SNP (Single Nucleotide Polymorphism) marker for identifying bee colony royal jelly high-yield character of western bees and application of SNP marker

Abstract

The invention relates to an SNP (Single Nucleotide Polymorphism) marker for identifying the high-yield character of bee colony royal jelly of western bees and application thereof. The SNP marker is selected from NC037641.110806386 and NC037641.110806436, and the SNP marker is selected from the group consisting of NC037641.110806436 The method comprises the following steps: randomly collecting adult worker bee individuals from a to-be-detected western bee colony, extracting genome DNA as a template, and carrying out PCR amplification reaction to obtain a PCR reaction product; carrying out agarose gel electrophoresis detection on the obtained PCR reaction product, and sequencing the PCR reaction liquid with a target band; and analyzing the sequencing result, calculating the gene frequency of the NC037641.110806386 site or the NC037641.110806436 site of the western bee colony to be detected, and determining whether the western bee colony to be detected is a bee colony with high royal jelly yield or not. The two SNP markers related to the high-yield character of the bee royal jelly of the western bees are provided from the molecular biology level, and the two SNP markers comprise target fragments amplified by the same pair of specific primers, so that the high-yield character of the bee royal jelly of a bee colony of the western bees can be scientifically, accurately and quickly identified, the breeding period of the bees with high royal jelly yield can be greatly shortened, and the breeding efficiency of the bees with high royal jelly yield can be improved. The breeding speed is accelerated.

Description

Technical Field

[0001] The invention relates to a method for identifying a high-yield trait of royal jelly in a honey bee colony, and in particular to a SNP marker for identifying a high-yield trait of royal jelly in a western honey bee colony and an application thereof, belonging to the field of biotechnology. Background Art

[0002] Royal jelly is one of the main products of my country's bee industry. It can regulate the development and differentiation of bees, and also has important health value for human health. Royal jelly has important pharmacological effects in fighting Alzheimer's disease and regulating blood sugar. Royal jelly has antibacterial effects, and its main active substance 10-HDA has an inhibitory effect on Staphylococcus aureus and Escherichia coli. 10-HDA also has the effect of inhibiting tumor cell proliferation and promoting cell apoptosis. Therefore, it is widely used in improving human health, medicine, health products and cosmetics.

[0003] my country is a major producer of royal jelly, accounting for more than 90% of the world's total, with an annual production of about 4,000 tons, which is closely related to the variety of bees raised in my country. In 1910, Italian honey bees were introduced, and their royal jelly production was about 0.5 to 1 kg per colony per year, which was extremely low. In the last century, numerous scientists and beekeepers in my country conducted breeding research on this bee species, and collected high-yield royal jelly bee colonies in Hangzhou, Pinghu, Jiaxing, Tonglu, Shaoxing and Longyou as breeding objects. After years of directional breeding and group closed breeding, using Taihu island isolation and artificial insemination technology, a new strain of Italian bees with excellent production performance and stable genetic traits was cultivated - "Zhejiang Agricultural University No. 1" Italian bees, whose royal jelly production exceeds 10kg per colony per year, with advantages such as fast reproduction, strong honey collection ability, strong disease resistance, high royal jelly production, strong insect breeding ability and docile temperament. Later, high-yield royal jelly bee species such as Pinghu bees and Xiaoshan bees were cultivated. Therefore, the cultivation of high-yield royal jelly bee species has received more and more attention and brought great economic benefits.

[0004] For a long time, my country's beekeeping scientific and technological workers have been committed to the research of royal jelly high-yielding bees, discovered the mechanism of royal jelly high production and many genetic markers related to royal jelly high-yielding traits, strengthened the conservation and breeding of royal jelly high-yielding bees, and fully utilized the advantages of my country's excellent bee species resources. The research on molecular genetic markers related to royal jelly high-yielding traits and SNP technology is summarized as follows: 1. Research on molecular genetic markers related to high royal jelly production In beekeeping, the high production of royal jelly in a bee colony has always been an important factor that beekeepers pay attention to. In order to more accurately and efficiently determine whether a bee colony is a high-production royal jelly colony, scientists have conducted in-depth research on molecular genetic marker technology to find molecular markers related to high royal jelly production traits, thereby providing a scientific basis for bee breeding and selection.

[0005] Molecular genetic markers are one of the important means in modern biotechnology. They analyze specific sequences or gene polymorphisms in the genome of organisms to explore the relationship between these markers and target traits. In the study of high-yield royal jelly traits of honey bees, researchers have widely used several molecular genetic marker technologies, including random amplified polymorphic DNA-PCR (RAPD-PCR) analysis, microsatellite DNA analysis, and gene chip technology.

[0006] For high-yield bee species of different strains, such as "Zhejiang Agricultural University No. 1", Pinghu honey bee and Xiaoshan honey bee, researchers found a specific DNA sequence fragment W316bp, which is common in worker bees but not in drones, indicating that the fragment may be associated with the high-yield trait of royal jelly. Through experimental verification, W316bp was confirmed as a reliable molecular marker for high-yield trait of royal jelly. Microsatellite DNA analysis provides another important molecular marker method; by analyzing the microsatellite loci of different bee species, specific microsatellite markers related to the high-yield trait of royal jelly were found. Among them, the microsatellite markers of "Zhejiang Agricultural University No. 1" bees showed their particularity in evolutionary history and were closely related to their high-yield traits; with the advancement of gene chip technology, researchers can screen genes related to the high-yield trait of royal jelly in a wider range of genomes. Through gene expression analysis of high-yield and low-yield bee species, multiple differentially expressed genes were found, which are involved in biological processes such as the olfactory system, nervous system and glandular function of bees. In particular, several upregulated genes such as dop2, SsRbeta and hex71 were considered to be potential molecular markers for high royal jelly production.

[0007] The research on molecular genetic markers related to high-yield royal jelly has achieved certain results, but it still faces some challenges and limitations. Traditional molecular marker methods such as RAPD-PCR and microsatellite analysis have the defects of narrow screening range and cannot fully cover all potential markers of the genome. Although gene chip technology can efficiently screen out potential molecular markers, the technology is complicated to operate and has high cost, which limits its popularity in large-scale applications. Therefore, more mature and scientific molecular technologies need to be adopted in the future to study the genetic basis of high-yield royal jelly more comprehensively and accurately. Finding a molecular marker method that is easy to operate, highly reliable and low-cost is of great significance to the development of bee breeding industry. This will provide scientific breeding strategies for the beekeeping industry, help improve the production efficiency of royal jelly of bees, and thus promote the sustainable development of the bee breeding industry.

[0008] 2. SNP technology Single nucleotide polymorphism (SNP) is known as the third generation of DNA molecular markers. It refers to the difference between individual nucleotides between different alleles at the same site. The most common is the replacement of a single nucleotide, which often occurs between purine bases (A and G) and pyrimidine bases (C and T). SNP markers can help distinguish the differences in genetic material between two individuals and are considered to be one of the genetic markers with the best application prospects. At present, the SNP information of the genome can be accurately obtained by extracting genomic DNA and randomly interrupting it, adding adapters, sequencing on a machine, and bioinformatics analysis, and SNP molecular markers related to specific traits can be screened out.

[0009] As a new generation of biotechnology, SNP technology has high practical value, its application in the field of human diseases is relatively mature, and it has made certain progress. However, the research and application of this technology in the molecular markers of high royal jelly production in Western honey bees are still relatively small. Therefore, this method uses SNP technology to identify the high royal jelly production traits of adult worker bees of Western honey bees, based on which high royal jelly production bees can be selected accurately, efficiently and quickly for breeding, and even lay a good foundation for breeding better quality jelly-producing bees through genetic means. Summary of the invention

[0010] The purpose of the present invention is to provide a SNP marker for identifying the high-yield trait of royal jelly of a honey bee colony and an application thereof.

[0011] The purpose of the present invention is achieved through the following technical solutions: A SNP marker for identifying the high-yield trait of royal jelly in a western honey bee colony, wherein the SNP marker is selected from NC_037641.1_10806386 and NC_037641.1_10806436, wherein NC_037641.1_10806386 is the base T or C at position 10806386 of chromosome 4 of the western honey bee, and NC_037641.1_10806436 is the base T or G at position 10806436 of chromosome 4 of the western honey bee.

[0012] A primer for detecting the above SNP marker, wherein the forward primer sequence of the primer is: 5'-TGTTCACTTGTCGAGTGCGAAG-3', and the reverse primer sequence is: 5'-ACCAGCGATACTTAAGCGGACA-3'; the size of the target fragment amplified by the primer is 688 bp.

[0013] The application of the above-mentioned SNP markers and primers in identifying the high-yield royal jelly traits of western honey bee colonies.

[0014] Application of the above-mentioned SNP markers and primers in western honey bee breeding.

[0015] A method for identifying the high-yield royal jelly trait of a western honey bee colony using the above-mentioned SNP marker, which comprises randomly collecting adult honey bee worker individuals from the western honey bee colony to be tested, extracting genomic DNA; using the extracted genomic DNA as a template, performing a PCR amplification reaction using the primers described in claim 2 to obtain a PCR reaction product; performing agarose gel electrophoresis detection on the obtained PCR reaction product, and sequencing the PCR reaction solution with the target band; analyzing the sequencing results, and calculating the gene frequency of the SNP marker site of the western honey bee colony to be tested; Further, the gene frequency of the NC_037641.1_10806386 locus of the tested honey bee colony is calculated. When the T allele frequency of the tested honey bee colony is significantly greater than the C allele frequency, the tested honey bee colony is a high-yield royal jelly colony; the significant refers to statistical P<0.01; Further, the gene frequency of the NC_037641.1_10806436 locus of the tested honey bee colony is calculated. When the T allele frequency of the tested honey bee colony is significantly greater than the G allele frequency, the tested honey bee colony is a high-producing royal jelly colony; the significance refers to statistical P<0.001.

[0016] Beneficial effects of the present invention: The method of using SNP markers (NC_037641.1_10806386; NC_037641.1_10806436) to identify the high-yield royal jelly trait of Western honey bee colonies in the present invention has been strictly screened and verified. The samples used in the study came from a high-yield royal jelly bee farm and a low-yield royal jelly bee farm in Yancheng, Jiangsu Province during the rapeseed flowering period in my country. In the bee farm, 100 groups of Western honey bees in the high-yield royal jelly colony and the low-yield royal jelly colony were marked as experimental bee colonies as research objects, and the genomic DNA of the honey bee samples was extracted, and the purity, concentration and integrity were tested. The library of the qualified samples was constructed, and the Illumina Novaseq6000PE150 sequencing platform was used for double-end sequencing, and the sequencing data was subjected to data quality control and processing. After obtaining high-quality sequencing data after quality control of each sample of high and low royal jelly production, SNPs were obtained by Samtools detection. By θ π Ratio(θ πHRJB / θ πLRJB ) analysis method preliminarily screened out 20 SNPs related to high royal jelly production traits. The preliminarily screened SNPs were verified by PCR and DNA sequencing technology on samples of high and low royal jelly producing Western honey bees, and NC_037641.1_10806386 and NC_037641.1_10806436 were screened out as molecular markers related to royal jelly production traits.

[0017] The significant advantages of the present invention are: 1. The royal jelly production capacity of bee colonies is affected by genotype, and there are specific alleles in high-yield royal jelly bee colonies that are significantly higher than those in low-yield royal jelly bee colonies. T The difference between the high-producing royal jelly bee colonies and the low-producing royal jelly bee colonies was extremely significant, that is, the T allele frequency in the high-producing royal jelly bee colonies was significantly higher than that in the low-producing royal jelly bee colonies; the T gene frequency of the SNP marker (NC_037641.1_10806436) was significantly higher than that in the low-producing royal jelly bee colonies. T The difference between high-producing royal jelly bee colonies and low-producing royal jelly bee colonies is extremely significant, that is, the frequency of the T allele in high-producing royal jelly bee colonies is significantly higher than that in low-producing royal jelly bee colonies. In addition, the two SNP sites are included in the target fragment amplified by the same pair of specific primers, so based on this result, it is convenient, fast and accurate to identify whether the bee colony has the ability to produce high royal jelly.

[0018] 2. Judging the royal jelly production capacity of the bee colony based on statistical indicators: The royal jelly production capacity of randomly collected worker bees in the bee colony was determined by the SNP site (NC_037641.1_10806386) P T >P C(P<0.01) is the high-yield royal jelly bee colony, P T <P C (P<0.01) is a low-yield royal jelly bee colony; at the SNP site (NC_037641.1_10806436) P T >P G (P<0.001) is the high royal jelly production bee colony, P T <P G (P<0.001) is a bee colony with low royal jelly production. Based on this, bee colonies with high royal jelly production are selected to increase the royal jelly production of the bee colony, thereby increasing the income of beekeepers. The method of identifying the high royal jelly production trait of bee colonies using SNP markers related to high royal jelly production of honey bees can greatly improve efficiency.

[0019] 3. The method of the present invention is currently mainly used in the laboratory to master the high-production mechanism of royal jelly of honeybees at the molecular level, detect molecular genetic markers related to the jelly production traits, and combine molecular genetic markers to assist honeybee variety breeding technology. This can not only ensure the accuracy of the selection, but also speed up the selection of honeybee varieties, greatly improve the success rate of breeding royal jelly high-producing bee species, and can safely, effectively and quickly identify royal jelly high-producing bee species. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The attached figure is a reference peak diagram for genotyping of SNP markers related to high production of royal jelly in honey bees. Figure 1 The SNP (NC_037641.1_10806386) marked by the box in the middle is a homozygous TT marker genotype, which is mainly found in bee colonies with high royal jelly production; Figure 2 The SNP (NC_037641.1_10806386) marked by the box in the middle is homozygous CC, which is mainly found in bee colonies with low royal jelly production; Figure 3 The SNP (NC_037641.1_10806386) marker genotype marked in the box is heterozygous CT, which appears in both high and low royal jelly production colonies.

[0021] Figure 4 The SNP (NC_037641.1_10806436) marked by the box in the middle is a homozygous TT marker genotype, which is mainly found in bee colonies with high royal jelly production; Figure 5 The SNP (NC_037641.1_10806436) marked by the box in the middle is homozygous for GG, which is mainly found in bee colonies with low royal jelly production; Figure 6The genotype of the SNP (NC_037641.1_10806436) marked in the box is heterozygous GT, which appears in both high and low royal jelly production colonies.

[0022] Figure 7 It is the average royal jelly production of high royal jelly producing bee colonies (HRJB) and low royal jelly producing bee colonies (LRJB). DETAILED DESCRIPTION

[0023] In order to make the contents of the present invention easier to understand, the technical solution of the present invention is further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0024] Example 1: Screening of SNPs molecular markers for identifying high royal jelly production traits in bee colonies (1) Collection of sequencing samples: The samples used in this study came from a high-yield royal jelly bee farm and a low-yield royal jelly bee farm in Yancheng, Jiangsu Province during the rapeseed flowering period. First, the royal jelly production of 120 Western honey bee colonies in each of the high-yield and low-yield bee farms was recorded according to the standard royal jelly determination method. The top 100 colonies with high royal jelly production and the bottom 100 colonies with low royal jelly production were selected according to the royal jelly production ranking from high to low. Through the determination and statistical analysis of the royal jelly production of 100 high-yield royal jelly bee colonies and 100 low-yield royal jelly bee colonies, the average royal jelly production of the high-yield and low-yield colonies was 243.38g and 77.90g, respectively ( Figure 7 ), T-test analysis showed that there was a significant difference in royal jelly production between the two bee colonies (P < 0.001). One worker bee was taken from each of 100 colonies with high royal jelly production and 100 colonies with low royal jelly production, and the genomic DNA of the bee samples was extracted and tested for purity, concentration and integrity.

[0025] (2) Detection and filtering of SNPs: The samples with qualified quality were used for library construction, and double-end sequencing was performed using the Illumina Novasek6000PE150 sequencing platform, and the sequencing data was quality controlled and processed. After obtaining high-quality sequencing data of each sample of high and low royal jelly production after quality control, SNPs were obtained by Samtools detection, and filtered by VCFtools software to ensure the high quality of SNPs (the filtering and screening conditions were set: VCFtools-maf0.05-max-missing 0.7-allow-extra-chr) to filter out sites with a minimum allele frequency of <0.05 and sites with a sample missing rate of >30%.

[0026] (3) Screening of SNPs associated with high royal jelly production: π Ratio(θ πHRJB / θπLRJB ) analysis method preliminarily screened out 20 SNPs associated with high royal jelly production traits. The preliminarily screened SNPs were verified by PCR and DNA sequencing technology on samples of high and low royal jelly producing Western honey bees, and NC_037641.1_10806386 and NC_037641.1_10806436 were screened out as SNPs markers related to royal jelly production traits.

[0027] Embodiment 2: A method for identifying high-yield royal jelly traits of a honey bee colony using SNP markers (NC_037641.1_10806386; NC_037641.1_10806436), the steps are as follows: (1) Sampling of individual bees: The samples used in this study were from a high-yield royal jelly bee farm and a low-yield royal jelly bee farm in Yancheng, Jiangsu Province during the rapeseed flowering period. In the bee farm, 15 colonies of high-yield royal jelly bees and 15 colonies of low-yield royal jelly bees were marked as experimental colonies (they were from the Western honey bee colonies whose royal jelly production had been measured in Example 1. Statistical analysis showed that there was a significant difference in royal jelly production between high-yield and low-yield bees). From each experimental colony, 3 to 4 adult worker bees that had just left the hive were collected, randomly sampled, and placed in a -20°C refrigerator for freezing for later use; (2) Extraction of honey bee sample DNA (using TIANGEN genome extraction kit) ① Place the abdominal samples of high- and low-producing royal jelly worker bees in a 1.5 mL centrifuge tube, add small magnetic beads and 200 μL buffer GA, and grind and homogenize thoroughly with a tissue disruptor; ② Add 20 μL of Proteinase K solution, mix well, and place in a 56°C metal bath to dissolve tissue fragments for 1.5 hours, turning upside down several times every 30 minutes to allow for a more complete reaction; ③ Add 200 μL of buffer GB, mix thoroughly, place in a 70°C metal bath for 10 min, and the reaction solution becomes clear without bubbles; ④ Add 200 μL of anhydrous ethanol, shake thoroughly, and centrifuge at 12000 rpm for 2 min at room temperature; ⑤ Use a pipette to draw the solution and add it to the adsorption column, centrifuge at 12000rpm for 30s, and discard the waste liquid; ⑥Add 500μL GD buffering and 600μL rinsing solution PW in sequence, centrifuge at high speed each time and discard the waste liquid.

[0028] ⑦ Place the adsorption column in a clean centrifuge tube, add 30 μL DEPC water, place for 5 minutes, centrifuge at high speed, and repeat this step twice; ⑧ The obtained DNA was tested for concentration and OD value using NanoDrop 2000 UV spectrophotometer, and the quality of the extracted DNA was tested using agarose gel, and finally stored at -20°C for future use.

[0029] (3) The upstream and downstream primer sequences of the amplified product containing two SNPs (NC_037641.1_10806386; NC_037641.1_10806436) are as follows: Primer-F: 5'-TGTTCACTTGTCGAGTGCGAAG-3' Primer-R: 5'-ACCAGCGATACTTAAGCGGACA-3' It was diluted to 10 μmol / μL and stored at -20°C after use.

[0030] (4) PCR detection: Using the DNA of each individual bee in step (2) as a template and Primer-F and Primer-R as primers, PCR is performed, and the PCR reaction products are detected by agarose gel electrophoresis. The PCR reaction solution showing the target band is sequenced.

[0031] PCR reaction system (50 μL): Reaction mixture Mix: 25 μL Primer-F: 2 μL Primer-R: 2 μL Template:1μL ddH2O: 20 μL Reaction conditions: (5) Analysis of the sequencing results obtained by SNPs (NC_037641.1_10806386; NC_037641.1_10806436): The following is the reference sequence of the two SNP-tagged PCR product fragments. The position of the SNP site (NC_037641.1_10806386) in the sequence is marked as C / T ; The position of the SNP site (NC_037641.1_10806436) in the sequence is marked as G / T .

[0032] 5'-TGTTCACTTGTCGAGTGCGAAGAAAATATCGTGATGGATATTTTGTGATTTTTTTTTTTAATTTCCTCGTCTAGAAAACATTACTAAACTATTTTTTTTGTTCCAAATACAATATTATTCAGTAAACTGATTCGATATTTATTTAATGTGTTCACTTGTTCACTTGTCGAATGTAAAAGAAAAGCTCATGATGGATATTTTGTGATTTTC TCGAAAAGATTATTAAACTATTTTTTTGTTTCCAGATGCAATATTATCCACAATAAACTAATTTGATATTTATTTATATGGAATAGGTGTTTTTGTTACTTGCAAAGAAAAGATCATGATAAATATTATGTGAGTTCTTTTGTTCTTTCTTTTTTGATTTCTTCAAAAAGATTTAACTATTATTAAACTATTTCTTTGTTCCAGATACAATATTAT C / T CAGTATTT ATTTGGGGATATATGAGTGCAAAGAAAAGATCAGATACTTT G / T TGAATAATAACACAAAT AACTTAACGAACGAATACTCTTTGCGATGCTTGAACCGACTTTTGAGATTCTTTTCATCGGGAATTTAATTTCTTTTTATCCTAAAAGATGATCAAAAGATCGTGAAATAGATATTTTGTGTTTCTTCGCCTAGAAAAAATTACTAAAATTATTTCTTTGTTCCAAATACATTTTACTGTCCGCT TAAGTATCGCTGGT-3' Check the PCR product sequencing peak graph and locate the position of the SNP marker (NC_037641.1_10806386) in the peak graph. The genotype peak graph standard is as follows: Figure 1 , Figure 2 and Figure 3 Mark the position, determine the genotype of each sample at the site (homozygous TT, homozygous CC or heterozygous CT) and count; and the position of the SNP marker (NC_037641.1_10806436) in the peak graph. The genotype peak graph standard is as follows Figure 4 , Figure 5 and Figure 6 Mark the position, determine the genotype of each sample at the site (homozygous TT, homozygous GG or heterozygous GT) and count them.

[0033] (6) Using SNPs (NC_037641.1_10806386; NC_037641.1_10806436) to identify high-yield royal jelly traits of bee colonies: The sequencing results of step (4) were aligned using BioEdit software, the peak types of the marker were counted, and the genotype and gene frequency were calculated, as shown in Tables 1 and 2. According to the frequency P of the T allele at the SNP marker (NC_037641.1_10806386) in worker bee individuals randomly collected from the bee colony, T and the frequency of the C allele, P C Whether there is a significant difference between the two groups to identify the high-yield royal jelly traits of the bee colonies, among which when the T allele frequency P of the bee colony T Significantly greater than the C allele frequency P C When , this bee colony is a high-yield royal jelly bee colony; according to the frequency of T allele in SNP marker (NC_037641.1_10806436), P T and the frequency of the G allele P G Whether there is a significant difference between the two groups to identify the high-yield royal jelly traits of the bee colonies, when the T allele frequency P of the bee colonies T Significantly greater than the G allele frequency P G At this time, this bee colony is a high-producing royal jelly colony.

[0034] Table 1 Distribution of different genotypes and gene frequencies of SNP (NC_037641.1_10806386) Table 2 Distribution of different genotypes and gene frequencies of SNP (NC_037641.1_10806436) Table 1 by χ 2 The Chi-Square Test statistic obtained the χ 2 =7.434, P < 0.01, indicating that there are significant differences between bee colonies with different royal jelly production abilities and different genotypes, which is statistically significant, indicating that the royal jelly production ability of bee colonies is affected by genotypes. T Significantly greater than P C , while in the low-yield group P T Significantly less than P C ; Table 2 by χ 2 The Chi-Square Test statistic obtained the χ 2=21.35, P < 0.001, indicating that there are extremely significant differences between bee colonies with different royal jelly production abilities and different genotypes, which is statistically significant, indicating that the royal jelly production ability of bee colonies is affected by genotypes. T Very significantly greater than P G , while in the low-yield group P T Very significantly less than P G Therefore, whether the allele frequencies of the two SNPs sites C and T and G and T in the bee samples are significantly different can be analyzed to determine whether the bee colony is a high-yield royal jelly bee colony.

[0035] The main reagents used in the present invention are as follows (all chemical reagents are analytically pure): Anhydrous ethanol, isopropanol, chloroform, ultrapure water, gold Trans DNA Marker I, gold 2×EasyTaqPCR SuperMix, gold agarose, gold Galstain, Biotech 50×TAE electrophoresis buffer, animal genome rapid extraction kit SK8222, upstream and downstream primers synthesized, nuclease A.

[0036] The instruments used in the present invention are mainly as follows: Axygen 1.5mL centrifuge tube, Axygen PCR tube, microwave oven, electronic balance, oscillator, small centrifuge, water bath, micropipette gun, electrophoresis instrument, ABI 96-well PCR instrument, Shanghai Peiqing Technology Co., Ltd. gel imaging analyzer, high-speed centrifuge, low-temperature refrigerator, high-pressure sterilizer, NanoDrop 2000, etc.

[0037] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. A SNP marker for identifying high royal jelly production traits of western honey bee colonies, characterized in that: The SNP marker is selected from NC_037641.1_10806386 and NC_037641.1_10806436, NC_037641.1_10806386 is the base T or C at position 10806386 of chromosome 4 of western honey bees, and NC_037641.1_10806436 is the base T or G at position 10806436 of chromosome 4 of western honey bees.

2. A primer for detecting the SNP marker according to claim 1, characterized in that: The forward primer sequence of the primer is: 5'-TGTTCACTTGTCGAGTGCGAAG-3', and the reverse primer sequence is: 5'-ACCAGCGATACTTAAGCGGACA-3'; the size of the target fragment amplified by the primer is 688 bp.

3. Use of the SNP marker described in claim 1 and the primer described in claim 2 in identifying the high-yield royal jelly trait of Western honey bee colonies.

4. Use of the SNP marker according to claim 1 and the primer according to claim 2 in breeding of honey bees.

5. A method for identifying high-yield royal jelly traits of honey bee colonies using SNP markers, characterized in that: Adult honey bee worker individuals were randomly collected from the tested western honey bee colonies, and genomic DNA was extracted; Using the extracted genomic DNA as a template, and using the primers described in claim 2 to perform a PCR amplification reaction to obtain a PCR reaction product; The obtained PCR reaction products were detected by agarose gel electrophoresis, and the PCR reaction solution with the target band was sequenced; The sequencing results were analyzed, the gene frequencies of the SNP marker sites of the tested honey bee colonies were calculated, and it was determined whether the tested honey bee colonies were high-producing royal jelly colonies.

6. The method according to claim 5, characterized in that: The gene frequency of the NC_037641.1_10806386 locus of the tested honey bee colony was calculated. When the T allele frequency of the tested honey bee colony was significantly greater than the C allele frequency, the tested honey bee colony was a high-producing royal jelly colony.

7. The method according to claim 6, characterized in that: The significant refers to statistical P <0.

01.

8. The method according to claim 5, characterized in that: The gene frequency of the NC_037641.1_10806436 locus of the tested honey bee colony was calculated. When the T allele frequency of the tested honey bee colony was significantly greater than the G allele frequency, the tested honey bee colony was a high-producing royal jelly colony.

9. The method according to claim 8, characterized in that: The significant refers to statistical P <0.001.

Images