Mixed DNA library construction method for nanopore sequencing, sequencing detection and application

Abstract

The invention discloses a mixed DNA library construction method for nanopore sequencing, a sequencing method and application, and belongs to the technical field of gene detection. The method comprises the following steps: firstly, carrying out terminal preparation on single strands of different DNAs, namely phosphorylating a 5'terminal and adding a single A basic group to a 3 'terminal; then adding different marker sequences to single chains of different DNAs; and finally, adding a nanopore joint to single chains of different DNAs, and mixing to construct a mixed DNA library construction method and a nanopore sequencing method. The construction method of the mixed DNA library aiming at nanopore sequencing is applied to DNA storage. Different marker sequences are added to different DNA molecules, multiple DNA molecule sequences and modified bases thereof can be detected at the same time, acquisition of single-stranded DNA molecule sequence information can be realized, and meanwhile, the cost is reduced and the batch effect is reduced.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and in particular relates to a mixed DNA library construction method and a sequencing method and application thereof for nanopore sequencing. Background Art

[0002] In recent years, sequencing technology has developed rapidly. From the second generation to the third generation of sequencing, the coding and non-coding genes of many species have been analyzed and identified, and previously unknown biological genetics and developmental issues have been understood from the whole genome level. An indispensable step before sequencing is to construct a standard sample library that can be applied to different sequencing platforms, referred to as library construction. The main purpose of library construction is to bring the sequencing adapter of the sequencing platform so that the library sequence can be accurately detected. The two main platforms for third-generation sequencing are nanopore sequencing of ONT and real-time single-molecule sequencing of PacBio. The current signal generated by the nucleic acid molecule passing through the nanopore protein during nanopore sequencing is the basis for base recognition. On the basis of identifying the four common bases, the nanopore protein can also identify modified nucleic acids through the current changes generated by different modified bases. At present, the nanopore adapters provided by the nanopore sequencing platform do not have a marker sequence, and the marker sequence in its mixed library construction reagent is not suitable for single-stranded DNA, nor is it suitable for specific determination of one of the single strands of double-stranded DNA. The existing nanopore sequencing library construction method is not suitable for simultaneously obtaining the sequences and base modification information of multiple single-stranded DNAs with specific starting sequences, and specific single-stranded sequences in multiple double-stranded DNAs. Therefore, the mixed DNA detection technology based on nanopore sequencing still needs to be improved in the method of constructing libraries. Summary of the invention

[0003] The purpose of the present invention is to provide a mixed DNA library construction method and sequencing method and application for nanopore sequencing, aiming to solve the defect that the existing nanopore library construction method is not suitable for simultaneously obtaining multiple single-stranded DNAs with specific starting sequences, the sequences of specific single strands in multiple double-stranded DNAs, and base modification information.

[0004] In order to achieve the above object, the present invention provides the following technical solutions:

[0005] The present invention provides a method for constructing a mixed DNA library for nanopore sequencing, comprising the following steps: obtaining a mixed DNA library with multiple different marker sequences by adding different markers and connectors to a plurality of single strands of DNA;

[0006] The single-stranded DNA includes a mixture of one or more of single-stranded DNA, a positive strand of double-stranded DNA, or a negative strand of double-stranded DNA;

[0007] When the single strand of the DNA is single-stranded DNA, the method of adding different labels and adapters comprises the following steps: connecting a plurality of single-stranded DNA molecules phosphorylated at the 5' end to adapters of partially double-stranded structures carrying different single-stranded DNA tag sequences, respectively, the ends of the adapters carrying different single-stranded DNA tags are complementary to the 5' ends of the single-stranded DNA carrying the starting sequence, connecting the purified products to the nanopore adapter, and obtaining a nanopore sequencing library of single-stranded DNA with the labels and adapters;

[0008] When the single strand of DNA is the positive strand of double-stranded DNA, the method of adding different labels and adapters comprises the following steps: connecting a plurality of double-stranded DNA molecules whose 5' end of the positive strand is phosphorylated and whose 3' ends of the two strands protrude a single A base with adapters of partially double-stranded structures with different second label sequences, adding a single A base to the 3' end of the connection purified product and then connecting it with a nanopore adapter, the positive strand forms a complete connection product that can be sequenced, and the negative strand cannot be sequenced because of a gap formed by the lack of phosphorylation at the 5' end; obtaining a nanopore sequencing library of the positive strand of double-stranded DNA with the label sequence and adapter;

[0009] When the single strand of DNA is the negative strand of double-stranded DNA, the method for adding different labels and adapters comprises the following steps: connecting a plurality of double-stranded DNA molecules whose 5' end of the negative strand is phosphorylated and whose 3' ends of both strands protrude a single A base, with adapters of partially double-stranded structures having different third labeling sequences, adding a single A base to the 3' end of the connection-purified product and then connecting it with a nanopore adapter, the negative strand forms a complete connection product that can be sequenced, and the positive strand cannot be sequenced because of a gap formed by the lack of phosphorylation at the 5' end; and obtaining a nanopore sequencing library of the negative strand of double-stranded DNA with the labeled sequence and adapter.

[0010] The mixed DNA library with multiple different label sequences is a mixed DNA library of one or more of a nanopore sequencing library with single-stranded DNA labels and adapters, a nanopore sequencing library with double-stranded DNA positive strand label sequences and adapters, or a nanopore sequencing library with double-stranded DNA negative strand label sequences and adapters.

[0011] Preferably, when the single strand of the DNA is single-stranded DNA:

[0012] The plurality of single-stranded DNA molecules with 5' end phosphorylation are obtained by enzyme cutting or DNA phosphokinase catalysis.

[0013] The partially double-stranded structured linker with different single-stranded DNA marker sequences is obtained by high-temperature annealing of the single-stranded DNA marker sequence and the first complementary sequence; the 5' end of the single-stranded DNA marker sequence is phosphorylated, the first complementary sequence is complementary to the single-stranded DNA marker sequence and the 5' ends of several single-stranded DNA molecules at the same time, and after complementation, a single A base protrudes from the 3' end.

[0014] The nanopore adapter is from the DNA library construction kit (SQK-LSK114) of ONT.

[0015] Preferably, when the single strand of the DNA is single-stranded DNA, the method of adding different labels and linkers specifically comprises the following steps:

[0016] (11) Phosphorylation of the 5' ends of several different single-stranded DNA molecules;

[0017] (12) synthesizing a plurality of single-stranded DNA marker sequences and their complementary first complementary sequences, mixing the single-stranded DNA marker sequences and the first complementary sequences in an equal molar ratio and performing annealing treatment to form a partially double-stranded structure linker;

[0018] (13) connecting several different single-stranded DNA molecules in step (11) to the linker in step (12) and purifying;

[0019] (14) connecting the product after passivation in step (13) to a nanopore connector and purifying it;

[0020] (15) The single-stranded DNA molecules with different single-stranded DNA labeling sequences in step (14) are mixed in an equimolar ratio to obtain a nanopore sequencing library with single-stranded DNA labels and adapters.

[0021] Preferably, in step (11), the 5' end phosphorylation of the single-stranded DNA molecule is achieved by enzyme cleavage or DNA phosphokinase catalysis.

[0022] Preferably, in step (12), the number of bases of the single-stranded DNA marker sequence is greater than or equal to 10, and the 5' end is phosphorylated. Further preferably, the single-stranded DNA marker sequence does not exist in the genome or transcriptome of an organism, especially in the genome or transcriptome of model animals such as humans and mice.

[0023] Preferably, the single-stranded DNA marker sequence bases contain modified bases.

[0024] The first complementary sequence is complementary to the 5' end of the single-stranded DNA marker sequence and the target single-stranded DNA molecule at the same time, and a single A base protrudes from the 3' end after complementation. The number of bases in the first complementary sequence is greater than or equal to 20.

[0025] Preferably, in step (13) and step (14), the ligation is performed by T4 DNA ligase; and the purification is performed by DNA purification magnetic beads.

[0026] Preferably, when the single strand of DNA is the plus strand of double strand DNA: the 5' end phosphorylation of the plus strand is obtained by PCR; a primer used in PCR that is identical to the 5' end sequence of the target single strand is phosphorylated at its 5' end, and the other primer is non-phosphorylated at its 5' end.

[0027] The partially double-stranded linker with different second tag sequences is obtained by high temperature annealing of the second tag sequence and the second complementary sequence; the 5' ends of the second tag sequence and the second complementary sequence are phosphorylated, and the 5' end of the second tag sequence protrudes a single T base after being complementary to the second complementary sequence.

[0028] The 3' end protruding single A base is completed by DNA polymerase I large fragment, and the DNA polymerase I large fragment lacks nuclease activity.

[0029] The ligation is completed by T4 DNA ligase; and the purification is completed by DNA magnetic beads.

[0030] The nanopore adapter is from the DNA library construction kit (SQK-LSK114) of ONT.

[0031] Preferably, when the single strand of DNA is the positive strand of double-stranded DNA, the method of adding different labels and adapters specifically comprises the following steps: (21) phosphorylating the 5' end of the target positive strand in a number of different double-stranded DNA molecules;

[0032] (22) Add a single A base to the 3′ end of different double-stranded DNA molecules and purify them;

[0033] (23) synthesizing a plurality of double-stranded DNA marker sequences and complementary second complementary sequences, mixing the double-stranded DNA marker sequences and the second complementary sequences in an equal molar ratio and performing annealing treatment to form a partially double-stranded structure linker;

[0034] (24) connecting the product in step (22) to the linker in step (23) and purifying;

[0035] (25) adding a single A base to the 3' end of the product in step (24) and purifying;

[0036] (26) connecting the product in step (25) to a nanopore connector and purifying;

[0037] (27) The double-stranded DNA molecules with several different double-stranded DNA labeling sequence adapters prepared in step (26) are mixed in an equimolar ratio to obtain the positive strand of the double-stranded DNA with the labeling sequence and adapter.

[0038] Preferably, in step (21), the phosphorylation of the 5' end of the target positive strand in the double-stranded DNA molecule is obtained by PCR; the PCR uses a primer that is partially identical to the 5' end sequence of the target single strand and has a phosphorylated 5' end, while the other primer has a non-phosphorylated 5' end.

[0039] Preferably, in step (22) and step (25), the addition of a single A base to the 3' end is completed by a large fragment of DNA polymerase I, and the large fragment of DNA polymerase I lacks exonuclease activity.

[0040] Preferably, in step (23), the double-stranded DNA marker sequence has a base number greater than or equal to 10 and is phosphorylated at the 5' end, and a single T base protrudes from the 5' end after complementation with the second complementary sequence. Further preferably, the double-stranded DNA marker sequence does not exist in the genome or transcriptome of an organism, especially in the genome or transcriptome of a model animal such as a human or a mouse.

[0041] Preferably, the double-stranded DNA marker sequence bases contain modified bases.

[0042] Preferably, the second complementary sequence has 10 or more bases and the 5' end is phosphorylated.

[0043] Preferably, in step (24) and step (26), the ligation is performed by T4 DNA ligase; and the purification is performed by DNA purification magnetic beads.

[0044] Preferably, when the single strand of the DNA is the negative strand of the double stranded DNA:

[0045] The partially double-stranded linker with different third tag sequences is obtained by high temperature annealing of the third tag sequence and the third complementary sequence. The 5' ends of the third tag sequence and the third complementary sequence are phosphorylated, and the 5' end of the third tag sequence protrudes a single T base after being complementary to the third complementary sequence. The 3' end protruding a single A base is completed by a large fragment of DNA polymerase I, and the large fragment of DNA polymerase I lacks nuclease exonuclease activity.

[0046] The ligation is completed by T4 DNA ligase; and the purification is completed by DNA magnetic beads.

[0047] Preferably, the first marker sequence, the second marker sequence and the third marker sequence are different marker sequences.

[0048] Preferably, the first marker sequence, the second marker sequence, the third marker sequence and the first complementary sequence, the second complementary sequence, and the third complementary sequence are all synthesized by a primer company.

[0049] Preferably, the nanopore adapter is from ONT's DNA library construction kit (SQK-LSK114).

[0050] Preferably, the 5' end phosphorylation of the negative strand is obtained by PCR; one primer used in the PCR that is identical to the 5' end sequence of the target single strand is phosphorylated at its 5' end, and the other primer is non-phosphorylated at its 5' end.

[0051] Preferably, when the single strand of DNA is the negative strand of double-stranded DNA, the specific method of adding different labels and connectors is consistent with the method when the single strand of DNA is the negative strand of double-stranded DNA, and the positive strand and the negative strand information are exchanged.

[0052] The mixed DNA library for nanopore sequencing constructed by the present invention can be a mixed DNA library of one or more of a nanopore sequencing library of single-stranded DNA plus a label and a connector, a nanopore sequencing library of the positive strand of double-stranded DNA plus a label sequence and a connector, and a nanopore sequencing library of the positive strand of double-stranded DNA plus a label sequence and a connector.

[0053] A nanopore sequencing detection is performed based on the mixed DNA library for nanopore sequencing constructed as above.

[0054] The above-mentioned mixed DNA library construction method for nanopore sequencing is applied in DNA storage.

[0055] The application in DNA storage is specifically embodied in: encoding information into single-stranded DNA or double-stranded DNA, the single-stranded DNA and the double-stranded DNA store information through different sequences and different base modifications, and after constructing the above-mentioned mixed DNA library, the sequence information and base modification information of the specific single strand of single-stranded DNA and double-stranded DNA are detected by nanopore sequencing, and then the information stored in the DNA is read by decoding. In the above process, nanopore sequencing can simultaneously measure multiple marker sequence information, with a high detection efficiency. Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0056] The present invention provides a hybrid DNA library construction method and sequencing method and application for nanopore sequencing, which is suitable for samples that want to simultaneously obtain multiple single-stranded DNAs with specific starting sequences, specific single-stranded sequences in multiple double-stranded DNAs, and base modification information. The method allows multi-sample hybrid nanopore sequencing, adds different marker sequences to different DNA molecules, can simultaneously detect multiple DNA molecule sequences and their modified bases, and can achieve the acquisition of single-stranded DNA molecule sequence information, which can not only reduce costs, but also reduce the differences caused by sample sequencing batches. The method can detect sequence information and multiple modified bases on single-stranded DNA molecules, and can be used for obtaining single-stranded DNA sequence information in DNA storage, expanding the capacity of DNA storage. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 This is a flow chart of the single-stranded DNA molecule library construction in Example 1 of the present invention.

[0058] Figure 2 This is a diagram of the detection and decoding results of single-stranded DNA modified bases in Example 1 of the present invention.

[0059] Figure 3 The flowchart of the construction of the plus-strand-specific and minus-strand-specific libraries of double-stranded DNA molecules in Example 2 of the present invention is shown.

[0060] Figure 4 This is a result diagram showing the proportion of positive strand detection and negative strand detection in the total results and the distribution of different markers in double-stranded DNA sequencing in Example 2 of the present invention.

[0061] Figure 5 This is a diagram showing the detection results of various non-natural modified bases in single-stranded specific sequencing of double-stranded DNA analysis in Example 2 of the present invention. DETAILED DESCRIPTION

[0062] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0063] In addition, if there are descriptions involving "first", "second", etc. in the embodiments of the present invention, the descriptions of "first", "second", etc. are only used for descriptive purposes and cannot be understood as indicating or suggesting their relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include at least one of the features. In addition, the technical solutions between the various embodiments can be combined with each other, but they must be based on the ability of ordinary technicians in the field to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be deemed that such a combination of technical solutions does not exist and is not within the scope of protection required by the present invention.

[0064] At present, the existing nanopore library construction method is not suitable for the situation where you want to simultaneously obtain multiple single-stranded DNAs with specific starting sequences, specific single-stranded sequences in multiple double-stranded DNAs, and base modification information. In order to solve the above technical problems, the present invention proposes a mixed DNA library construction method and sequencing method and application for nanopore sequencing.

[0065] The encoding and decoding rules of DNA storage used in the embodiments of the present invention adopt the encoding and decoding rules described in Chinese patent CN202210879914.4.

[0066] Embodiment 1:

[0067] like Figure 1 As shown, a hybrid DNA library construction method and sequencing method for nanopore sequencing (for hybrid single-stranded DNA nanopore sequencing in DNA storage), the specific steps are as follows:

[0068] 1. Single-stranded DNA preparation (phosphorylation of the 5' ends of several different single-stranded DNA molecules;)

[0069] 1) Three groups of three single-stranded DNA molecules with 5'-terminal phosphorylation were synthesized. The first group did not contain any modified bases and served as the control group. The three sequences were marked as 1, 2, and 3, respectively. The three DNA sequences of the second and third groups were consistent with the three DNA sequences in the first group. The second group contained the modified base 5mC (the specific sequence was TTATCTGACTAACGAGCAGCAATCAGACGTCATATCGGCACTGCTTGCTTTCGAA / i5MedC / GTCATCGACGCGACACAACAGCTACGTCGTCATAGCAGTCTACACAT), and the DNA storage information was "Hello world!". The third group contained the modified base 6mA (the specific sequence was

[0070] TTATCTGACTCCACATCTACGACACAATCCTACCCACCCACCCACCCACCC / 6-MedA / CCCACCCACCCACCCACCCACCCACCCACCCACCCACCCACCCACCCACCG), the DNA storage information is "Hello DNA!".

[0071] 2) The concentration of single-stranded DNA molecules was detected using Qubit, and 200 ng of each single-stranded DNA molecule was taken for subsequent library construction.

[0072] 2. Preparation of partial double-stranded adapters with labeled sequences

[0073] 1) Synthesize 6 marker sequences and their complementary sequences. The 5' end of the marker sequence is phosphorylated. The sequence is as follows:

[0074] Tag sequence 1: CACAAAGACACCGACAACTTTCTTACGCGATATC (SEQ ID No. 1)

[0075] Complementary sequence 1: AGTCAGATAAGATATCGCGTAAGAAAGTTGTCGGTGTCTTTGTGA (SEQ ID No. 2)

[0076] Tag sequence 2: ACAGACGACTACAAACGGAATCGAACGCGATATC (SEQ ID No. 3)

[0077] Complementary sequence 2: AGTCAGATAAGATATCGCGTTCGATTCCGTTTGTAGTCGTCTGTA (SEQ ID No. 4)

[0078] Tag sequence 3: CCTGGTAACTGGGACACAAGACTCACGCGATATC (SEQ ID No. 5)

[0079] Complementary sequence 3: AGTCAGATAAGATATCGCGTGAGTCTTGTGTCCCAGTTACCAGGA (SEQ ID No. 6)

[0080] 2) Mix the marker sequence and its complementary sequence in a 1:1 ratio, and then place them in a PCR instrument for annealing. The annealing procedure is as follows:

[0081] 95℃2minutes

[0082] Ramp 95℃to 75℃(Rate:0.1℃ / second)Hold at 75℃2minutes;

[0083] Ramp 75℃to 65℃(Rate:0.1℃ / second)Hold at 65℃2minutes;

[0084] Ramp 65℃to 50℃(Rate of 0.1℃ / second)Hold at 50℃2minutes;

[0085] Ramp 50℃to 37℃(Rate of 0.1℃ / second)Hold at 37℃2minutes;

[0086] Ramp 37℃to 20℃(Rate of 0.1℃ / second)Hold at 20℃2minutes;

[0087] Ramp 20℃to 4℃(Rate of 0.1℃ / second)Hold at 4℃Indefinitely until collection.

[0088] 3) The joint generated by annealing the marker sequence 1 and the complementary sequence 1 is marked as joint 1, the joint generated by annealing the marker sequence 2 and the complementary sequence 2 is marked as joint 2, and the joint generated by annealing the marker sequence 3 and the complementary sequence 3 is marked as joint 3.

[0089] 3. Connect the single-stranded DNA molecule to the adapter with the labeled sequence

[0090] 1) Take 200 ng of single-stranded DNA molecules, add the corresponding adapters at a molar ratio of 1:10 (add adapters 1, 2 and 3 to the single-stranded DNA molecules marked as 1, 2 and 3), add 2.5 μL T4 DNA ligase (NEB, M0202) and 5 μL 10×ligation buffer respectively, and finally add water to make up to 50 μL.

[0091] 2) The ligation reaction was carried out in a PCR instrument at 20°C for 20 minutes.

[0092] 3) The product of the ligation reaction was purified using DNA magnetic beads (Vazyme, N411), and the DNA was finally dissolved in enzyme-free water.

[0093] 4. Connect single-stranded DNA molecules with different tag sequences to nanopore adapters

[0094] 1) All reagents used in this step were from the SQK-LSK114 kit of ONT, and the ligase was from NEB (M2200).

[0095] 2) Mix 30 μL of single-stranded DNA molecules with labeled sequences with 12.5 μL of LNB, 5 μL of Quick ligase, and 2.5 μL of LA, and react at room temperature for 5 minutes.

[0096] 3) The ligation product was purified using DNA magnetic beads, and the magnetic beads were washed with SFB provided by the kit, and finally eluted with EB.

[0097] 4) Use Qubit to detect library concentration.

[0098] 5. Hybrid sequencing

[0099] 1) All reagents used in this step are from the SQK-LSK114 kit of ONT.

[0100] 2) The three single-stranded DNA molecule libraries were mixed in an equal molar ratio and supplemented to 32 μL with EB.

[0101] 3) Add 100 μL SB and 68 μL LIB, and mix well with a pipette.

[0102] 4) Follow the instructions in the SQK-LSK114 kit to load the instrument.

[0103] 6. Sequencing data analysis

[0104] Nanopore sequencing and analysis results show that the sequence and modification information of single-stranded DNA can be well obtained, such as Figure 2 As shown in Figure 2, "Hello world!" and "Hello DNA!" are encoded into two different single-stranded DNAs with 5mC and 6mA, respectively. Figure 1 The mixed DNA library of single-stranded DNA in the medium was constructed, sequenced and analyzed to accurately obtain the sequence and modification information of two single-stranded DNA molecules with modified bases 5mC and 6mA, which can be restored to "Hello world!" and "Hello DNA!" after decoding.

[0105] Example 2

[0106] like Figure 3 As shown, a mixed DNA library construction method and sequencing method for nanopore sequencing (detecting a variety of non-natural modified bases of specific single strands in double-stranded DNA chains, and the library construction method can also be used for DNA storage), the specific steps are as follows:

[0107] 1. Double-stranded DNA preparation

[0108] 1) Different modified base deoxynucleotides (5-Cl-dU, 5-Br-dU, 5-I-dU, 5-Me-dC, 5-F-dC, 7-deaza-dA, 6-Me-dA and 2-amino-dA) were mixed with other 3 conventional deoxynucleotides as raw materials, and one oligonucleotide with 5' end phosphorylation modification and another oligonucleotide without modification were used as primers to synthesize 8 double-stranded DNAs with non-natural modified bases and 1 double-stranded DNA without modified bases by PCR. The template is as described in SEQ ID No.7; the primer sequences are as follows:

[0109] Upstream primer: TAATACGACTCACTATAGGGAACTGGCCGGTACCTGAGCTC (SEQ ID No. 8)

[0110] Downstream primer: CTCCCCCTGAACCTGAAACATA (SEQ ID No. 9)

[0111] 2) Purify the PCR product with DNA magnetic beads, dissolve the DNA with enzyme-free water and detect the concentration with Qubit.

[0112] 3) Take 500 ng of each double-stranded DNA, add 0.5 μL 10 mM dATP (NEB, N0440), 5 μL 10× buffer and 1.5 μL Klenow Fragment (3'→5'exo-, NEB, M0212), and finally add water to make up to 50 μL. Place in a PCR instrument and run at 37°C for 30 minutes.

[0113] 4) Purify the product with DNA magnetic beads and dissolve the DNA in enzyme-free water.

[0114] 2. Preparation of partial double-stranded adapters with labeled sequences

[0115] 1) 18 marker sequences and their complementary sequences were synthesized. Both the marker sequences and the complementary sequences were phosphorylated at the 5' end. The sequences are as follows:

[0116] Tag sequence 4: CACAAAGACACCGACAACTTTCTT (SEQ ID No. 10)

[0117] Complementary sequence 4: AAGAAAGTTGTCGGTGTCTTTGTGT (SEQ ID No. 11)

[0118] Tag sequence 5: ACAGACGACTACAAACGGAATCGA (SEQ ID No. 12)

[0119] Complementary sequence 5: TCGATTCCGTTTGTAGTCGTCTGTT (SEQ ID No. 13)

[0120] Tag sequence 6: CCTGGTAACTGGGACACAAGACTC (SEQ ID No. 14)

[0121] Complementary sequence 6: GAGTCTTGTGTCCCAGTTACCAGGT (SEQ ID No. 15)

[0122] Tag sequence 7: TAGGGAAACACGATAGAATCCGAA (SEQ ID No. 16)

[0123] Complementary sequence 7: TTCGGATTCTATCGTGTTTCCCTAT (SEQ ID No. 17)

[0124] Tag sequence 8: AAGGTTACACAAACCCTGGACAAG (SEQ ID No. 18)

[0125] Complementary sequence 8: CTTGTCCAGGGTTTGTGTAACCTTT (SEQ ID No. 19)

[0126] Tag sequence 9: GACTACTTTCTGCCTTTGCGAGAA (SEQ ID No. 20)

[0127] Complementary sequence 9: TTCTCGCAAAGGCAGAAAGTAGTCT (SEQ ID No. 21)

[0128] Marker sequence 10: AAGGATTCATTCCCACGGTAACAC (SEQ ID No. 22)

[0129] Complementary sequence 10: GTGTTACCGTGGGAATGAATCCTTT (SEQ ID No. 23)

[0130] Marker sequence 11: ACGTAACTTGGTTTGTTCCCTGAA (SEQ ID No. 24)

[0131] Complementary sequence 11: TTCAGGGAACAAACCAAGTTACGTT (SEQ ID No. 25)

[0132] Tag sequence 12: AACCAAGACTCGCTGTGCCTAGTT (SEQ ID No. 26)

[0133] Complementary sequence 12: AACTAGGCACAGCGAGTCTTGGTTT (SEQ ID No. 27)

[0134] 2) The marker sequence and its complementary sequence are mixed in a one-to-one correspondence at a ratio of 1:1, and then placed in a PCR instrument for annealing. The annealing procedure is shown in Example 1.

[0135] 3) The joint generated by annealing the marker sequence 4 and the complementary sequence 4 is marked as joint 4, the joint generated by annealing the marker sequence 5 and the complementary sequence 5 is marked as joint 5, the joint generated by annealing the marker sequence 6 and the complementary sequence 6 is marked as joint 6, and so on.

[0136] 3. Connect the double-stranded DNA molecule to the adapter with the labeled sequence

[0137] 1) Add different adapters to the prepared double-stranded DNA molecules at a molar ratio of 1:20, then add 2.5 μL T4 DNA ligase (NEB, M0202) and 5 μL 10×ligation buffer, and finally add water to make up to 50 μL.

[0138] 2) See Example 1 for subsequent ligation and purification.

[0139] 4. Connect the double-stranded DNA molecule with the labeled sequence to the nanopore adapter

[0140] 1) The sources of the reagents used in this step are shown in Example 1.

[0141] 2) Mix 30 μL of double-stranded DNA molecules with labeled sequences with 12.5 μL of LNB, 5 μL of Quick ligase, and 2.5 μL of LA, and react at room temperature for 5 minutes.

[0142] 3) The ligation product was purified using DNA magnetic beads, and the magnetic beads were washed with SFB provided by the kit, and finally eluted with EB.

[0143] 4) Use Qubit to detect library concentration.

[0144] 5. Hybrid sequencing

[0145] 1) The sources of the reagents used in this step are shown in Example 1.

[0146] 2) 9 double-stranded DNA molecule libraries were mixed in equal molar ratios and supplemented to 32 μL with EB.

[0147] 3) Add 100 μL SB and 68 μL LIB, and mix well with a pipette.

[0148] 4) Follow the instructions in the SQK-LSK114 kit to load the instrument.

[0149] 6. Sequencing data analysis

[0150] Based on 8 double-stranded DNAs with non-natural modified bases and 1 double-stranded DNA without modified bases, Figure 3 The positive strand specific sequencing of double-stranded DNA and the negative strand specific sequencing of double-stranded DNA were carried out respectively. Figure 4 As shown in the figure, the positive strand-specific sequencing of double-stranded DNA mainly detected the positive strand (the proportion of the positive strands of the 9 DNA species in the total results was more than 98%), and the negative strand-specific sequencing of double-stranded DNA mainly detected the negative strand (the proportion of the negative strands of the 9 DNA species in the total results was more than 98%), and there was no significant difference in the results of the 9 DNA molecules; and as shown in the figure Figure 5 As shown, signal differences between non-natural modified bases and conventional bases, as well as signal differences between different types of modifications, were detected. The figure shows the results of comparative analysis of unmodified A and three different A modifications (7-deaza-dA, 6-Me-dA and 2-amino-dA), demonstrating its potential for DNA storage.

[0151] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0152] The present invention provides a hybrid DNA library construction method and sequencing method and application for nanopore sequencing, which is suitable for samples that want to simultaneously obtain multiple single-stranded DNAs with specific starting sequences, specific single-stranded sequences in multiple double-stranded DNAs, and base modification information. The method allows multi-sample hybrid nanopore sequencing, which can not only reduce costs, but also reduce the differences caused by sample sequencing batches. The method can detect sequence information and modified bases on single-stranded DNA molecules, and can be used to obtain information on single-stranded DNA sequences and base modifications in DNA storage.

[0153] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for constructing a mixed DNA library for nanopore sequencing, characterized in that: The following steps are involved: By adding different labels and adapters to several single strands of DNA, a mixed DNA library with multiple different label sequences is obtained; The single-stranded DNA includes a mixture of one or more of single-stranded DNA, a positive strand of double-stranded DNA, or a negative strand of double-stranded DNA; When the single strand of the DNA is single-stranded DNA, the method of adding different labels and adapters comprises the following steps: connecting a plurality of single-stranded DNA molecules phosphorylated at the 5' end to adapters of partially double-stranded structures carrying different single-stranded DNA tag sequences, respectively, the ends of the adapters carrying different single-stranded DNA tags are complementary to the 5' ends of the single-stranded DNA carrying the starting sequence, connecting the purified products to the nanopore adapter, and obtaining a nanopore sequencing library of single-stranded DNA with the labels and adapters; When the single strand of DNA is the positive strand of double-stranded DNA, the method of adding different labels and adapters comprises the following steps: connecting a plurality of double-stranded DNA molecules whose 5' ends of the positive strands are phosphorylated and whose 3' ends of the two strands protrude a single A base with adapters of partially double-stranded structures carrying different second labeling sequences, adding a single A base to the 3' end of the connection purified product and then connecting it with a nanopore adapter to obtain a nanopore sequencing library of the positive strand of the double-stranded DNA with the labeled sequence and adapter; When the single strand of DNA is the negative strand of double-stranded DNA, the method of adding different labels and adapters comprises the following steps: connecting a plurality of double-stranded DNA molecules whose 5' end of the negative strand is phosphorylated and whose 3' ends of both strands protrude a single A base with adapters of partially double-stranded structures carrying different third labeling sequences, adding a single A base to the 3' end of the connection purified product and then connecting it with a nanopore adapter to obtain a nanopore sequencing library of the negative strand of the double-stranded DNA with the labeled sequence and adapter; The mixed DNA library with multiple different label sequences is a mixed DNA library of one or more of a nanopore sequencing library with single-stranded DNA labels and adapters, a nanopore sequencing library with double-stranded DNA positive strand label sequences and adapters, or a nanopore sequencing library with double-stranded DNA negative strand label sequences and adapters.

2. The method for constructing a mixed DNA library for nanopore sequencing according to claim 1, characterized in that: When the single strand of the DNA is single-stranded DNA: The plurality of single-stranded DNA molecules phosphorylated at the 5' end are obtained by enzyme digestion or DNA phosphokinase catalysis; The partially double-stranded structured linker with different single-stranded DNA marker sequences is obtained by high-temperature annealing of the single-stranded DNA marker sequence and the first complementary sequence; the 5' end of the single-stranded DNA marker sequence is phosphorylated, the first complementary sequence is complementary to the single-stranded DNA marker sequence and the 5' ends of several single-stranded DNA molecules at the same time, and after complementation, a single A base protrudes from the 3' end.

3. The method for constructing a mixed DNA library for nanopore sequencing according to claim 1, characterized in that: When the single strand of the DNA is single-stranded DNA, the method of adding different labels and linkers specifically comprises the following steps: (11) Phosphorylation of the 5' ends of several different single-stranded DNA molecules; (12) synthesizing a plurality of single-stranded DNA marker sequences and their complementary first complementary sequences, mixing the single-stranded DNA marker sequences and the first complementary sequences in an equal molar ratio and performing annealing treatment to form a partially double-stranded structure linker; (13) connecting several different single-stranded DNA molecules in step (11) to the linker in step (12) and purifying; (14) connecting the product after passivation in step (13) to a nanopore connector and purifying it; (15) The single-stranded DNA molecules with different single-stranded DNA labeling sequences in step (14) are mixed in an equimolar ratio to obtain a nanopore sequencing library with single-stranded DNA labels and adapters.

4. The method for constructing a mixed DNA library for nanopore sequencing according to claim 3, characterized in that: In step (11), the 5' end phosphorylation of the single-stranded DNA molecule is obtained by enzyme cleavage or DNA phosphokinase catalysis; In step (12), the number of bases of the single-stranded DNA marker sequence is greater than or equal to 10, and the 5' end is phosphorylated; the single-stranded DNA marker sequence does not exist in the genome or transcriptome of the organism; The single-stranded DNA marker sequence bases include modified bases; The first complementary sequence is complementary to the 5' end of the single-stranded DNA marker sequence and the target single-stranded DNA molecule at the same time, and a single A base protrudes from the 3' end after complementation, and the number of bases in the first complementary sequence is greater than or equal to 20; In step (13) and step (14), the ligation is accomplished by T4 DNA ligase; and the purification is accomplished by DNA purification magnetic beads.

5. The method for constructing a mixed DNA library for nanopore sequencing according to claim 1, characterized in that: When the single strand of the DNA is the positive strand of double-stranded DNA: The phosphorylation of the 5' end of the positive strand is obtained by PCR; a primer used in the PCR that is identical to the 5' end sequence of the target single strand is phosphorylated at the 5' end, and the 5' end of the other primer is non-phosphorylated; The partially double-stranded linker with different second tag sequences is obtained by high-temperature annealing of the second tag sequence and the second complementary sequence; the 5' ends of the second tag sequence and the second complementary sequence are phosphorylated, and the 5' end of the second tag sequence protrudes a single T base after being complementary to the second complementary sequence; The 3' end protruding single A base is completed by DNA polymerase I large fragment, and the DNA polymerase I large fragment lacks nuclease activity.

6. The method for constructing a mixed DNA library for nanopore sequencing according to claim 1, characterized in that: When the single strand of the DNA is the positive strand of the double-stranded DNA, the method of adding different labels and adapters specifically comprises the following steps: (21) Phosphorylation of the 5′ end of the target positive strand in several different double-stranded DNA molecules; (22) Add a single A base to the 3′ end of different double-stranded DNA molecules and purify them; (23) synthesizing a plurality of double-stranded DNA marker sequences and complementary second complementary sequences, mixing the double-stranded DNA marker sequences and the second complementary sequences in an equal molar ratio and performing annealing treatment to form a partially double-stranded structure linker; (24) connecting the product in step (22) to the linker in step (23) and purifying; (25) adding a single A base to the 3' end of the product in step (24) and purifying; (26) connecting the product in step (25) to a nanopore connector and purifying; (27) The double-stranded DNA molecules with several different double-stranded DNA labeling sequence adapters prepared in step (26) are mixed in an equimolar ratio to obtain the positive strand of the double-stranded DNA with the labeling sequence and adapter.

7. The method for constructing a mixed DNA library for nanopore sequencing according to claim 6, characterized in that: In step (21), the phosphorylation of the 5' end of the target positive strand in the double-stranded DNA molecule is obtained by PCR; the 5' end of a primer used in the PCR that is identical to the 5' end sequence of the target single strand is phosphorylated, and the 5' end of another primer is non-phosphorylated; In step (22) and step (25), the addition of a single A base to the 3' end is completed by a large fragment of DNA polymerase I, and the large fragment of DNA polymerase I lacks exonuclease activity; In step (23), the double-stranded DNA marker sequence has a base number greater than or equal to 10 and is phosphorylated at the 5' end, and after complementation with the second complementary sequence, a single T base protrudes from the 5' end; the double-stranded DNA marker sequence does not exist in the genome or transcriptome of the organism; The double-stranded DNA marker sequence bases include modified bases; The second complementary sequence has a base number greater than or equal to 10 and the 5' end is phosphorylated.

8. The method for constructing a mixed DNA library for nanopore sequencing according to claim 1, characterized in that: The first marker sequence, the second marker sequence, and the third marker sequence are different marker sequences.

9. A nanopore sequencing assay, characterized in that: Nanopore sequencing detection is performed based on a mixed DNA library for nanopore sequencing obtained by the construction method according to any one of claims 1 to 8.

10. The method for constructing a mixed DNA library for nanopore sequencing according to any one of claims 1 to 9 is used in DNA storage, characterized in that: The information is encoded into single-stranded DNA or double-stranded DNA. The single-stranded DNA and the double-stranded DNA store information through different sequences and different base modifications. After constructing the above-mentioned mixed DNA library, nanopore sequencing is used to detect the sequence information and base modification information of the specific single strand of the single-stranded DNA and double-stranded DNA, and then the information stored in the DNA is read through decoding.

Images