SgRNA sequence for targeted knockout of klebsiella pneumoniae capsular gene cluster and application

Abstract

The invention discloses an sgRNA sequence for targeted knockout of a klebsiella pneumoniae capsular gene cluster and application. The invention relates to an sgRNA sequence for targeted knockout of a capsule gene cluster of klebsiella pneumoniae. The sequence comprises cps-sgRNA-F as shown in SEQ ID NO. 1 and cps-sgRNA-R as shown in SEQ ID NO. 2. The sgRNA sequence for targeted knockout of the KL47 capsular gene cluster provided by the invention can specifically target the capsular gene cluster, the capsular gene cluster can be specifically knocked out in a targeted manner by constructing the sgRNA sequence into a CRISPR / Cas9 carrier system and matching with a lambda Red homologous recombination system, and a capsular gene cluster knockout strain is obtained, so that important pathogenic factors of klebsiella pneumoniae can be clarified, and the klebsiella pneumoniae can be effectively prevented from being damaged. The specific function of the capsular type KL47 is proved. The CRISPR / Cas9 targeted knockout system for Klebsiella pneumoniae KL47 capsular gene clusters can effectively knock out the capsular gene clusters of strains, and is high in specificity, simple in method and easy to popularize.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and in particular relates to a sgRNA sequence for targeted knockout of a capsule gene cluster, a CRISPR / Cas9 and a plasmid vector system of λRed and an application thereof. Background Art

[0002] In recent years, the drug resistance of bacteria in my country has become increasingly serious, and multidrug-resistant and even pan-drug-resistant bacteria have gradually become an important cause of infection and death in patients. According to the results of CHINET's Chinese Bacterial Resistance Monitoring (January-December 2021), carbapenem, as one of the line of defense drugs for the treatment of Klebsiella pneumoniae, has a resistance rate of about 25%. Carbapenem-resistant Klebsiella pneumoniae (CRKP) has a high incidence rate, high mortality rate, and heavy medical burden. It is currently known that the ST11 type is the most important medical-related CRKP clone in China. The clone has a KL47 capsule, which is encoded by the KL47 capsule gene cluster. The capsule plays an important role in the bacterial pathogenicity, but the specific function of the KL47 capsule of this CRKP clone still needs to be further understood.

[0003] In 2000, some scholars developed a method to use the lambda phage homologous recombination system to achieve recombination between exogenous linear double-stranded DNA and chromosomal DNA homologous sequences in Escherichia coli. In actual operation, the genes of three red proteins (Gam, Exo, Beta) are placed on the expression vector. Once the exogenous dsDNA is electroporated into the cell, there is a probability that homologous recombination will occur in the same genomic target sequence, replacing the gene to be knocked out.

[0004] The CRISPR-Cas system is an RNA-mediated acquired immune system that provides sequence-specific protection against foreign DNA. When foreign DNA enters bacteria and invades their genome, the bacteria will use this defense mechanism to cut it off. Currently, the CRISPR / Cas system has been developed into a genome editing tool. Summary of the invention

[0005] The purpose of the present invention is to provide a sgRNA sequence and application for targeted knockout of the Klebsiella pneumoniae capsule gene cluster in response to the deficiencies of the prior art.

[0006] A sgRNA sequence for targeted knockout of a Klebsiella pneumoniae capsule gene cluster, comprising cps-sgRNA-F as shown in SEQ ID NO.1 and cps-sgRNA-R as shown in SEQ ID NO.2.

[0007] A CRISPR / Cas9 and λRed plasmid vector system for targeted knockout of a capsule gene cluster, the plasmid vector system is a recombinant expression plasmid vector of the sgRNA sequence, λRed and CRISPR / cas9 vector for targeted knockout of a capsule gene cluster, and its sequence is: SEQ ID NO.3.

[0008] A method for constructing a CRISPR / Cas9 and λRed plasmid vector system for targeted knockout of a capsule gene cluster comprises the following steps: (1) using BsaI to digest the plasmid vector pCAS-RED to obtain a linear pCAS-RED vector after digestion; (2) annealing cps-sgRNA-F and cps-sgRNA-R of the sgRNA sequence targeting the capsule gene cluster to obtain a double-stranded DNA sequence, and connecting the double-stranded DNA sequence with the pCAS-RED plasmid vector after enzyme digestion to obtain a recombinant expression plasmid vector of the sgRNA sequence targeting the capsule gene cluster.

[0009] The application of the CRISPR / Cas9 and λRed plasmid vector system is used to target and knock out the Klebsiella pneumoniae KL47 capsule gene cluster.

[0010] The beneficial effects of the present invention are as follows: The sgRNA sequence for targeted knockout of the KL47 capsule gene cluster provided by the present invention can specifically target the capsule gene cluster, and is constructed into the CRISPR / Cas9 vector system, and combined with the λRed homologous recombination system, it can specifically target and knock out the Klebsiella pneumoniae capsule gene cluster to obtain a strain with the capsule gene cluster knocked out, thereby facilitating the elucidation of important pathogenic factors of Klebsiella pneumoniae and proving the specific function of the KL47 capsule type.

[0011] The CRISPR / Cas9 targeted knockout system of the Klebsiella pneumoniae KL47 capsule gene cluster of the present invention can effectively knock out the capsule gene cluster of the strain, has high specificity, is simple in method, and is easy to promote. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 FIG. 4 is a plasmid map of the vector plasmid pCAS-RED used in the examples of the present invention.

[0013] Figure 2 This is a graph showing the results of PCR detection by electrophoresis in an embodiment of the present invention.

[0014] Figure 3 This is the survival curve of mice after intraperitoneal bacterial infection in an example of the present invention. DETAILED DESCRIPTION

[0015] The present invention will be described in detail below according to the accompanying drawings and preferred embodiments, and the purpose and effect of the present invention will become more clear. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0016] The principle of targeting the sgRNA sequence to knock out the capsule gene cluster is as follows: The target sequence of the sgRNA on the KL47 capsule gene cluster conforms to the sequence arrangement rule of 5'-N(20)-NGG(PAM), the target sequence of the sgRNA on the capsule gene cluster is located in the conserved region of the gene, and the target site sequence of the sgRNA on the capsule gene cluster is shown in the sequence table SEQ ID NO.1 sequence, in the The TAGT sequence is added to the 5'-end of the target site sequence of the sgRNA on the capsule gene cluster to synthesize a forward oligonucleotide, namely, Forward oligo; the complementary chain of the target site sequence of the sgRNA on the capsule gene cluster is obtained, and the AAAC sequence is added to the 5'-end of the complementary chain to synthesize a reverse oligonucleotide, namely, Reverse oligo.

[0017] The Forward oligo and Reverse oligo of the two complementary oligonucleotides synthesized are annealed and connected to form a double-stranded sgRNA oligonucleotide that can be connected to the plasmid vector.

[0018] The annealed double-stranded sgRNA oligonucleotide was fused with the linearized vector pCAS-RED ( Figure 1 ) to obtain the expression vector pCAS-RED-sgRNA plasmid carrying the sgRNA oligonucleotide containing the corresponding target sequence, transform the competent bacteria DH5α and inoculate it on a hygromycin plate, pick a single clone and identify the positive clone by sequencing, and shake the positive clone to extract the plasmid.

[0019] The pCAS-RED-sgRNA plasmid carrying sgRNA, Cas9 and Red at the same time and the repair template containing 500bp homology arms at both ends of the capsule gene cluster are used to transfer to the target bacteria, and hygromycin resistance screening is added to select monoclonal bacteria, and genomic DNA is extracted. The gene fragment containing the target sequence is PCR amplified using the genomic DNA as a template, and the capsule gene cluster is confirmed to have been knocked out by whole genome sequencing to obtain knockout bacteria. The specific preparation method is as follows: S1: Prepare 10 MHA solid plates containing 100 μg / ml hygromycin S1.1: Weigh 7.6 g of Mueller-Hinton Agar (MHA) culture medium into 200 ml of distilled water, autoclave at 121°C for 20 minutes, and place in a 60°C water bath for later use.

[0020] S1.2: Accurately weigh 0.02 g of hygromycin into 1 ml of aqueous solution to obtain a hygromycin solution.

[0021] S1.3: Add the hygromycin solution prepared in S1.2 to the 200 ml MHA culture medium prepared in S1.1, mix well, and pour into a sterile culture dish with a diameter of 90 mm, about 20 ml in each culture dish.

[0022] S1.4: Incubate at room temperature for 2 hours until the MHA medium solidifies, then dry in the air and store at 4°C for future use.

[0023] S2: Preparation of competent bacteria S2.1: Columbia blood agar plates were inoculated with the target bacteria in four zones.

[0024] S2.2: Weigh 1.9 g of Mueller-Hinton (MH) medium in 50 ml of distilled water and sterilize by autoclaving at 121°C for 20 minutes. After the autoclave is over, place in a 4°C refrigerator for later use.

[0025] S2.3: Pick a single colony and add it to 5 ml liquid culture medium, amplify it at 220 rpm and 37°C overnight. On the next day, take 500 μL and add it to 50 ml MH liquid culture medium, amplify it at 220 rpm and 37°C for 2.5 hours to culture the bacteria.

[0026] S2.4: Use a centrifuge to collect the bacteria. The centrifuge is set at 5000 rpm for 5 minutes.

[0027] S2.5: Rinse the bacteria with 15 ml of double distilled water (ddH2O) precooled at 4°C and resuspend the bacteria.

[0028] S2.6: Repeat step S2.5.

[0029] S2.7: Use the same centrifugation conditions as S2.4 again to collect the bacteria by centrifugation, wash the bacteria with 1 ml of 10% glycerol solution by volume, and resuspend the bacteria.

[0030] S2.8: Repeat step S2.7.

[0031] S2.9: Dispense into 1.5 ml EP test tubes, 100 μL per tube, and store at -80℃ until use.

[0032] S3: Construction of pCAS-RED-sgRNA plasmid S3.1: Synthesize the following two sgRNA sequences (1) cps-sgRNA-F: TAGTGCACCGATATAGGTCACACA, SEQ ID NO.1; (2) cps-sgRNA-R:AAACTGTGTGACCTATATCGGTGC, SEQ ID NO.2.

[0033] S3.2: Dilute the two sequences to 100 μmol / L using ddH2O according to the synthesized concentration.

[0034] S3.3: Anneal the two sgRNA sequences to form a double-stranded sgRNA according to the following conditions.

[0035] (1) Add a, b, and c to a 0.2 ml PCR tube and heat at 95°C for 3 minutes in a thermal cycler. Then cool the PCR tube to 25°C at a rate of 0.5°C / 10s in the thermal cycler. The two sequences will automatically connect to form a double-stranded sgRNA. a. 1 μl cps-sgRNA-F solution b. 1 μl cps-sgRNA-R solution c. 8 μl ddH2O.

[0036] (2) Place the double-stranded sgRNA annealed in (1) at 4°C for later use.

[0037] S3.4: Use Bsal endonuclease to digest the pCAS-RED plasmid, specifically: Prepare the following ad system, mix well at low speed in a centrifuge, 1000 rpm, 10 seconds, then place in a 37°C constant temperature water bath for 2 hours, purify the plasmid vector using a DNA purification kit after the water bath ends, and store for later use.

[0038] a.1μl Bsal b. 5 μl 10× Cutsmart Buffer c.5μl pCAS-RED (200μg / ml) d. 39 μl ddH2O.

[0039] S3.5: Use T4 DNA ligase to connect the pCAS-RED plasmid vector digested in S3.4 and the double-stranded sgRNA in S3.3, specifically: Prepare the following system, mix well in a centrifuge at low speed, 1000 rpm, 10 seconds, and then place in a constant temperature water bath at 16°C for 2 hours to obtain the pCAS-RED-sgRNA plasmid (SEQ ID NO.3).

[0040] a. 0.5 μl T4 DNA ligase b.1μl 10× Ligase Buffer c.2μl linearized pCAS-RED (25μg / ml) d.1 μl double-stranded sgRNA e. 5.5 μl ddH2O.

[0041] S4: Electroporation of pCAS-RED-sgRNA plasmid into Klebsiella pneumoniae S4.1: Thaw the competent bacteria stored at -80℃ on ice.

[0042] S4.2: Add 3 μl of the ligated pCAS-RED-sgRNA plasmid and mix gently. Note: Do not shake the cells vigorously.

[0043] S4.3: Use the Bio-Rad electroporation instrument to transform the pCAS-RED-sgRNA plasmid into competent bacteria (condition: voltage 2500V).

[0044] S4.4: Quickly add 900 μl of SOC (super Optimal Broth) medium (pre-warmed at 37°C) containing L-arabinose.

[0045] S4.5: Cultivate with shaking at 30°C for 1 hour (200 rpm).

[0046] S4.6: Take an appropriate amount of 50 μl and spread it on MHA solid plate culture medium containing 100 μg / ml hygromycin.

[0047] S4.7: Incubate overnight at 37°C.

[0048] S5: PCR verification of target gene knockout S5.1: Select a single colony cultured on the MHA solid medium containing 100 μg / ml hygromycin.

[0049] S5.2: Use PCR to amplify gnd, a gene in the capsule gene cluster.

[0050] S5.3: After PCR, use agarose gel electrophoresis to detect the PCR results. Add gelred nucleic acid dye. If no bands are imaged, it means PCR is negative.

[0051] S5.4: The PCR-negative strain is the knockout strain. Select a single colony and store it in a 30% volume ratio glycerol broth medium at -80°C for future use.

[0052] like Figure 2 The figure shows the PCR results of the electrophoresis detection in this example, where M is a marker, 1 is the original strain, and 2-7 are knockout strains. The electrophoresis of the PCR amplification band of the original strain is positive, and the electrophoresis of the knockout strain is negative.

[0053] S6: Toxicity Verification S6.1: Columbia blood agar plates were inoculated with the target bacteria in four zones.

[0054] S6.2: Pick up a single colony from step S6.1 and add it to sterile saline, adjust the turbidity to 0.5 McFarland turbidity, dilute it 10 times, and then inject 100 μL of the solution into female BAlB / c mice about 5 weeks old through the peritoneal cavity. Each group of bacteria contains 10 mice.

[0055] S6.3: After injection, place the mice at room temperature, provide normal feed and water, and observe the mice for death after 24 hours.

[0056] Figure 3 The lethality of the bacteria to mice before and after the knockout of the strain is given. Figure 3 The results show that the lethality of the strain to mice was reduced after knockout, indicating that the knockout was successful.

[0057] Those skilled in the art can understand that the above are only preferred examples of the invention and are not intended to limit the invention. Although the invention is described in detail with reference to the above examples, those skilled in the art can still modify the technical solutions recorded in the above examples or replace some of the technical features therein with equivalents. Any modification, equivalent replacement, etc. made within the spirit and principle of the invention shall be included in the protection scope of the invention.

Claims

1. A sgRNA sequence for targeting and knocking out the capsule gene cluster of Klebsiella pneumoniae, characterized in that: The sequence includes cps-sgRNA-F as shown in SEQ ID NO.1 and cps-sgRNA-R as shown in SEQ ID NO.

2.

2. A CRISPR / Cas9 and λRed plasmid vector system for targeted knockout of capsule gene clusters, characterized in that: The plasmid vector system is a recombinant expression plasmid vector of the sgRNA sequence, λRed and CRISPR / cas9 vector for targeted knockout of the capsule gene cluster as claimed in claim 1, and its sequence is: SEQ ID NO.

3.

3. A method for constructing a CRISPR / Cas9 and λRed plasmid vector system for targeted knockout of capsule gene clusters, characterized in that: The steps include: (1) using BsaI to digest the plasmid vector pCAS-RED to obtain a linear pCAS-RED vector after digestion; (2) annealing cps-sgRNA-F and cps-sgRNA-R of the sgRNA sequence for targeting and knocking out the capsule gene cluster as described in claim 1 to obtain a double-stranded DNA sequence, and connecting the double-stranded DNA sequence with the pCAS-RED plasmid vector after enzyme digestion to obtain a recombinant expression plasmid vector of the sgRNA sequence for targeting and knocking out the capsule gene cluster.

4. An application of the CRISPR / Cas9 and λRed plasmid vector system as claimed in claim 2, characterized in that: Used to target and knock out the Klebsiella pneumoniae KL47 capsule gene cluster.

Images