were inoculated into LB liquid medium (10g / L tryptone, 5g / L yeast extract, 10g / L NaCl), and cultured at 37℃ for 12h. Then, the inoculation amount was inoculated into LB liquid medium at 1% and cultured for 100min until A600 was between 0.6 and 0.7. Then, a final concentration of 0.5mmol / LIPTG inducer was added, and expression was induced at 25℃ for 5h. The cells were collected and SDS-PAGE of Der p 1 expressed protein was performed. 1.5mL of bacterial liquid was centrifuged to collect the cells, and 100μL 2x loading buffer (20g / L SDS, 500mL glycerol, 62.5mmol / L Tris-HCl (pH6.8), 20mL / L β-mercaptoethanol, 0.1g bromophenol blue, 30mmol / L NaCI, 1mmol / L EDTA) was added and mixed thoroughly. After boiling for 5min, centrifugal electrophoresis was performed at 12000r / min.

[0044] 1.7. Purification of Der p 1 recombinant protein.

[0045] The precipitate of inclusion body protein was weighed separately, and the precipitate was resuspended and dissolved with 1:10 (w / v) detergent Buffer G (50mmol Tris, 0.5mol Urea, 200mmol NaCl, 0.2% (v / v) TritonX-100, pH 8.0, stored at room temperature), centrifuged at 4°C, 11000rpm for 20min, and the precipitate was retained; the precipitate was denatured with 1:10 (w / v) inclusion body denaturant Buffer F (100mmol Tris, 6mol guanidine hydrochloride, pH 8.0, stored at room temperature) and denatured with slow magnetic stirring at room temperature for 2h; centrifuged at 4°C, 11000rpm for 20min, the supernatant was taken and filtered with a 0.45μm membrane for later use.

[0046] Flush the protein purification system with ddH2O ( Prime plus), and at the same time, exhaust the bubbles in the system; install the Ni-NTA purification column, be careful not to let bubbles enter the column, and rinse it with 5×CV (Column Volume) ddH2O at a flow rate of 5mL / min; at a flow rate of 2mL / min, 2×Buffer A (150mmol NiSO4, sterilized by 0.45μm filter membrane, stored at room temperature) is used to bind Ni2+ ions to the column; at a flow rate of 5mL / min, 5×CV ddH2O is used to rinse the column to remove non-specifically bound ions; at a flow rate of 5mL / min, 5×CV Buffer B (10mmol Imidazole, 6mol Urea, 20mmol Tris, 200mmol NaCl, pH8.0, stored at room temperature) is used to balance the column; the treated denatured sample is added at a flow rate of 1mL / min to allow the His-tagged protein to bind to the Ni-NTA column; after the protein concentration is detected, take 20μL of the sample and add 5μL 5×SDS-PAGE loading buffer, boil at 100℃ for 10min; set up the electrophoresis device; add 10μL of the treated sample to each well; 80V voltage, until the sample runs to the separation gel, then adjust to 120V until the gel indicator runs to the bottom; stain the separation gel with G-250 stain for 30min; add destaining solution until the gel background is clear and transparent, take a picture and save. The electrophoresis diagram of Der p 1 recombinant protein is shown in Figure 2 The SDS-PAGE gel formula is shown in Table 2 below.

[0047] Table 2. SDS-PAGE gel formula

[0048] Determination of protein concentration after purification: 1) Reagent preparation: according to the total volume of BCA working solution required, quantitatively take solution A: solution B = 50:1, mix well, and prepare BCA working solution; 2) Take a certain amount of BSA standard solution and dilute it to different concentrations using 0.02 M PMS; 3) Add 25 μL of standard protein solution of corresponding concentration and the sample to be tested to each ELISA well (measure twice each); 4) Add 200 μL BCA working solution to each ELISA well and mix quickly; 5) Incubate in a 37°C water bath for 30 min; 6) After cooling to room temperature, measure the A562 value of each well on an ELISA reader; 7) Draw a standard curve with the average value of A562 of each well of the standard solution as the ordinate; 8) Calculate the protein concentration of the diluted sample on the standard curve based on the average value of the sample A562. Select a sample with an appropriate dilution to calculate the final protein concentration, and then calculate the original sample protein concentration based on the dilution multiple.

[0049] Example 2: Nitrosylation of recombinant proteins.

[0050] The full sequence of the dust mite allergen Der p 1 recombinant protein consists of 320 amino acids, the relative molecular mass of the protein is about 36kDa, and the main chain (amino acid sequence 17-320) contains 21 tyrosine residues. Finally, the tyrosine-containing polypeptide and its corresponding nitrated polypeptide were selected as the target polypeptides. These target polypeptides contain the three nitration sites of Der p 1. The amino acid sequence SEQ ID NO.1 information is shown in Table 3 below, where the numbers indicate the sites of the amino acids that can be nitrated.

[0051] Table 3. Amino acid sequence of Der p 1 recombinant protein

[0052] Use peroxynitrite to nitrate the dust mite allergen protein Der p 1. First, ONOO - The solution was slowly thawed on ice, and different volumes of ONOO with a concentration of 3.45 mmol / L were added. - The solution was added to a low protein adsorption tube containing 10 μg of allergen (the concentration of Der p 1 was 1 mg / mL) to prepare ONOO - The ratio of tyrosine molar concentration in protein (ONOO - / Y) was a mixed solution of 1:1, 5:1, and 15:1. After the mixed solution was mixed, it was reacted at 4°C for 120 minutes. Finally, the protein and the nitrating agent were separated by ultrafiltration centrifugation to terminate the reaction. Der p 1 used an ultrafiltration tube with a molecular weight cutoff of 10 kDa and was washed twice with 50 mmol / L NH4HCO3 buffer solution (pH 7.5-8.5). Finally, the protein reaction product was dissolved in 20 μL NH4HCO3 buffer. The three raw materials obtained above and the raw material without nitration were labeled and tested, and the results are shown in Table 4.

[0053] Table 4. Detection data of nitrated and non-nitrated proteins

[0054] It can be seen from Table 4 that ONOO - When the molar concentration ratio of tyrosine in protein is 5:1, it is closest to the target value and has the best effect.

[0055] Example 3: Biotin conjugation of Der p 1 recombinant protein.

[0056] 3.1. Antigen dialysis.

[0057] Prepare 0.02M PBS solution and 0.02M PBS-T (wherein the concentration of Tween-20 is 1‰), dilute the Der p 1 recombinant protein after nitration treatment according to the molar concentration ratio of ONOO- to tyrosine in protein to 5:1 to 1 mg / mL, and then put it into a 3.5KD dialysis bag for dialysis using two dialysis solutions. Dialyze twice at 2-8°C, change the solution after 3 hours, and dialyze for 12 hours overnight the second time.

[0058] 3.2. Biotin coupling.

[0059] The labeling ratio was calculated according to the molar ratio of antigen to biotin, and the molar ratio of antigen to biotin was set to 1 / 5 and 1 / 20 respectively. The reaction was carried out on a blood mixer at room temperature for 60 minutes. After the reaction was completed, 1% volume of 1M Tris solution was added to the above liquid for blocking, and the blocking time was 30 minutes.

[0060] 3.3. Antigen purification.

[0061] The blocked allergens were dialyzed using the two dialysates in 3.1 for a total of two times at 2-8°C. After changing the dialysate every 3 hours, the second dialysate was performed overnight for 12 hours.

[0062] 3.4. Antigen recovery and preservation.

[0063] Take out the dialyzed allergen from the dialysis bag and measure the volume, add an equal volume of glycerol and store at -20℃.

[0064] Example 4: Der p 1-specific IgE detection kit (magnetic microparticle chemiluminescence method).

[0065] 4.1. Preparation of the test kit.

[0066] A Der p 1 specific IgE detection kit, comprising: M (magnetic beads) reagent, R1 (biotinylated Der p 1 allergen), R2 (alkaline phosphatase-labeled mouse anti-human IgE antibody) and matching calibrators and quality control products.

[0067] Preparation of the kit: M: Dilute 10 mg / mL magnetic particles to 0.2 mg / mL with 0.01 M PBS; R1: Dilute the allergen intermediate to 0.5 μg / mL with 0.01 M PBS solution; R2: Mouse anti-human IgE antibody labeled on the surface of alkaline phosphatase, diluted in MES buffer; Calibrators and quality controls: Tris buffer (pH 7.4) containing 2.5% bovine serum albumin was diluted into gradient calibrators of 0.0 IU / mL, 0.35 IU / mL, 0.70 IU / mL, 3.50 IU / mL, 17.50 IU / mL, 50.00 IU / mL, and 100.00 IU / mL (0.70 IU / mL and 17.50 IU / mL are quality control 1 and quality control 2, respectively).

[0068] In this kit, the surface of M reagent is a magnetic bead reagent coated with streptavidin. The sample to be tested is mixed with M magnetic particles and R1 biotin-labeled Der p 1 allergen and incubated. After washing, R2 alkaline phosphatase (AP)-labeled mouse anti-human IgE secondary antibody is added to react to form a solid-phase antigen-antibody-enzyme-labeled secondary antibody complex. The unbound enzyme-labeled antibody and other substances are removed by washing. The chemiluminescent substrate AMPPD is added, and the luminescent substrate emits photons under the catalysis of alkaline phosphatase. The number of photons generated is proportional to the concentration of Der p 1 in the sample.

[0069] 4.2. Test kit performance test.

[0070] 4.2.1. Linear.

[0071] The linear high-value reference was diluted to different concentrations according to a certain ratio, and each concentration was measured 3 times. The theoretical concentration and the measured concentration were fitted using the least squares method. The correlation coefficient R 2 is 0.9994, such as Figure 3 shown.

[0072] 4.2.2. Accuracy.

[0073] A high-value analyte A with a known concentration is added to a low-concentration serum B at a volume ratio of no more than 1:19 to obtain a test sample. The concentration of the test sample should be within the detection range of the reagent. The recovery rate is calculated according to the formula to be 96.32%. The recovery rate requirement is 85% to 115%. The kit meets the requirements.

[0074] 4.2.3. Precision.

[0075] The low-value reference substance (0.70 IU / mL) and the high-value reference substance (17.50 IU / mL) were used for 10 tests, and the average values ​​and coefficient of variation CV of the 10 test results were calculated. The results are shown in Table 5 below. It can be seen that the coefficient of variation CV of the kit is less than 5%, indicating that the kit has good precision and meets clinical requirements.

[0076] Table 5. Kit precision test data

[0077] 4.2.4. Stability.

[0078] The kit (M, R1, R2) was divided into 4 parts, one of which was placed at 4°C, and the other three were placed at 37°C for 1, 4, and 7 days, respectively. Three different clinical samples (i.e., P1, P2, and P3) were measured. The results are shown in Table 6. It can be seen from the table that the signal retention rate of the kit after 7 days of thermal acceleration was greater than 90%, indicating that the kit has good stability and meets clinical requirements.

[0079] Table 6. Kit stability test data

[0080] 4.2.5. Sample comparison.

[0081] The molar ratio of Der p 1 antigen to biotin was set to 1 / 5 and 1 / 20, respectively. The comparative data of dialysis using different buffers are shown in Table 7.

[0082] Table 7. Comparative data of different ratios of antigen to biotin and different dialysates

[0083] From the results in Table 7, it can be seen that the antigen obtained by nitrating the Der p 1 recombinant protein is closest to the target value when dialyzed with PBS-T buffer and the molar ratio of biotin is 1 / 5, so this condition is optimal.

[0084] The specific implementation methods described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific implementation method of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A recombinant protein of dust mite allergen Der p 1, characterized in that: It has the amino acid sequence shown in SEQ ID NO.

1.

2. A method for preparing a recombinant protein of dust mite allergen Der p 1, characterized in that: The following steps are involved: Design a pair of specific primers for amplifying Der p 1, amplify by PCR, and recover the target band; Connect the target band to the cloning vector, transform it into competent cell culture, and extract the recombinant plasmid containing the target gene; The recombinant plasmid is cloned into a prokaryotic expression vector to obtain an expression vector containing the target gene; The expression vector containing the target gene is transformed into a host cell, the expression is induced, and the Der p 1 recombinant protein is obtained by purification.

3. The method for preparing a recombinant protein of dust mite allergen Der p 1 according to claim 2, characterized in that: The specific primers are: The upstream primer was 5′GGATCCGAATTCCTTTTTTTTTCTTTCTCTC3′; The downstream primer was 5'GCCCAAGCTTTAATTTTTGTGAATGAATTTATTC3'.

4. The method for preparing a recombinant protein of dust mite allergen Der p 1 according to claim 2, characterized in that: The recombinant plasmid is cloned into a prokaryotic expression vector to obtain an expression vector containing the target gene, including: The sticky ends of the recombinant plasmid containing the target gene and the prokaryotic expression vector were cut by restriction endonucleases NdeⅠ and PstⅠ, respectively, and the expression vector containing the target gene was constructed under the action of T4 DNA ligase.

5. The method for preparing a recombinant protein of dust mite allergen Der p 1 according to any one of claims 2 to 4, characterized in that: The prokaryotic expression vector adopts pET28a. A kit comprising the Der p 1 recombinant protein according to claim 1.

7. A kit according to claim 6, characterized in that: The Der p 1 recombinant protein is nitrated using a peroxynitrite solution.

8. A kit according to claim 7, characterized in that: During nitration, ONOO in peroxynitrite solution - The molar concentration ratio of tyrosine in the Der p 1 recombinant protein is (1-15):1, the reaction temperature is 3-5°C, and the reaction time is 100-140 minutes.

9. A kit according to claim 7 or 8, characterized in that: It includes magnetic bead reagent, biotinylated Derp1 recombinant protein, and alkaline phosphatase-labeled mouse anti-human IgE antibody.

10. Use of the dust mite allergen Der p 1 recombinant protein according to claim 1 in the preparation of a diagnostic reagent for detecting house dust mites or a biological product for desensitization treatment.

Images