Base editor and construction method and application thereof

Abstract

The invention relates to the technical field of gene editing, in particular to a base editor as well as a construction method and application thereof, which are used for mutation of a specific base at a specific site in DNA (Deoxyribose Nucleic Acid) level. The ABE with higher editing specificity and low RNA / DNA off-target risk, the CBE with high editing precision and low RNA / DNA off-target risk and the ACBE tool with smaller volume are constructed by the method disclosed by the invention. The ABE tool developed in the invention has higher specificity when mediating A.T-G.C mutation, the capability of mediating C.G-T.A mutation of the ABE tool is obviously inhibited and even eliminated, and the off-target effect at RNA and DNA levels is obviously reduced and even eliminated; the CBE tool developed by the invention has higher accuracy when mediating C.G-T.A mutation, and the off-target effect of RNA (Ribonucleic Acid) and DNA (Deoxyribose Nucleic Acid) levels is obviously reduced or even eliminated; the ACBE tool developed in the invention only needs single deaminase, is smaller in volume, obviously reduces and even eliminates off-target effects at RNA and DNA levels, and has higher application value.

Description

[0001] This application is a divisional application. The application date of the parent application is October 21, 2021. The application number is 202111226226.X. The name of the invention is "Base editor and its construction method and application". Technical Field

[0002] The present invention relates to the field of gene editing technology, and in particular to a base editor and a method for constructing the same. Background Art

[0003] The new gene editing technology represented by CRISPR / Cas9 has brought changes to biomedical research. This technology makes efficient and accurate gene editing possible. Since 2016, researchers have developed a variety of DNA base editing tools that can efficiently induce precise point mutations at the DNA level, and no DNA double-strand breaks will occur in the process. There are many types of base editors that have been reported, of which the two most important are cytosine base editors (CBE, which can mediate C·G--T·A mutations) and adenine base editors (ABE, which can mediate A·T--G·C mutations). Among them, CBE is a fusion of a specific cytidine deaminase with a mutant nuclease (such as spCas9 carrying D10A or mutations, called nspCas9) and a uracil glycosylase inhibitor (UGI). The resulting fusion protein can mediate C·G--T·A mutations under the guidance of sgRNA. ABE fuses the directed-evolved Escherichia coli-derived adenosine deaminase (ecTadA*) dimer or monomer with a mutant nuclease (such as spCas9 carrying D10A or mutation, called nCas9). The resulting fusion protein can mediate A·T--G·C mutation under the guidance of sgRNA. Based on ABE and CBE, the researchers also fused a specific cytidine deaminase, a directed-evolved adenosine deaminase from Escherichia coli (ecTadA*), a mutant nuclease (such as spCas9 carrying D10A or mutation, called nCas9), and a uracil glycosylase inhibitor (UGI) to construct ACBE. The resulting fusion protein can mediate the simultaneous occurrence of C·G--T·A mutation and A·T--G·C mutation in specific sites under the guidance of sgRNA (Nat Biotechnol, 2020.38(7):861-864; BMC Biol, 2020.18(1):131; Nat Biotechnol, 2020.38(7):856-860; Nat Biotechnol, 2020.38(7):865-869). Existing ABE, CBE and ACBE tools still have shortcomings, which limits their application prospects.

[0004] In addition to A·T--G·C mutations, existing ABE tools can also mediate C·G--T·A mutations to a certain extent, which reduces the specificity and accuracy of ABE editing and is not conducive to the application of ABE (Nat Biotechnol, 2021 (https: / / doi.org / 10.1038 / s41587-021-00943-2); Nat Biotechnol, 2019.37(10):1145-1148; Nat Commun, 2020.11(1):5827). Although some researchers have constructed CBE tools that can specifically mediate TC-TT mutations through point mutations based on the characteristics of ABE tools that can mediate C·G--T·A mutations, their activity is very low and their application scenarios are limited (Nat Biotechnol, 2021, https: / / doi.org / 10.1038 / s41587-021-00943-2). In addition, the deaminases currently suitable for ABE construction are all derived from the directed evolution of Escherichia coli-derived adenosine deaminase (ecTadA*), and the types of deaminases are very limited, which also limits the diversity of ABE base editing characteristics and is not conducive to the application and promotion of tools. In addition, there is currently a lack of ABE tools that can coordinately optimize multiple aspects such as RNA / DNA off-target effects and editing accuracy.

[0005] The deaminases in existing CBE tools all belong to the cytidine deaminase family. This type of tool currently has a series of problems in base editing accuracy (activity window specificity), RNA off-target effects, and DNA off-target effects. There is still a lack of CBE tools that can synergistically optimize multiple aspects such as RNA / DNA off-target effects and editing accuracy (Nat Biotechnol, 2020. 38(5): 620-628; Nat Commun, 2020. 11(1): 2052; Nat Methods, 2020. 17(6): 600-604).

[0006] Existing ACBE tools require the simultaneous fusion of two deaminases (cytidine deaminase and directed-evolved adenosine deaminase from Escherichia coli (ecTadA*)) on nCas9, which makes the ACBE tool too large and not conducive to application (Nat Biotechnol, 2020.38(7):861-864; BMC Biol, 2020.18(1):131; Nat Biotechnol, 2020.38(7):856-860; Nat Biotechnol, 2020.38(7):865-869). Summary of the invention

[0007] In order to optimize the deficiencies of base editors ABE, CBE and ACBE, and to develop ABE with higher editing specificity and low RNA / DNA off-target risk, CBE with high editing accuracy and low RNA / DNA off-target risk, and smaller ACBE tools, the purpose of the present invention is to provide a new base editor and a construction method and application thereof, which are used for mutation of specific bases at specific sites at the DNA level.

[0008] It can achieve the conversion of C·G base pairs to T·A base pairs at specific sites on the DNA level (C·G--T·A mutation, CBE), the mutation of A·T base pairs to G·C base pairs (A·T--G·C mutation, ABE), or simultaneously achieve the conversion of C·G base pairs to T·A base pairs and A·T base pairs to G·C base pairs at specific sites (C·G--T·A and A·T--G·C simultaneous mutation, ACBE).

[0009] The present invention provides a new method for constructing an adenine base editor (ABE), a cytosine base editor (CBE) and an ACBE, so as to develop an ABE with higher editing specificity and lower RNA / DNA off-target risk, a CBE with higher editing accuracy and lower RNA / DNA off-target risk, and an ACBE tool with smaller size.

[0010] The basic principle of the present invention is to perform saturation mutation screening on key amino acid sites of adenosine deaminase (TadA-8e) from Escherichia coli after directed evolution (Nat Biotechnol, 2020.38(7):883-891). Finally, through specific point mutations or point mutation combinations, the construction of ABE, CBE and ACBE and the conversion between various base editors are realized; or mutations and systematic screening are performed on various adenosine deaminase (TadA) in nature to find new functional TadA and construct diversified ABE, CBE and ACBE.

[0011] After directed protein evolution, adenosine deaminase (ecTadA) from Escherichia coli (called ecTadA* after evolution) has the ability to deaminate adenine (A) in single-stranded DNA and achieve A·T--G·C mutation. The base editor ABE constructed on this basis can achieve A·T--G·C mutation in the target site of the genome. The researchers also found that under certain conditions, ABE can deaminate cytosine (C) in single-stranded DNA, and to a certain extent can also mediate C·G--T·A mutation, and has certain CBE functions. This ability to mediate C·G--T·A mutations increases the off-target risk of ABE tools (Nat Biotechnol, 2019.37(10):1145-1148; Nat Commun, 2020.11(1):5827). Therefore, saturation mutation screening of specific sites of adenosine deaminase (TadA) or point mutation and systematic screening of naturally occurring adenosine deaminase (TadA) can construct new ABEs, CBEs, and ACBEs. Specific point mutations or combinations of point mutations can achieve the following goals:

[0012] (1) Reduce or eliminate the ability of ABE tools to mediate C·G--T·A mutations, improve RNA off-target effects and DNA off-target effects, and enhance their safety;

[0013] (2) Convert ABE to CBE to obtain new CBE tools, which have new features different from existing tools in terms of base editing accuracy (activity window specificity), RNA off-target effects, and DNA off-target effects;

[0014] (3) Convert ABE into ACBE and construct a new type of ACBE using a single deaminase to reduce the size of ACBE and improve its base editing accuracy (activity window specificity), RNA off-target effect, and DNA off-target effect.

[0015] After systematic research and saturation screening, the inventors finally obtained ABE with higher editing specificity, CBE with high editing accuracy and low RNA / DNA off-target risk, and ACBE tool with smaller size through different point mutations at specific amino acid sites, or a combination of point mutations at multiple amino acid sites, and finally completed the present invention.

[0016] The purpose of the present invention can be achieved by the following technical solutions:

[0017] The first object of the present invention is to provide a base editor, which is a fusion protein formed by fusing a mutant TadA-X to the N-terminus, C-terminus or internal fusion site of a Cas nuclease;

[0018] Mutant TadA-X refers to a deaminase in which the 106th and 108th homologous amino acids in TadA-X are mutated to valine and asparagine, respectively;

[0019] TadA-X refers to TadA from different sources; preferably, there are multiple groups of TadA-X, and the amino acid sequences of the mutants thereof are shown in any one of SEQ ID NO.5 to SEQ ID NO.29;

[0020] The Cas nuclease is selected from the Cas9, Cas12, and Cas13 protein families. Preferably, the Cas nuclease is selected from nSpCas9 and its mutants, SaCas9 and its mutants, Cas12a and its mutants, or Cas12f and its mutants, and is further preferably nSpCas9.

[0021] In one embodiment of the present invention, the mutant TadA-X refers to a deaminase in which the amino acids homologous to the 106th and 108th amino acids of ecTadA in Q2LYC0, F2G306, G0JN58, B5ZCW4, Q1AS41, E4TTF3, Q57LE3, Q99W51, ecTadA are mutated to valine and asparagine, respectively;

[0022] The amino acid sequences of Q2LYC0, F2G306, G0JN58, B5ZCW4, Q1AS41, E4TTF3, Q57LE3, Q99W51 or ecTadA mutants are SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, and SEQ ID NO.13, respectively.

[0023] The base editor obtained above mediates A·T--G·C mutation.

[0024] In one embodiment of the present invention, the mutant TadA-X refers to a deaminase in which the amino acids 106 and 108 homologous to ecTadA in B3PCY2, A5WFT9, C1DXN9, B2UR34, R4K908, D5W8R4, and E1TAF4 are mutated to valine and asparagine, respectively;

[0025] The amino acid sequences of B3PCY2, A5WFT9, C1DXN9, B2UR34, R4K908, D5W8R4, and E1TAF4 mutants are SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, and SEQ ID NO.20, respectively.

[0026] The base editor obtained above mediates C·G--T·A mutation.

[0027] In an embodiment of the present invention, mutant TadA-X refers to a deaminase in which the amino acids homologous to ecTadA 106 and 108 are mutated to valine and asparagine, respectively, at Q13XZ4, A8F050, E8WVH3, P44931, G0EXN4, E0TBL5, A1W869, D5X1Y1, and I3YB54;

[0028] The amino acid sequences of the Q13XZ4, A8F050, E8WVH3, P44931, G0EXN4, E0TBL5, A1W869, D5X1Y1, and I3YB54 mutants are SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, and SEQ ID NO.29, respectively.

[0029] The base editors obtained above mediate A·T--G·C and C·G--T·A mutations.

[0030] In an embodiment of the present invention, an NLS sequence and a linker sequence are added to the 5' and 3' of the mutant TadA-X to obtain an NLS-mutant TadA-X-linker, and the NLS-mutant TadA-X-linker is placed at the N-terminus, C-terminus or internal fusion site of the Cas nuclease to form a fusion protein;

[0031] Among them, NLS-mutant TadA-X-linker means that TadA-8e is replaced by mutant TadA-X relative to NLS-TadA-8e-linker, and the amino acid sequence of NLS-TadA-8e-linker is shown in SEQ ID NO.4.

[0032] In an embodiment of the present invention, when the Cas nuclease is selected as nSpCas9, the fusion sites inside the nSpCas9 include fusion sites 113, 203, 312, 459, 535, 583, 687, 701, 715, 730, 770, 793, 801, 895, 905, 919, 946, 1010, 1029, 1047, 1117, 1154, 1249, and 1282;

[0033] The preferred fusion site is position 1249.

[0034] A second object of the present invention is to provide a method for constructing a base editor, characterized in that it comprises the following steps:

[0035] The mutant TadA-X was fused to different sites of the Cas nuclease to construct a base editor;

[0036] The mutant TadA-X refers to a deaminase in which the amino acids 106 and 108 homologous to ecTadA in TadA-X are mutated to valine and asparagine, respectively; there are multiple groups of TadA-X, and the amino acid sequences of the mutants are shown in any one of SEQ ID NO.5-SEQID NO.29.

[0037] In one embodiment of the present invention, NLS sequence and linker sequence may be added to the 5' and 3' ends of TadA-8e, mutant TadA-8e or mutant TadA-X, respectively.

[0038] The third object of the present invention is to provide an application of a base editor ABE, wherein the base editor ABE mediates A·T--G·C mutation;

[0039] Base editor ABE refers to a fusion protein formed by Q2LYC0, F2G306, G0JN58, B5ZCW4, Q1AS41, E4TTF3, Q57LE3, Q99W51, ecTadA and the 106th and 108th homologous amino acids of ecTadA being mutated to valine and asparagine respectively, and then being fused to the N-terminus and the 1249th fusion site of nSpCas9, wherein the amino acid sequences of Q2LYC0, F2G306, G0JN58, B5ZCW4, Q1AS41, E4TTF3, Q57LE3, Q99W51 or ecTadA mutants are SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, and SEQ ID NO.13 respectively;

[0040] Base editor ABE also refers to a fusion protein formed by the following single point mutation or combination of point mutations in amino acids in TadA-8e, in which the deaminase is placed at the N-terminus of nSpCas9 and the 1249th fusion site. This type of fusion protein only has the obvious ability to mediate A·T--G·C mutations.

[0041] The fourth object of the present invention is to provide an application of a base editor CBE, wherein the base editor CBE mediates C·G--T·A mutation;

[0042] Base editor CBE refers to a fusion protein formed by mutating the homologous amino acids at positions 106 and 108 of B3PCY2, A5WFT9, C1DXN9, B2UR34, R4K908, D5W8R4, E1TAF4 and ecTadA to valine and asparagine, respectively, and then fused to the N-terminus and the 1249th fusion site of nSpCas9, wherein the amino acid sequences of the mutants of B3PCY2, A5WFT9, C1DXN9, B2UR34, R4K908, D5W8R4, and E1TAF4 are SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, and SEQ ID NO.20, respectively.

[0043] The fifth object of the present invention is to provide an application of a base editor ACBE, wherein the base editor ACBE mediates A·T--G·C and C·G--T·A mutations;

[0044] Base editor ACBE refers to a fusion protein formed by the amino acids homologous to positions 106 and 108 of Q13XZ4, A8F050, E8WVH3, P44931, G0EXN4, E0TBL5, A1W869, D5X1Y1, and I3YB54 and ecTadA, which are mutated to valine and asparagine, respectively, and then placed at the N-terminus and the 1249th fusion site of nSpCas9, wherein the amino acid sequences of the mutants of Q13XZ4, A8F050, E8WVH3, P44931, G0EXN4, E0TBL5, A1W869, D5X1Y1, and I3YB54 are SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29.

[0045] In a sixth aspect of the present invention, adenine deaminase TadA mutant protein is provided, wherein the adenine deaminase TadA mutant protein is a non-natural protein, and the adenine deaminase TadA mutant protein refers to a deaminase in which the amino acids 106 and 108 homologous to ecTadA in TadA-X are mutated to valine and asparagine, respectively;

[0046] TadA-X refers to TadA from different sources; preferably, there are multiple groups of TadA-X mutants, and their amino acid sequences are shown in any one of SEQ ID NO.5-SEQ ID NO.29.

[0047] Furthermore, the mutant TadA-8e protein or the adenine deaminase TadA mutant protein is a monomer or a dimer.

[0048] In a seventh aspect, the present invention provides a polynucleotide encoding the fusion protein in the base editor.

[0049] Or, a polynucleotide encoding the adenine deaminase TadA mutant protein.

[0050] The eighth aspect of the present invention provides a vector containing the polynucleotide.

[0051] In the ninth aspect of the present invention, a host cell is provided, comprising the base editor, or the adenine deaminase TadA mutant protein, or the vector.

[0052] In a tenth aspect, the present invention provides a kit comprising reagents for constructing the base editor.

[0053] Compared with the prior art, the present invention has the following beneficial effects:

[0054] (1) The ABE tool developed in the present invention has higher specificity in mediating A·T--G·C mutation, and its ability to mediate C·G--T·A mutation is significantly inhibited or even eliminated.

[0055] (2) The CBE tool developed in the present invention has higher accuracy in mediating C·G--T·A mutation, and the off-target effects at the RNA and DNA levels are significantly reduced or even eliminated.

[0056] (3) The ACBE tool developed in the present invention only requires a single deaminase, which is smaller in size and has significantly reduced or even eliminated off-target effects at the RNA and DNA levels, thus having higher application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1Schematic diagram of the editing efficiency of various base editors ABEs for base A (A·T--G·C mutation) and C (C·G--T·A mutation rate) at the sgRNA-S1 site when TadA-8e is fused to different positions of the nSpCas9 protein (including N-, C-, and internal fusion sites).

[0058] Figure 2 Schematic diagram of the editing efficiency of various base editors ABEs for base A (A·T--G·C mutation) and C (C·G--T·A mutation rate) at the sgRNA-S1 site when NLS-TadA-8e-linker is fused to different positions of the nSpCas9 protein (including N-, C-, and internal fusion sites).

[0059] Figure 3 Schematic diagram of the editing efficiency (C·G--T·A mutation rate) of 1249-NLS-TadA-8e-linker and 1249-TadA-8e for the fourth base C (C4) and the sixth base C (C6) at the sgRNA-S1 site.

[0060] Figure 4 Schematic diagram of the editing efficiency of various base editors ABEs for base A (A·T--G·C mutation) and C (C·G--T·A mutation rate) at the sgRNA-1, sgRNA-18, sgRNA-PT14, sgRNA-HPE6 and sgRNA-S5 sites when different types of TadA were fused to the 1249 site of the nSpCas9 protein (the experimental results are the average of two independent biological repeat experiments).

[0061] Figure 5 Schematic diagram of the off-target effects of different types of base editors at the RNA level and DNA level (non-Cas dependent).

[0062] a. Number of AI off-targets for each base editor at the RNA level.

[0063] b. Number of CU off-targets for each base editor at the RNA level.

[0064] c. AG off-target effects of each base editor at the DNA level (non-Cas9 dependent). A total of four off-target sites R-loop 1, 2, 3, and 4 were used for detection.

[0065] d. CT off-target effects of each base editor at the DNA level (non-Cas9 dependent). A total of four off-target sites R-loop 1, 2, 3, and 4 were used for detection.

[0066] * means P < 0.05; ** means P < 0.01; *** means P < 0.001. (The results are from three independent biological replicates).

[0067] Figure 6 A schematic diagram showing the activity window of the optimized base editor for mediating C·G--T·A mutation and A·T--G·C mutation, and the base preference when mediating C·G--T·A mutation;

[0068] The figure shows the activity window of 1249-NLS-TadA-8e-linker mediating C·G--T·A mutation and A·T--G·C mutation (a) and the base preference when mediating C·G--T·A mutation (b); the activity window of 1249-NLS-TadA-8e-linker (V28G) mediating C·G--T·A mutation and A·T--G·C mutation (c) and the base preference when mediating C·G--T·A mutation (d); the activity window of 1249-NLS-TadA-8e-linker (N108Y) mediating C·G--T·A mutation and A·T--G·C mutation (e) and the base preference when mediating C·G--T·A mutation (f).

[0069] Figure 7 A schematic diagram showing the activity window of the optimized base editor for mediating C·G--T·A mutation and A·T--G·C mutation, and the base preference when mediating C·G--T·A mutation;

[0070] The figure shows the activity window of 1249-NLS-TadA-8e-linker (N46L) for mediating C·G--T·A mutation and A·T--G·C mutation (a) and its base preference when mediating C·G--T·A mutation (b); the activity window of 1249-NLS-TadA-8e-linker (N46C) for mediating C·G--T·A mutation and A·T--G·C mutation (c) and its base preference when mediating C·G--T·A mutation (d); the activity window of 1249-NLS-TadA-8e-linker (N46P) for mediating C·G--T·A mutation and A·T--G·C mutation (e) and its base preference when mediating C·G--T·A mutation (f).

[0071] Figure 8 A schematic diagram showing the activity window of the optimized base editor for mediating C·G--T·A mutation and A·T--G·C mutation, and the base preference when mediating C·G--T·A mutation;

[0072] The figure shows the activity window of 1249-NLS-TadA-8e-linker (V28G-N46L) for mediating C·G--T·A mutation and A·T--G·C mutation (a) and its base preference when mediating C·G--T·A mutation (b); the activity window of 1249-NLS-TadA-8e-linker (V28G-N46C) for mediating C·G--T·A mutation and A·T--G·C mutation (c) and its base preference when mediating C·G--T·A mutation (d); the activity window of 1249-NLS-TadA-8e-linker (V28G-N46P) for mediating C·G--T·A mutation and A·T--G·C mutation (e) and its base preference when mediating C·G--T·A mutation (f).

[0073] Fig. 9 A schematic diagram showing the activity window of the optimized base editor for mediating C·G--T·A mutation and A·T--G·C mutation, and the base preference when mediating C·G--T·A mutation;

[0074] The figure shows the activity window of 1249-NLS-TadA-8e-linker (N46C-N108Y) for mediating C·G--T·A mutation and A·T--G·C mutation (a) and its base preference when mediating C·G--T·A mutation (b); the figure shows the activity window of 1249-NLS-TadA-8e-linker (N46P-N108S) for mediating C·G--T·A mutation and A·T--G·C mutation (c) and its base preference when mediating C·G--T·A mutation (d).

[0075] Fig.10 A schematic diagram showing the activity window of the optimized base editor for mediating C·G--T·A mutation and A·T--G·C mutation, and the base preference when mediating C·G--T·A mutation;

[0076] The figure shows the activity window of 1249-NLS-TadA-8e-linker (F84M-N108Y) for mediating C·G--T·A mutation and A·T--G·C mutation (a) and its base preference when mediating C·G--T·A mutation (b); the figure shows the activity window of 1249-NLS-TadA-8e-linker (F84M-N108C) for mediating C·G--T·A mutation and A·T--G·C mutation (c) and its base preference when mediating C·G--T·A mutation (d).

[0077] Fig.11 A schematic diagram showing the activity window of the optimized base editor for mediating C·G--T·A mutation and A·T--G·C mutation, and the base preference when mediating C·G--T·A mutation;

[0078] The figure shows the activity window of 1249-NLS-Q13XZ4(VN)-linker for mediating C·G--T·A mutation and A·T--G·C mutation (a) and its base preference when mediating C·G--T·A mutation (b); the activity window of 1249-NLS-B3PCY2(VN)-linker for mediating C·G--T·A mutation and A·T--G·C mutation (c) and its base preference when mediating C·G--T·A mutation (d); the activity window of 1249-NLS-E8WVH3(VN)-linker for mediating C·G--T·A mutation and A·T--G·C mutation (e) and its base preference when mediating C·G--T·A mutation (f).

[0079] Fig.12 Schematic diagram of the activity window for optimizing base editors to mediate C·G--T·A mutation and A·T--G·C mutation;

[0080] The figure shows the activity window of 1249-NLS-B5ZCW4(VN)-linker mediated C·G--T·A mutation and A·T--G·C mutation (a); the activity window of 1249-NLS-Q57LE3(VN)-linker mediated C·G--T·A mutation and A·T--G·C mutation (b); the activity window of 1249-NLS-Q99W51(VN)-linker mediated C·G--T·A mutation and A·T--G·C mutation (c). DETAILED DESCRIPTION

[0081] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0082] Example 1

[0083] Construction of TadA-8e-based base editor ABE

[0084] It is known that ecTadA* can be placed at the N-terminus, C-terminus or internal fusion site of nSpCas9 (D10A) for the construction of functional ABE (Nat Commun, 2020.11(1):5827). In this embodiment, in order to obtain ABE tools with higher editing activity and more diverse editing windows, according to existing studies (Nat Commun, 2020.11(1):5827), TadA-8e (SEQ ID NO.1) was placed at the N-terminus, C-terminus (the C-terminus had an additional link sequence (SEQ ID NO.3)) and multiple internal fusion sites (Table 1) of SV40NLS-linker-nSpCas9-nucleoplasmin NLS (SEQ.ID NO.2, positions 2-17 in the sequence are the SV40NLS-linker sequence, positions 18-1384 correspond to the 2-1368 sequence of nSpCas9 (D10A), and positions 1385-1400 are the nucleoplasmin NLS sequence) to construct a variety of ABE tool expression vectors ABE-Internal-8e (simultaneously expressing EGFP through the 2A-EGFP element). In addition, considering that the protein linker may improve the conformation of the fusion protein after internal fusion, the applicant added NLS sequence and linker sequence to the 5' and 3' of TadA-8e to obtain NLS-TadA-8e-linker (SEQ ID NO.4), and placed them at the N-terminus and multiple internal fusion sites of nSpCas9, respectively, to construct a variety of ABE tool expression vectors ABE-Internal-8e (expressing EGFP simultaneously through the 2A-EGFP element). To evaluate the editing activity of ABE-Internal-8e, different ABE-Internal-8e were co-transfected with single guide RNA (sgRNA) (sgRNA simultaneously expressed uracil glycosylase inhibitor UGI and 2A-mCherry) into cultured 293T cells. After 72 hours of cell culture, double-positive cells expressing EGFP and mCherry were collected by FACS. The sgRNA used in this example is S1 (sequence is GAACACAAAGCATAGACTGC).

[0085] Table 1 nspCas9 fusion sites

[0086]

[0087]

[0088] The genome of the collected double-positive cells was extracted, and directional PCR was performed using primers that can specifically amplify the sgRNA-S1 site information. The PCR products were verified by Sanger sequencing to verify the editing efficiency of different ABE-Internal-8e at the S1 site. The results showed that compared with TadA-8e, NLS-TadA-8e-linker can enhance the editing activity of various ABE-Internal-8e and expand the editing window to a certain extent ( Figure 1-2 In addition, the results showed that 1249-TadA-8e and 1249-NLS-TadA-8e-linker constructed at the 1249th fusion site of nSpCas9 had certain C·G--T·A mutation activity, among which 1249-NLS-TadA-8e-linker had higher C·G--T·A mutation activity at the C4 site than 1249-TadA-8e( Figure 3 ).

[0089] Example 2

[0090] Screening of other types of TadA in nature and construction of base editors

[0091] In this embodiment, dozens of different types of TadA were screened in nature, and the amino acid sites corresponding to the 106th and 108th amino acids of ecTadA were mutated to valine and asparagine (TadA-X, SEQ ID NO.5-SEQ ID NO.29), respectively. The wild-type ecTadA (SEQ ID NO.13) with mutations at the A106V and D108N sites was used as a control. Then, TadA-8e in 1249-NLS-TadA-8e-linker was replaced with mutant TadA-X, and the 1249-TadA-X expression vector was constructed to analyze the base editing ability and characteristics of 1249-TadA-X.

[0092] To evaluate the base editing ability of 1249-TadA-X, 1249-TadA-X (which simultaneously expresses EGFP through the 2A-EGFP element) was co-transfected with a single guide RNA (sgRNA) (sgRNA simultaneously expresses uracil glycosylase inhibitor UGI and 2A-mCherry) into cultured 293T cells. After 72 hours of cell culture, double-positive cells expressing both EGFP and mCherry were collected by FACS (Scheme 1).The sgRNAs used in Scheme 1 of this embodiment are S1 (sequence: GAACACAAAAGCATAGACTGC), S18 (ACACACACACTTAGAATCTG), PT14 (sequence: TCCAAACCCATATATACAGC), HPE6 (sequence: GTATAATCCAAAGATGGTCA), S5 (GATGAGATAATGATGAGTCA) and PT14 (TCCAAACCCATATATACAGC). The results show that 1249-NLS-Q2LYC0(VN)-linker, 1249-N LS-Q13XZ4(VN)-linker, 1249-NLS-F2G306(VN)-linker, 1249-NLS-B3PCY2(VN)-linker, 1249-NLS-A8F050(N)-linker, 1249-NLS-A 5WFT9(VN)-linker,1249-NLS-G0JN58(VN)-linker,1249-NLS-B5ZCW4(VN)-linker,1249-NLS-E8WVH3(VN)-linker,1249-NLS-Q1AS 41(VN)-linker, 1249-NLS-P44931(VN)-linker, 1249-NLS-C1DXN9(VN)-linker, 1249-NLS-B2UR34(VN)-linker, 1249-NLS-G0EXN4 (VN)-linker, 1249-NLS-E4TTF3(VN)-linker, 1249-NLS-R4K908(VN)-linker, 1249-NLS-E0TBL5(VN)-linker, 1249-NLS-A1W869(VN )-linker, 1249-NLS-D5W8R4(VN)-linker, 1249-NLS-D5X1Y1(VN)-linker, 1249-NLS-I3YB54(VN)-linker, 1249-NLS-Q57LE3(VN)-linker, 1249-NLS-Q99W51(VN)-linker, 1249-NLS-E1TAF4(VN)-linker, 1249-NLS-ecTadA(VN)-linker have significant base editing activity (>10%) at at least one site.In terms of base editing specificity, 1249-NLS-B3PCY2(VN)-linker, 1249-NLS-A5WFT9(VN)-linker, 1249-NLS-C1DXN9(VN)-linker, 1249-NLS-B2UR34(VN)-linker, 1249-NLS-R4K908(VN)-linker, 1249-NLS-D5W8R4(VN)-linker, 1249-NLS-E1TAF4 (VN)-linker mainly mediates C·G--T·A mutations and is mainly used as a CBE tool; 1249-NLS-Q13XZ4(VN)-linker, 1249-NLS-A8F050(N)-linker, 1249-NLS-E8WVH3(VN)-linker, 1249-NLS-P44931(VN)-linker, 1249-NLS-G0EXN4(VN)-linker, 1249-NLS-E0TBL5(VN) -linker, 1249-NLS-A1W869(VN)-linker, 1249-NLS-D5X1Y1(VN)-linker, 1249-NLS-I3YB54(VN)-linker have the same ability to mediate A·T--G·C and C·G--T·A mutations, and have the potential to be ACBE, 1249-NLS-Q2LYC0(VN)-linker, 1249-NLS-F2G306(VN)-linker, 1249-NLS- G0JN58(VN)-linker, 1249-NLS-B5ZCW4(VN)-linker, 1249-NLS-Q1AS41(VN)-linker, 1249-NLS-E4TTF3(VN)-linker, 1249-NLS-Q57LE3(VN)-linker, 1249-NLS-Q99W51(VN)-linker, 1249-NLS-ecTadA(VN)-linker are mainly used as ABE tools (. Figure 4 ).

[0093] Example 3

[0094] Preferred tools for off-target effect analysis at the RNA level

[0095] In this embodiment, 1249-NLS-TadA-8e-linker, 1249-NLS-TadA-8e-linker (V28G), 1249-NLS-TadA-8e-linker (N46L), 1249-NLS-TadA-8e-linker (N46C), 1249-NLS-TadA-8e-linker (N46P), 1249-NLS-TadA-8e-linker (N108Y), 1249-NLS-TadA-8e-linker (V28G-N46L), 1249-NLS-TadA-8e-linker (V28G-N46P), 1249-NLS-TadA-8e-linker (V28G-N46C), 1249-NLS-TadA-8e-linker (N46P), 1249-NLS-TadA-8e-linker (N108Y), 1249-NLS-TadA-8e-linker (V28G-N46C), 1249-NLS-TadA-8e-linker (N46P), 1249-NLS-TadA-8e-linker (N108Y), 1249-NLS-TadA-8e-linker (V28G-N46C), 1249-NLS-TadA-8e-linker (N46P), 1249-NLS-TadA-8e-linker (N108Y), 1249-NLS-TadA-8e-linker (V28G-N46 N108Y), 1249-NLS-TadA-8e-linker (N46P-N108S), 1249-NLS-TadA-8e-linker (F84M-N108Y), 1249-NLS-TadA-8e-linker(F84M-N108C), 1249-NLS-Q13XZ4(VN)-linker, 1249-NLS-B3PCY2(V N)-linker, 1249-NLS-B5ZCW4(VN)-linker, 1249-NLS-E8WVH3(VN)-linker, 1249-NLS-Q57LE3(VN)-linker, 1249-NLS-Q99W51(VN)-linker, 1249-NLS-ecTadA(VN)-linker to analyze its off-target effects at the RNA level. Among them, 1249-NLS-TadA-8e-linker(8E) was used as a positive control; nCas9-D10A was used as a negative control.

[0096] To evaluate the off-target effects of each preferred tool at the RNA level, each preferred expression vector (expressing EGFP simultaneously through the 2A-EGFP element) was co-transfected with a single guide RNA (sgRNA) (sgRNA simultaneously expressed the uracil glycosylase inhibitor UGI and 2A-puromycin) into cultured 293T cells. Puromycin was added 24 hours after transfection to select positive cells. After 48 hours of puromycin treatment, cells were collected to extract total RNA for RNA-seq experiments. The sgRNA used in this protocol is sg-RNF (sequence GTCATCTTAGTCATTACCTG).

[0097] RNA editing refers to the process of changing genetic information at the mRNA level. Specifically, it refers to the deletion, insertion or chemical modification of nucleotides in mRNA molecules. This modification affects gene expression, the production of different amino acids and the formation of open reading frames. In mammalian cells, there are two main types of RNA editing, namely AI editing and CU editing. This RNA editing is mediated by RNA-dependent adenine deaminase.

[0098] We first analyzed the AI ​​editing results and found that the TadA-8e* point mutation significantly reduced the off-target effect of 1249-NLS-TadA-8e-linker at the RNA level. After the point mutation, the off-target effect at the RNA level was similar to that of the background (NC, transfection of sgRNA only) and the negative control group (Cas9-D10A+sgRNA). In addition, among other newly screened functional TadA-based base editors, the off-target effects of 1249-NLS-B5ZCW4(VN)-linker and 1249-NLS-B3PCY2(VN)-linker at the RNA level were similar to those of the background and negative controls, while the off-target effects of 1249-NLS-Q13XZ4(VN)-linker, 1249-NLS-ecTadA(VN)-linker, 1249-NLS-Q57LE3(VN)-linker and 1249-NLS-E8WVH3(VN)-linker at the RNA level were slightly higher than those of the background and negative controls, but significantly lower than those of 1249-NLS-TadA-8e-linker. The off-target effect of 1249-NLS-Q99W51(VN)-linker at the RNA level was significantly higher than that of 1249-NLS-TadA-8e-linker( Figure 5 a).

[0099] The results of CU editing at the RNA level showed that each sample group was similar to the background (NC, transfected with sgRNA only) and the negative control group (Cas9-D10A+sgRNA), with no significant increase ( Figure 5 b).

[0100] Example 4

[0101] Analysis of off-target effects of some tools at the DNA level (non-Cas-dependent off-target effects)

[0102] In this embodiment, 1249-NLS-TadA-8e-linker (V28G), 1249-NLS-TadA-8e-linker (N46L), 1249-NLS-TadA-8e-linker (N46C), 1249-NLS-TadA-8e-linker (N46P), 1249-NLS-TadA-8e-linker (N108Y), 1249-NLS-TadA-8e-linker (V28G-N46L), 1249-NLS-TadA-8e-linker (V28G-N46P), 1249-NLS-TadA-8e-linker (V28G-N46C), 1249-NLS-TadA-8e-linker (N46C-N108Y) are preferred. , 1249-NLS-TadA-8e-linker(N46P-N108S), 1249-NLS-TadA-8e-linker(F84M-N108Y), 1249-NLS-TadA-8e-linker(F84M-N108C), 1249-NLS-Q13XZ4(VN)-linker, 1249-NLS-B3PCY2(VN)-linker, 1249-NLS-B5ZCW4(VN)-linker, 1249-NLS-E8WVH3(VN)-linker, 1249-NLS-Q57LE3(VN)-linker, 1249-NLS-Q99W51(VN)-linker to analyze their off-target effects at the DNA level (non-Cas-dependent off-target effects). 1249-NLS-TadA-8e-linker (8e) was also selected as a control.

[0103] Off-target effects at the DNA level (non-Cas-dependent off-target effects) are analyzed by R-Loop experiments [8]. The basic principle is that dSaCas9 and sasgRNA (sasgRNA-X) targeting a specific genomic site (site X) are co-expressed in cells, inducing the formation of a single-stranded DNA (ssDNA) region at site X; at this time, the co-expressed base editor (ABE or CBE) in the cell may bind to ssDNA and mediate C·G--T·A (CBE) or A·T--G·C (ABE) mutations due to its own affinity for ssDNA.

[0104] After the human HEK293T cell line was revived and cultured, it was plated in 12-well plates at a density of 30%-50%. After 24 hours, liposomes were used to co-transfect the preferred expression vectors of the base editor (simultaneously expressing EGFP through the 2A-EGFP element) and the inactivated SaCas9 (dSaCas9)-sasgRNA co-expression vector (simultaneously expressing red fluorescent protein). After 72 hours of culture, the cells were harvested by trypsin digestion, double-positive cells were sorted by flow cytometry, and the genome was extracted by lysing the cells with lysis buffer. After that, primers were designed for directional amplification of the sasgRNA site. The amplified products were purified and deeply sequenced, and data analysis was performed to understand the AG and CT mutation frequencies at the sasgRNA site. In the study, four different sasgRNA off-target sites (sasgRNA-1~6) were selected for off-target effect analysis at the DNA level (non-Cas-dependent off-target effects).

[0105] The results of AG mutation efficiency showed that the base editing efficiency of 1249-NLS-TadA-8e-linker (8e) at the four sites of sasgRNA-1, 2, 4, and 6 was <8% (the editing efficiency is the sum of the AG mutation frequencies of all off-target sites), indicating that its off-target effect at the DNA level (non-Cas-dependent off-target effect) is very low. Compared with 1249-NLS-TadA-8e-linker (8e), 1249-NLS-TadA-8e-linker (V28G), 1249-NLS-TadA-8e-linker (N46L), 1249-NLS-TadA-8e-linker (N46C), 1249-NLS-TadA-8e-linker (N46P), 1249-NLS-TadA-8e-linker (N108 Y), 1249-NLS-TadA-8e-linker (V28G-N46L), 1249-NLS-TadA-8e-linker (V28G-N46P), 1249-NLS-TadA-8e- linker(V28G-N46C), 1249-NLS-TadA-8e-linker(N46C-N108Y), 1249-NLS-TadA-8e-linker(N46P-N108S), 1 249-NLS-TadA-8e-linker(F84M-N108Y), 1249-NLS-TadA-8e-linker(F84M-N108C), 1249-NLS-Q13XZ4(VN) -linker, 1249-NLS-B3PCY2(VN)-linker, 1249-NLS-B5ZCW4(VN)-linker, 1249-NLS-E8WVH3(VN)-linker, 1 Point mutations such as 249-NLS-Q57LE3(VN)-linker and 1249-NLS-Q99W51(VN)-linker can significantly reduce the off-target effects at the DNA level of the four sites of sasgRNA-1, 2, and 4 (non-Cas-dependent off-target effects); at the sasgRNA-6 site, the off-target effects at the DNA level of the above base editors (non-Cas-dependent off-target effects) are also lower than 8e, and the AG base editing efficiencies at the four off-target sites 1, 2, 4, and 6 are all <4% ( Figure 5 c).

[0106] Analysis of CT mutation efficiency showed that except for V28G-N46C at the sasgRNA-6 site, which had a mutation efficiency of nearly 4%, the CT mutation efficiencies of the other base editors at the four sites were all <2% ( Figure 5 d).

[0107] The results of DNA off-target effect analysis showed that base editors constructed with point mutations and new TadA deaminase had a low level of non-Cas-dependent off-target effects and significantly improved safety.

[0108] Example 5 Optimizing the activity window and base preference of base editors

[0109] In this embodiment, 1249-NLS-TadA-8e-linker, 1249-NLS-TadA-8e-linker(V28G), 1249-NLS-TadA-8e-linker(N46L), 1249-NLS-TadA-8e-linker(N46C), 1249-NLS-TadA-8e-linker(N46P), 1249-NLS -TadA-8e-linker(N108Y)、1249-NLS-TadA-8e-linker(V28G-N46L)、1249-NLS-TadA-8e-linke r(V28G-N46P), 1249-NLS-TadA-8e-linker(V28G-N46C), 1249-NLS-TadA-8e-linker(N46C-N10 8Y), 1249-NLS-TadA-8e-linker (N46P-N108S), 1249-NLS-TadA-8e-linker (F84M-N108Y), 1249 -NLS-TadA-8e-linker(F84M-N108C), 1249-NLS-Q13XZ4(VN)-linker, 1249-NLS-B3PCY2(VN)-l Inker, 1249-NLS-B5ZCW4(VN)-linker, 1249-NLS-E8WVH3(VN)-linker, 1249-NLS-Q57LE3(VN)-linker, and 1249-NLS-Q99W51(VN)-linker were used to analyze their activity window and base preference, and 1249-NLS-TadA-8e-linker (8e) was selected as a control.

[0110] In order to systematically analyze the activity window and base preference of base editors, 12 sgRNAs (S18 sequence: ACACACACACTTAGAATCTG; HEK4 sequence: GGCACTGCGGCTGGAGGTGG; ZSCAN2 sequence: GTGCGGCAAGAGCTTCAGCC; AAVS1 sequence: GACCCTCAGCCGTGCTGCTC; FAN3 sequence: CGCCGTCTCCAAGGTGAAAG; EMX sequence: GAGTCCGAGCAGAAGAAGAA; MSKC sequence: CGTCGCCGATCTTCACAGGG; PT14 sequence: TCCAAACCCATATATACAGC; RNF sequence: GTCATCTTAGTCATTACCTG; S1 sequence: GAACACAAAGCATAGACTGC; sgB sequence: AGAGCCCCCCCTCAAAGAGA; UBE3A sequence: GTACAGTTAGTACTCAGCAG) were selected for related research. The 1249-NLS-TadA-8e-linker mutant (which simultaneously expresses EGFP through the 2A-EGFP element) was co-transfected with a single guide RNA (sgRNA) (which simultaneously expresses the uracil glycosylase inhibitor UGI and 2A-mCherry) into cultured 293T cells. After 72 hours of cell culture, double-positive cells expressing both EGFP and mCherry were collected by FACS (Scheme 1).

[0111] The cell-extracted genome was collected and directional PCR was performed using primers that can specifically amplify the target sgRNA site information. The PCR products were sequenced by amplicon to analyze the activity window and base preference of the preferred base editor (n = 3 biological replicates).

[0112] The results showed that 1249-NLS-TadA-8e-linker has the ability to mediate C·G--T·A mutation (CBE activity) and A·T--G·C mutation (ABE activity), but its ABE activity is significantly higher than its CBE activity. The ABE activity window of 1249-NLS-TadA-8e-linker is A2-A14 (PAM is 21-23), and the CBE activity window is (C4-C7) ( Figure 6 a). The CBE activity of 1249-NLS-TadA-8e-linker showed base preference, and its preference for different base sites was CA≈CT>CG≈CC, AC≈TC>GC≈CC( Figure 6 b).

[0113] Different point mutations of TadA-8e have an impact on its base editing activity and base preference. For single point mutations, after the V28G point mutation, the CBE activity of 1249-NLS-TadA-8e-linker (V28G) is higher than the ABE activity, and the CBE activity window is (C4-C7), and the ABE activity window is A5 ( Figure 6 c). Its preference for different base sites is CA≈CT>CG≈CC, AC≈TC>CC>GC( Figure 6 d). The CBE activity of 1249-NLS-TadA-8e-linker (N108Y) is similar to the ABE activity, where the CBE activity window is (C4-C7) and the ABE activity window is (A5-A7) ( Figure 6 e). Its preference for different base sites is CT≈CA≈CC>CG, TC>AC>CC≈GC ( Figure 6 f). 1249-NLS-TadA-8e-linker (N46L) has almost no ABE activity, and its CBE activity window is (C4-C8) ( Figure 7 a). Its preference for different base sites is CG>CA≈CC≈CT, CC≈TC>GC≈AC( Figure 7 b). The CBE activity of 1249-NLS-TadA-8e-linker (N46C) is similar to the ABE activity, where the CBE activity window is (C4-C8) and the ABE activity window is (A5-A7) ( Figure 7 c). Its preference for different base sites is CT≈CA≈CC>CG, CC≈TC>GC≈AC ( Figure 7 d). 1249-NLS-TadA-8e-linker (N46P) has only CBE activity, and the activity window is (C4-C8) ( Figure 7 e). Its preference for different base sites is CC≈TC>GC≈AC( Figure 7 f).

[0114] For the double-point mutation, the ABE activity of 1249-NLS-TadA-8e-linker (V28G-N46L) is very low, and the CBE activity window is (C4-C8) ( Figure 8 a), its preference for different base sites is CG≈CT≈CA>CC, TC≈CC>GC≈AC( Figure 8 b). The ABE activity of 1249-NLS-TadA-8e-linker (V28G-N46C) is very low, and the CBE activity window is (C4-C9) ( Figure 8 c), its preference for different base sites is TC≈CC≈AC>GC( Figure 8d). The ABE activity of 1249-NLS-TadA-8e-linker (V28G-N46P) is very low, and the CBE activity window is (C4-C8) ( Figure 8 e), its preference for different base sites is CT≈CG≈CA>CC, TC≈CC>GC≈AC( Figure 8 f). The ABE and CBE activities of 1249-NLS-TadA-8e-linker (N46C-N108Y) are both very low, with the ABE activity window at A5 and the CBE activity window at C4-C6 ( Fig. 9 a). Its preference for different base sites is CA≈CT>CC≈CG, AC≈TC>CC≈GC( Fig. 9 b). The CBE activity of 1249-NLS-TadA-8e-linker (N46P-N108S) is significantly higher than the ABE activity. The ABE activity window is A5, and the CBE activity window is C4-C9 ( Fig. 9 c), which has no obvious base preference ( Fig. 9 d). The ABE activity of 1249-NLS-TadA-8e-linker (F84M-N108Y) is similar to that of CBE. The activity window of ABE is A5-A7, while that of CBE is C4-C7 ( Fig.10 a), its preference for different base sites is CT≈CA≈CC>CG, TC≈AC>CC≈GC( Fig.10 b). The activity of ABE of 1249-NLS-TadA-8e-linker (F84M-N108C) is significantly higher than that of CBE. The activity window of ABE is A5-A7, while that of CBE is C4-C7 ( Fig.10 c). Its preference for different base sites is CA≈CT>CC≈CG, AC≈TC>CC≈GC ( Fig.10 d).

[0115] In summary, different point mutations in TadA-8e will significantly change the base editing activity and preference of 1249-NLS-TadA-8e-linker, and the effects of different point mutations on ABE and CBE activities are significantly different.

[0116] For base editors derived from TadA homologous proteins, the CBE activity of 1249-NLS-Q13XZ4(VN)-linker is significantly higher than the ABE activity. The CBE activity window is C4-6, and the ABE activity window is A5, A7 ( Fig.11 a). Its preference for different base sites is CA≈CT>CC≈CG, AC≈TC>CC≈GC( Fig.11b). The ABE activity of 1249-NLS-B3PCY2(VN)-linker is very low, and the CBE activity window is C4-7 ( Fig.11 c). Its preference for different base sites is that it has high editing activity at CT / AC sites and very low editing activity at CG / GC sites ( Fig.11 d). 1249-NLS-E8WVH3(VN)-linker has similar ABE and CBE activities, with the CBE activity window being C4-6 and the ABE activity window being A3-7 ( Fig.11 e). Its preference for different base sites is CA≈CT>CC>CG, AC>TC≈CC≈GC( Fig.11 f). The CBE activity of 1249-NLS-B5ZCW4(VN)-linker is very low, and the ABE activity window is A5-7 ( Fig.12 a) The CBE activity of 1249-NLS-Q57LE3(VN)-linker is very low, and the ABE activity window is A5. Fig.12 b), the CBE and ABE activities of 1249-NLS-Q99W51(VN)-linker are both very low, with the CBE activity window at C5 and the ABE activity window at A3 and A5 ( Fig.12 c)

[0117] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A base editor, characterized in that A fusion protein formed by fusion of the mutant TadA-X to the N-terminus, C-terminus or internal fusion site of the Cas nuclease; Mutant TadA-X refers to a deaminase in which the amino acids 106 and 108 homologous to ecTadA in TadA-X are mutated to valine and asparagine, respectively; TadA-X refers to TadA from different sources; Preferably, there are multiple groups of TadA-X, and the amino acid sequences of the mutants thereof are shown in any one of SEQ ID NO.5 to SEQ ID NO.29; The Cas nuclease is selected from the Cas9, Cas12, and Cas13 protein families. Preferably, the Cas nuclease is selected from nSpCas9 and its mutants, SaCas9 and its mutants, Cas12a and its mutants, or Cas12f and its mutants, and is further preferably nSpCas9.

2. The base editor according to claim 1, characterized in that Mutant TadA-X refers to deaminases in which the amino acids homologous to ecTadA 106 and 108 in Q2LYC0, F2G306, G0JN58, B5ZCW4, Q1AS41, E4TTF3, Q57LE3, Q99W51, and ecTadA are mutated to valine and asparagine, respectively; The amino acid sequences of Q2LYC0, F2G306, G0JN58, B5ZCW4, Q1AS41, E4TTF3, Q57LE3, Q99W51 or ecTadA mutants are SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQID NO.10, SEQ ID NO.11, SEQ ID NO.12, and SEQ ID NO.13, respectively.

3. The base editor according to claim 1, characterized in that Mutant TadA-X refers to deaminases in which the amino acids 106 and 108 homologous to ecTadA in B3PCY2, A5WFT9, C1DXN9, B2UR34, R4K908, D5W8R4, and E1TAF4 are mutated to valine and asparagine, respectively; The amino acid sequences of B3PCY2, A5WFT9, C1DXN9, B2UR34, R4K908, D5W8R4, and E1TAF4 mutants are SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, and SEQ ID NO.20, respectively.

4. The base editor according to claim 1, characterized in that Mutant TadA-X refers to a deaminase in which the amino acids 106 and 108 homologous to ecTadA at Q13XZ4, A8F050, E8WVH3, P44931, G0EXN4, E0TBL5, A1W869, D5X1Y1, and I3YB54 are mutated to valine and asparagine, respectively; The amino acid sequences of the Q13XZ4, A8F050, E8WVH3, P44931, G0EXN4, E0TBL5, A1W869, D5X1Y1, and I3YB54 mutants are SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, and SEQ ID NO.29, respectively.

5. The base editor according to claim 1, 2, 3 or 4, characterized in that: After adding NLS sequence and linker sequence to the 5' and 3' of mutant TadA-X, respectively, NLS-mutant TadA-X-linker is obtained, and the NLS-mutant TadA-X-linker is placed at the N-terminus, C-terminus or internal fusion site of Cas nuclease to form a fusion protein; Among them, NLS-mutant TadA-X-linker means that TadA-8e is replaced by mutant TadA-X relative to NLS-TadA-8e-linker, and the amino acid sequence of NLS-TadA-8e-linker is shown in SEQ ID NO.

4.

6. The base editor according to claim 1, 2, 3 or 4, characterized in that: When the Cas nuclease is selected as nSpCas9, the fusion sites inside the nSpCas9 include fusion sites 113, 203, 312, 459, 535, 583, 687, 701, 715, 730, 770, 793, 801, 895, 905, 919, 946, 1010, 1029, 1047, 1117, 1154, 1249, and 1282; The preferred fusion site is position 1249.

7. A method for constructing a base editor, characterized in that: The following steps are involved: The mutant TadA-X was fused to different sites of the Cas nuclease to construct a base editor; Mutant TadA-X refers to a deaminase in which the amino acids 106 and 108 homologous to ecTadA in TadA-X are mutated to valine and asparagine, respectively; There are multiple groups of TadA-X, and the amino acid sequences of their mutants are shown in any one of SEQ ID NO.5 to SEQ ID NO.

29.

8. The method for constructing a base editor according to claim 7, characterized in that: NLS sequence and linker sequence were added to the 5' and 3' ends of mutant TadA-X, respectively.

9. Application of base editor ABE, characterized in that: The base editor ABE mediates A·T--G·C mutation; Base editor ABE refers to a fusion protein formed by Q2LYC0, F2G306, G0JN58, B5ZCW4, Q1AS41, E4TTF3, Q57LE3, Q99W51, ecTadA and the 106th and 108th homologous amino acids of ecTadA being mutated to valine and asparagine respectively, and then fused to the N-terminus and the 1249th fusion site of nSpCas9, wherein the amino acid sequences of Q2LYC0, F2G306, G0JN58, B5ZCW4, Q1AS41, E4TTF3, Q57LE3, Q99W51 or ecTadA mutants are SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.12, and SEQ ID NO.13, respectively.

10. Application of base editor CBE, characterized in that: The base editor CBE mediates C·G--T·A mutation; Base editor CBE refers to a fusion protein formed by mutating the homologous amino acids at positions 106 and 108 of B3PCY2, A5WFT9, C1DXN9, B2UR34, R4K908, D5W8R4, E1TAF4 and ecTadA to valine and asparagine, respectively, and then fused to the N-terminus and the 1249th fusion site of nSpCas9, wherein the amino acid sequences of the B3PCY2, A5WFT9, C1DXN9, B2UR34, R4K908, D5W8R4, and E1TAF4 mutants are SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, and SEQ ID NO.20, respectively.

11. Application of base editor ACBE, characterized in that: The base editor ACBE mediates A·T--G·C and C·G--T·A mutations; Base editor ACBE refers to a fusion protein formed by the amino acids homologous to positions 106 and 108 of Q13XZ4, A8F050, E8WVH3, P44931, G0EXN4, E0TBL5, A1W869, D5X1Y1, and I3YB54 and ecTadA, which are mutated to valine and asparagine, respectively, and then placed at the N-terminus and the 1249th fusion site of nSpCas9, wherein the amino acid sequences of the mutants of Q13XZ4, A8F050, E8WVH3, P44931, G0EXN4, E0TBL5, A1W869, D5X1Y1, and I3YB54 are SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.

29.

12. Adenine deaminase TadA mutant protein, characterized in that The adenine deaminase TadA mutant protein is a non-natural protein, and the adenine deaminase TadA mutant protein refers to a deaminase in which the 106th and 108th amino acids homologous to ecTadA in TadA-X are mutated to valine and asparagine, respectively; TadA-X refers to TadA from different sources; preferably, there are multiple groups of TadA-X, and the amino acid sequences of their mutants are shown in any one of SEQ ID NO.5-SEQ ID NO.

29.

13. The adenine deaminase TadA mutant protein according to claim 12, characterized in that: The mutant protein is a monomer or a dimer.

14. A polynucleotide, characterized in that Encoding the fusion protein in the base editor according to any one of claims 1 to 6.

15. A polynucleotide, characterized in that Encodes the protein according to claim 12.

16. A carrier, characterized in that Containing the polynucleotide according to claim 15.

17. A host cell, characterized in that Containing the base editor according to any one of claims 1 to 6, or containing the protein according to claim 12, or containing the vector according to claim 16.

Images