MiRNA for regulating and controlling liver carnitine palmitoyltransferase I and application thereof

Abstract

The invention discloses miRNA for regulating and controlling liver carnitine palmitoyl transferase I and application of the miRNA, and belongs to the field of molecular biology. According to the present invention, the existence of the binding site with the miR-380-3p in the CPT1A 3UTR region is clarified; experiments of transfecting miR-380-3p simulants and interferents by fetal sheep kidney medullary cells prove that the expression quantity of the CPT1A gene can be remarkably reduced at mRNA and protein levels through miR-380-3p overexpression, and the expression quantity of the CPT1A gene can be remarkably increased at the protein level through interference of endogenous miR-380-3p. Furthermore, the miR-380-3p provided by the invention can effectively regulate the expression of a target gene CPT1A, so that the miR-380-3p participates in influencing the metabolism of fatty acid, plays an important role in adapting the mongolian sheep to a cold environment in winter, and has application potential in the treatment of human obesity.

Description

Technical Field

[0001] The invention relates to miRNA for regulating liver carnitine palmitoyltransferase I and application thereof, and belongs to the field of molecular biology. Background Art

[0002] The Sunite Mongolian sheep belongs to the family of Artiodactylidae and is one of the excellent local mutton breeds in Inner Mongolia. Living in the Xilin Gol grassland with a large temperature difference between morning and evening, the lowest temperature is below -38°C, but its growth and development are normal, its reproductive performance is stable, and the survival rate of lambs is high, which shows that Mongolian sheep have their own unique cold adaptation mechanism. The main ways for animals to produce heat include basal metabolism, body activity, shivering and non-shivering heat production caused by cold, and the thermal effect of food. Among them, basal heat production has been proven to be mainly achieved by enhancing the heat production capacity of internal organs such as the liver and muscles. As the main organ of lipid metabolism, the liver plays a key role in heat production.

[0003] Carnitine palmitoyltransferase I (CPT1A) is an enzyme located on the outer membrane of mitochondria. It is a key enzyme for animal fatty acid oxidation. It is responsible for transporting palmitic acid, a product of fat metabolism, into mitochondria to complete β-oxidation energy production. Its activity determines whether the subsequent energy production process is vigorous. Studies have shown that under high-fat diet or starvation conditions, fatty acid β-oxidation becomes the main energy supply mode. At this time, CPT1A activity is enhanced. CPT1A indirectly affects the substrate supply and energy production of the TCA cycle by regulating the rate at which fatty acids enter the mitochondria. CPT1A can also affect the succinylation level of some key metabolic enzymes, such as pyruvate kinase and glutamine synthetase. These enzymes play an important role in glycolysis and amino acid metabolism. Therefore, CPT1A can affect the energy metabolism of cells by synergistically regulating pathways such as glycolysis, tricarboxylic acid cycle, and succinylation modification. These synergistic effects help maintain the energy homeostasis of sheep and adapt to different environmental conditions.

[0004] MicroRNA (miRNA) is an endogenous small RNA molecule with a length of 22-25 nt. It negatively regulates target genes by cutting or inhibiting the translation of target proteins to achieve gene silencing. Studying the role of miRNA in regulating CPT1A expression activity will help to better adjust its activity according to the energy needs of the sheep, thereby playing an important role in energy metabolism and providing new means and ideas for Mongolian sheep to resist the heat production process in the cold environment. Fatty acid oxidation (FAO) is an important process in liver energy metabolism, and its normal progress is crucial to maintaining liver function and energy balance in the body. CPT1A, as a key enzyme in carnitine-dependent mitochondrial inner membrane transport, controls the process of fatty acids entering mitochondria for oxidation. Therefore, the regulation of CPT1A is directly related to the efficiency of fatty acid oxidation in the liver. There are many existing studies on the regulation of CPT1A, such as transcription factors, interacting proteins, etc., but they are all biological macromolecules and have limited application prospects. Since miRNA sequences are relatively short, in vitro synthesis is relatively convenient, and it has a good prospect for medicinal use. Studies have found that miR-122 is a highly specific miRNA expressed in the liver, accounting for about 70% of the total liver miRNA. It is involved in regulating the metabolism of cholesterol and fatty acids. By inhibiting the expression of miR-122, the levels of cholesterol and triglycerides in plasma can be effectively reduced, and liver fat accumulation can be reduced, which provides a new potential therapeutic strategy for the treatment of fat metabolism diseases such as non-alcoholic fatty liver disease (NAFLD) and atherosclerosis. In addition, miR-130 was found to be expressed less in the adipose tissue of obese mice. Overexpression of miR-130 can reduce adipocyte differentiation and fat accumulation by inhibiting the expression of its target genes (such as PPARγ). Using miRNA mimics or anti-miRNA oligonucleotides to regulate lipid metabolism and deliver them to target cells or tissues through nanocarriers, viral vectors, etc. is a potential gene therapy method. Local treatment of specific tissues or organs, such as liver and muscle, can be achieved by local injection of miRNA mimics or anti-miRNA oligonucleotides to achieve efficient treatment. For diseases that require systemic treatment, such as obesity, hyperlipidemia, etc., systemic administration can be selected to deliver therapeutic agents to systemic tissues and organs by intravenous injection or oral administration. These examples show the potential application of miRNA in the treatment of fat metabolic diseases. However, CPT1A is regulated by multiple factors, and the related factors have a wide range of functions and a large number. Their functions have not yet been clarified, and the prior art does not report specific miRNA and its relationship. Therefore, the present invention aims to find a new type of small molecule RNA that effectively regulates CPT1A to improve the efficiency of fatty acid oxidation in the liver, and provide new ideas for the selection of sheep breeds and the treatment of metabolic diseases such as human obesity and fatty liver. Summary of the invention

[0005] In view of the deficiencies of the above-mentioned prior art, the present invention provides a miRNA for regulating liver carnitine palmitoyltransferase I and its application, aiming to provide a miRNA that can regulate the expression level of CPT1A, a key enzyme in liver fatty acid transport, and provide new ideas for the breeding of sheep breeds and the treatment of metabolic diseases such as human obesity and fatty liver.

[0006] The first technical solution provided by the present invention is the use of a miRNA in regulating the key enzyme CPT1A in liver fatty acid transport, wherein the miRNA is miR-380-3p.

[0007] In certain embodiments, the miR-380-3p sequence is SEQ ID NO:1.

[0008] SEQ ID NO: 1: 5´-UAUGUAAUGUGGUCCACGUCU-3´.

[0009] In certain embodiments, the miR-380-3p precursor sequence is SEQ ID NO:2.

[0010] SEQ ID NO:2: 5´-CCTTCCCACGGTACCTGAAAAGATGGTTGACCACAGAACATGCGCTGTCTCTATGTCGTATGTAATGTGGTCCACGTCTTCTCAATATCAAATTCAGTCGCAG-3´.

[0011] In certain embodiments, the regulation is to upregulate the level of CPT1A gene and / or protein by downregulating the expression of miR-380-3p, or to downregulate the level of CPT1A gene, protein and / or mRNA by upregulating the expression of miR-380-3p.

[0012] The second technical solution provided by the present invention is the use of a regulator of miR-380-3p in the preparation of a product for regulating the expression of CPT1A gene or protein.

[0013] In certain embodiments, the miR-380-3p regulator includes a miR-380-3p enhancer or a miR-380-3p inhibitor, wherein the miR-380-3p enhancer enhances the activity and / or expression of miR-380-3p, and the miR-380-3p inhibitor inhibits the activity and / or expression of the miR-380-3p molecule.

[0014] In certain embodiments, the enhancer of miR-380-3p downregulates the level of CPT1A gene, protein and / or mRNA, and the inhibitor of miR-380-3p upregulates the level of CPT1A gene and / or protein.

[0015] In certain embodiments, the enhancer of miR-380-3p comprises a miR-380-3p mimic; a miR-380-3p mimic is a miR-380-3p synthesized by chemical synthesis to simulate endogenous miR-380-3p in an organism. In certain embodiments, the inhibitor of miR-380-3p comprises a miR-380-3p inhibitor, and the nucleotide sequence of the miR-380-3p inhibitor is shown in SEQ ID NO.3: SEQ ID NO.3: AGACGTGGACCACATTACATA.

[0016] The third technical solution provided by the present invention is the use of miR-380-3p as a target in the preparation of a drug for alleviating, reducing and / or treating diseases related to low expression of CPT1A, by downregulating the expression of miR-380-3p and thereby upregulating the level of CPT1A gene and / or protein, thereby alleviating, reducing and / or treating diseases related to low expression of CPT1A.

[0017] In certain embodiments, the expression of miR-380-3p is downregulated by a miR-380-3p inhibitor, wherein the miR-380-3p inhibitor comprises a miR-380-3p interferor, and the nucleotide sequence of the miR-380-3p interferor is shown in SEQ ID NO.3, SEQ ID NO.3: AGACGTGGACCACATTACATA.

[0018] In certain embodiments, the drug is a vector for gene therapy, including vectors for gene editing, gene expression regulation, or gene delivery; or, the drug is a vector for cell therapy, including stem cells, immune cells, or repair cells.

[0019] In certain embodiments, the dosage form of the drug includes oral solution, injection, tablet, pill, dispersion, capsule, pellet, granule, suspension, emulsion.

[0020] In certain embodiments, the diseases associated with low CPT1A expression include obesity, fatty liver, cardiovascular disease, and insulin resistance.

[0021] The technical effects of the present invention are as follows: 1. The luciferase reporter plasmid of the target gene 3'UTR region was successfully constructed and co-transfected with the miRNA expression plasmid into 293T cells. The chemiluminescence reaction characteristics were used to detect the regulatory effect of miRNA on the target sequence, and it was confirmed that there was a binding site for miR-380-3p in the 3'UTR region of CPT1A (P<0.01).

[0022] 2. Through the experiment of transfecting fetal sheep renal medullary cells with miR-380-3p mimics, qRT-PCR and Western blot detection proved that overexpression of miR-380-3p can significantly downregulate the expression of the target gene CPT1A at the mRNA (P<0.001) and protein levels (P<0.001).

[0023] 3. Through the experiment of interfering with miR-380-3p transfection in fetal sheep renal medullary cells, Western blot detection proved that interfering with endogenous miR -380-3p could significantly upregulate the expression of the target gene CPT1A at the protein level (P<0.01).

[0024] 4. A miRNA, miR-380-3p, was successfully obtained from the liver tissue of Mongolian sheep. It can effectively regulate the expression of the target gene CPT1A, thereby participating in the metabolism of fatty acids. It plays an important role in the adaptation of Mongolian sheep to the cold environment in winter and has application potential in the treatment of human obesity. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a graph showing the relative expression level of CPT1A in liver tissue detected by qRT-PCR in the present invention.

[0026] Figure 2 This is a graph showing the relative expression level of miR-380-3p in liver tissue detected by qRT-PCR in the present invention.

[0027] Figure 3 The results of constructing the dual-luciferase reporter vector for CPT1A wild type (H32748).

[0028] Figure 4 The results of constructing the dual-luciferase reporter vector for the CPT1A mutant (H32749).

[0029] Figure 5 This is the effect of miR-380-3p on the luciferase activity of CPT1A wild-type (H32748) vector and mutant (H32749) vector.

[0030] Figure 6 This is the relative expression level of CPT1A gene mRNA after fetal sheep renal medullary cells were transfected with miR-380-3p.

[0031] Figure 7 This is a graph showing the Western blot detection results of CPT1A gene protein and its expression level after fetal sheep renal medullary cells were transfected with miR-380-3p mimics.

[0032] Figure 8 This is a graph showing the Western blot detection results of CPT1A gene protein and its expression level after fetal sheep renal medullary cells were transfected with miR-380-3p inhibitor. DETAILED DESCRIPTION

[0033] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.

[0034] The detection method involved in the embodiment: 1. qRT-PCR: 1. RNA Extraction Add Trizol to the sample. The sample volume should not exceed 10% of the Trizol volume. Let stand for 5 minutes.

[0035] Add 0.2 mL of chloroform to each 1 mL of Trizol, shake vigorously for 15 seconds, and place on ice for 3 minutes. 4°C, 12,000 rpm, 15 min, take the supernatant. Add the same volume of isopropanol as the supernatant and let it stand at room temperature for 10 min. 4°C, 12,000 rpm, 10 min, discard the supernatant, and wash the RNA precipitate with 1 mL of 75% ethanol. 4°C, 12,000 rpm, 5 min, discard the supernatant. Let the RNA stand and dry at room temperature for 5 min. Dissolve the precipitate in 10 μL of DEPC water. Take 3 μL of RNA sample and electrophoresed it in 1.5% agarose gel; 1 μL of RNA sample was tested for concentration by UV spectrophotometer, and the RNA sample was considered qualified when A260 / 280 was between 1.8 and 2.0.

[0036] 2. Reverse Transcription (1) mRNA reverse transcription Take 1 μg of total RNA as template RNA, add 2 μL 5X PrimeScript RT Master Mix (TaKaRa, Product No. RR036A), RNase Free H 2 Make up to 10 μL of HO, and reverse transcription conditions are 37℃ for 15 min, 85℃ for 15 s, and 4℃. The obtained cDNA is stored in a -20℃ refrigerator.

[0037] (2) miRNA reverse transcription Preparation of miRNA reverse transcription system: Take 2 μg of total RNA as template RNA, add 10 μL 2X miRNA P-RT Solution mix, 2 μL miRNA P-RT Enzyme mix, RNase Free H 2 Add 20 μL of O, mix gently and centrifuge for 3-5 s. Incubate the reaction mixture in a 37°C water bath for 60 min, then heat at 85°C for 5 min to inactivate the enzyme and store at 4°C.

[0038] 3. Fluorescence quantitative PCR Primer design: According to the CDS sequence of CPT1A found on NCBI, primers were designed using primer 6.0 software. The upstream primer is 5´-ACTCACATCCAGGCGGCAAGA-3´ (SEQ ID NO: 4); the downstream primer is 5´-CGGAGCAGAGCGGAATCGTAGA-3´ (SEQ ID NO: 5), and the amplified product length is 124 bp. The upstream primer of miR-380-3p is 5´-GCTATGTAATGTGGTCCACGTCT-3´ (SEQ ID NO: 6), and the downstream primer is 5´-GTGCAGGGTCCGAGGT-3´ (SEQ ID NO: 7).

[0039] Table 1 Preparation of mRNA qRT-PCR system:

[0040] Three parallel reactions were set up for each mRNA expression test, with β-actin as the internal reference. The amplification program was: 95°C for 10 min, 45 cycles (95°C for 15 s, 52°C for 60 s).

[0041] Table 2 Preparation of miRNA qRT-PCR system

[0042] Three parallel reactions were set up for each miRNA expression detection, with SnRNAU6 as the internal reference.

[0043] The amplification program was: pre-deformation at 95°C for 30 s, denaturation at 95°C for 5 s, and annealing at 60°C for 30 s for 40 cycles.

[0044] The inflection point of the real-time quantitative PCR amplification curve is clear, and the overall parallelism of the amplification curve is good, indicating that the amplification efficiency of each reaction tube is similar, the limit is flat without rising phenomenon, and the slope of the curve exponential period is large, indicating that the amplification efficiency is high; the melting curves of the sample amplification products are all single-peaked, indicating that there is only one amplification product, which is specific amplification; according to the relative quantitative formula of qRT-PCR: 2 -ΔΔCt, and compared the expression levels of miR-380-3p and CPT1A genes.

[0045] 2. Western blot detection 1. Protein sample preparation After 48 hours of cell transfection and culture, wash twice with PBS, add 150 μL of RIPA containing protease inhibitors and phosphatase inhibitors to each well, collect cells with a cell scraper in a 1.5mL centrifuge tube, and place on ice for 30 minutes. Centrifuge at 12000rpm, 4℃ for 15 minutes, take the supernatant in a 1.5ml centrifuge tube, and store at -80℃. Use the BCA kit to determine the protein sample concentration. Add 4xLoading Buffer protein loading solution according to the sample volume, and denature at 100℃ for 5 minutes.

[0046] 2. Glue making A separation gel: 30% acrylamide 1.98 mL, 1.5 M Tris-HCl (pH 8.8) 1.5 mL, SDS 60 μL, H 2 O2.4mL, 10% AP 60μL, TEMED 6μL, mix, carefully add to the installed electrophoresis vertical plate, add 1.5~2ml isopropanol cover to drive away bubbles. After the separation gel solidifies, use ddH 2 0 Wash off the isopropanol completely. B SDS-PAGE stacking gel: 30% acrylamide 0.83 mL, 1.5 M Tris-HCl (pH 6.8) 0.625 mL, SDS 50 μL, H 2 Mix 3.42 mL of O, 75 μL of 10% AP, and 7.5 μL of TEMED, add it to the separation gel and quickly put in the comb to prevent bubbles from forming.

[0047] 3. Sample loading After the concentrated gel is naturally dried, carefully unplug the electrophoresis comb, place the vertical plate into the electrophoresis tank, add 1xTris-G1y electrophoresis buffer, calculate the protein sample added to each well according to the protein concentration, and add 5μL of marker.

[0048] 4. Electrophoresis gel Run the gel at 80V until the marker is separated, then switch the voltage to 120V until bromophenol blue is electrophoresed to the bottom of the gel. Select the appropriate interval according to the protein molecular weight and cut the gel of interest.

[0049] 5. Transfer The cathode of the transfer clip is at the bottom and the anode is at the top. 3 layers of sponge, 3 layers of filter paper, target gel, PVDF membrane, 3 layers of filter paper, and 3 layers of sponge are laid in order. After each layer is placed, use a glass rod to drive away bubbles, and then place the transfer clip vertically in the transfer tank, 120V, 13min.

[0050] 6. Closure Prepare a blocking solution with a concentration of 5% skimmed milk powder and block for 3 hours.

[0051] 7. Primary Antibody Incubation The primary antibody was diluted with 5% skimmed milk powder according to the corresponding ratio, placed on a PVDF membrane, and kept in a 4°C refrigerator overnight. The primary antibody was recovered and washed three times with TBST, each time for 10 min.

[0052] 8. Secondary Antibody Incubation Dilute the secondary antibody with 5% skim milk powder at a concentration of 1:1, place it on a shaker and shake it slowly for 2 hours at room temperature, recover the secondary antibody, and wash it with TBST three times, each time for 10 minutes.

[0053] 9. Glue Mix the A and B solutions of the ECL super-sensitive luminescent liquid in a ratio of 1:1 and protect them from light, then drop them on the PVDF membrane and develop and take pictures using an imaging system.

[0054] 10. Result processing ImageJ image analysis software was used for grayscale analysis, and SPSS18.0 was used to analyze the significance of the differences (****P<0.0001, ***P<0.001, **P<0.01, *P<0.05).

[0055] The raw materials used in the examples are: 1. Fetal sheep kidney medullary cells are derived from the Key Laboratory of Biomanufacturing in Inner Mongolia Autonomous Region and have been published in the following literature: Zhang D. Effects of GABA on Oxidative Stress and Metabolism in High-Glucose Cultured Mongolian Sheep Kidney Cells[J].International Journal of Molecular Sciences, 2024, 25.DOI:10.3390 / ijms251810033.

[0056] 2. 293T cell line was obtained from the Cell Bank of the Chinese Academy of Sciences.

[0057] 3. Sunite sheep were purchased from Sunite Right Banner Ranch.

[0058] Example 1 Sequencing and data analysis of the entire transcriptome of Sunite Mongolian sheep in winter and summer 1. Sample collection and total RNA extraction Three Mongolian sheep were selected from Sunite Right Banner, Inner Mongolia Autonomous Region, in winter (January) and summer (July), aged 1.5 years and weighing about 25-30 kg. The liver tissue was obtained after slaughter, cut into small pieces and placed in 2 mL cryotubes, and immediately frozen in liquid nitrogen for later use.

[0059] RNA extraction standards: RNA purity: OD260 / 280 ≥ 1.8, 28S / 18S ≥ 1; RNA integrity: RIN value ≥ 7.0. RNA integrity detection method: Agilent2100 (RNA6ano kit), agarose gel electrophoresis (agarose gel concentration: 1% agarose gel: voltage: 5V / cm; time: 20min).

[0060] 2. Sequencing and data analysis Sequencing: mRNA and miRNA were sequenced using Illumina NovaSeq 6 second-generation high-throughput sequencing technology. The data was processed by removing adapters, removing low-quality proteins, and removing contamination to obtain the final data.

[0061] HISAT2 was used to map clean reads to the sheep reference genome, and featurecounts was used to calculate gene expression. Deseq2 was used to analyze the gene expression differences between the treatment group and the reference group, using log 2 FoldChange|≥1.5 and P<0.05 were used to screen the up- and down-regulated genes. A total of 14 differentially expressed miRNAs were screened, of which 11 were down-regulated; 535 differentially expressed mRNAs, of which 474 were up-regulated. The algorithms including TargetScan, RNAhybrid, miR-Walk and miRanda were used to predict the binding of differentially expressed miRNAs and target genes. By taking the intersection of the algorithms and integrating all target genes with genes negatively correlated with miRNA expression in the mRNA sequencing results, it was predicted that the down-regulated miRNA (miR-380-3p) had a regulatory relationship with the target gene mRNA (CPT1A).

[0062] 3. Detection of miR-380-3p and CPT1A expression in liver tissues in winter and summer by qRT-PCR The liver tissue was ground in liquid nitrogen, and 1 mL of Trizol was added to every 50-100 mg of tissue, and the tissue was homogenized using a homogenizer. The results of qRT-PCR showed that the qRT-PCR amplification results were stable, and the expression level of CPT1A in the winter liver group was higher than that in the summer liver group ( Figure 1 ), while the expression level of miR-380-3p in the winter liver group was significantly lower than that in the summer liver group ( Figure 2 ), the above results verified the results of the integrated analysis of high-throughput transcriptome expression data, that is, in the liver, there may be a regulatory relationship between the expression level of miR-380-3p and the expression level of the CPT1A gene.

[0063] Example 2 Verification of the relationship between miR-380-3p and target gene CPT1A 1. Dual fluorescence reporter gene detection According to Sun Yuqing et al., "Construction of Ddit4 3'UTR Dual Luciferase Reporter Gene Plasmid and Identification of Regulatory MicroRNA", Chinese Journal of Biological Products, 34.12(2021):6, wild type ( Figure 3 ) and mutant reporter gene plasmids ( Figure 4 ).

[0064] 293T cells in the logarithmic growth phase were collected, and miR-380-3p mimics, negative control (NC) and CPT1A luciferase reporter vectors were co-transfected into 293T cells according to the instructions of lipofectamine TM2000 transfection, and divided into four groups: wild type + miR-380-3p mimics, wild type + negative control, mutant type + miR-380-3p mimics and mutant type + negative control. After 24 hours of culture, the intensity of firefly luciferase and Renilla luciferase in different groups was detected, and the relative luciferase activity was calculated using the ratio of the intensity of firefly luciferase and Renilla luciferase. The details are as follows: (1) Plasmid transfection into cells Cells were seeded into 96-well plates at a confluence of 70%. After 24 hours, luciferase reporter gene plasmids and miR-380-3p gene plasmids were transfected. Three replicate wells were set for each sample. Prepare DNA and transfection reagent: When transfecting plasmids in a 96-well plate, the ratio of each well is Firefly luciferase vector (Firefly): Renilla luciferase vector (Renilla): transfection reagent = 0.2μg: 0.01μg: 0.5μL. Prepare microRNA and transfection reagent diluents, the final concentration of microRNA is 100nM, and the transfection reagent is 0.25μL per well. Dilute DNA, microRNA and transfection reagent, incubate at room temperature for 5min, then mix with transfection reagent and incubate at room temperature for 20min. Discard 50μL of culture medium from each well, and add 50μL of DNA-microRNA transfection mixture to each well of cell samples. After 6 hours of transfection, replace with fresh complete culture medium.

[0065] (2) After 48 hours of co-transfection of the dual fluorescence reporter gene detection plasmid, discard the culture medium and wash once with 100μL 1XPBS. Tilt the 96-well plate and drain the remaining PBS. Dilute 5XPLB (Passive Lysis Buffer) into 1XPLB with deionized water and bring to room temperature before use. Add 50μL of diluted 1X PLB to each well and shake on a shaker at room temperature for 15 minutes to lyse. Add 5μL of clear solution to each well of the white opaque 96-well ELISA plate, add 50μL of pre-mixed LAR II, and measure the data after 2s. Add 50μL of pre-mixed Stop&Glo Reagent to each well, let it stand for 2s, and measure the data.

[0066] The results showed that miR-380-3p reduced the activity of luciferase (P<0.01) ( Figure 5 ), CPT1A was preliminarily identified as the target gene of miR-380-3p.

[0067] 2. Effects of miR-380-3p mimics on CPT1A gene levels According to the instructions of riboFECT™ CP transfection reagent, negative control (NC) and miR-380-3p mimics were transferred into fetal sheep renal medullary cells. RNA was extracted after 24 hours of culture and then reverse transcribed to obtain cDNA. The relative expression of CPT1A gene mRNA was detected by real-time quantitative PCR, and the effect of miR-380-3p mimics on CPT1A gene at the protein level was detected by Western blot. like Figure 6 , 7As shown, miR-380-3p mimics not only downregulated the expression level of CPT1A gene at the mRNA level (P < 0.001), but also downregulated the expression of CPT1A gene at the protein level (P < 0.001).

[0068] 3. Effect of miR-380-3p inhibitor on the protein level of CPT1A gene According to the instructions of Lipofectamine™ 3000 Transfection Reagent, negative control (NC) and miR-380-3p inhibitor were transferred into fetal sheep renal medullary cells. Protein was extracted after 72 hours of culture, and Western blot was used to detect the effect of miR-380-3p inhibitor on the protein level of CPT1A gene.

[0069] like Figure 8 As shown, miR-380-3p inhibitor could upregulate the expression of CPT1A gene at the protein level (P<0.01).

[0070] The results showed that miR-380-3p could inhibit the expression of CPT1A gene at the mRNA and protein levels, and further confirmed that miR-380-3p could bind to CPT1A 3´UTR and CPT1A was the target gene of miR-380-3p.

[0071] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. An application of miRNA in regulating the key enzyme CPT1A in liver fatty acid transport, characterized in that: The miRNA is miR-380-3p.

2. The use according to claim 1, characterized in that: The regulation is to upregulate the level of CPT1A gene and / or protein by downregulating the expression of miR-380-3p.

3. The use according to claim 1, characterized in that: By upregulating the expression of miR-380-3p, the levels of CPT1A gene, protein and / or mRNA are downregulated.

4. Use of a miR-380-3p regulator in the preparation of a product for regulating CPT1A gene or protein expression, characterized in that: The miR-380-3p regulator includes a miR-380-3p enhancer or a miR-380-3p inhibitor, wherein the miR-380-3p enhancer enhances the activity and / or expression of miR-380-3p, and the miR-380-3p inhibitor inhibits the activity and / or expression of the miR-380-3p molecule.

5. The use according to claim 4, characterized in that: The miR-380-3p nucleotide sequence is shown in SEQ ID NO:1, and the miR-380-3p precursor sequence is shown in SEQ ID NO:

2.

6. The use according to claim 5, characterized in that: The enhancer of miR-380-3p downregulates the level of CPT1A gene, protein and / or mRNA, and the inhibitor of miR-380-3p upregulates the level of CPT1A gene and / or protein.

7. The use according to claim 5, characterized in that: The miR-380-3p enhancer includes miR-380-3p mimics, which are miR-380-3p synthesized by chemical synthesis to simulate endogenous miR-380-3p in vivo; the miR-380-3p inhibitor includes miR-380-3p interferor, and the nucleotide sequence of the miR-380-3p interferor is shown in SEQ ID NO.

3.

8. Use of miR-380-3p as a target in the preparation of a drug for alleviating, reducing and / or treating a disease related to low expression of CPT1A, characterized in that: By down-regulating the expression of miR-380-3p and thereby up-regulating the level of CPT1A gene and / or protein, it is used to alleviate, mitigate and / or treat diseases related to low expression of CPT1A.

9. The use according to claim 8, characterized in that: The expression of miR-380-3p is downregulated by a miR-380-3p inhibitor, wherein the miR-380-3p inhibitor includes a miR-380-3p interferor, and the nucleotide sequence of the miR-380-3p interferor is shown in SEQ ID NO.

3.

10. The use according to claim 8, characterized in that: Diseases associated with low CPT1A expression include obesity, fatty liver, cardiovascular disease and insulin resistance.

Images