Microfluidic electrochemical aptamer sensor and microfluidic electrochemical analysis system

Abstract

The invention relates to a microfluidic electrochemical aptamer sensor and a microfluidic electrochemical analysis system. According to the invention, a series of important biomarkers such as adenosine, homocysteine and the like in a blood sample of an organism can be rapidly and accurately quantitatively detected, so that the health condition of the organism can be judged for subsequent treatment. In addition to instant and rapid detection, the device is moderate in size and weight, convenient to carry and suitable for detecting the body health condition in various environments such as hospitals, families and fields, and the obtained physiological parameters are used for giving an early warning to the health condition of people.

Description

Technical Field

[0001] The invention belongs to the field of analysis and detection, and particularly relates to a microfluidic electrochemical aptamer sensor and a microfluidic electrochemical analysis system. Background Art

[0002] The changes in the concentration of biomarkers in the blood can quickly determine the health status of the human body. There are many types of biomarkers, such as cardiovascular disease markers such as cardiac troponin I (cTnI), homocysteine ​​(Hcy), and adenosine. It is crucial to detect the concentration of these biomarkers in the blood. Since whole blood contains components such as red blood cells, white blood cells, and platelets, these cells may release enzymes or other substances that interfere with the detection of biomarkers. Direct detection in the blood is inaccurate, so in general, the detection of the content of some biomarkers in the blood requires the blood to be processed, and then tested after processing and requires specific large instruments to detect its content. This process of detecting biomarkers is cumbersome, and the price and time costs are high. Summary of the invention

[0003] In view of the defects of the prior art, the technical problem to be solved by the present invention is to provide a microfluidic electrochemical aptamer sensor and a microfluidic electrochemical analysis system.

[0004] The present invention provides a method for preparing a biosensor, comprising:

[0005] (1) After modifying the material on the electrode surface, the activated adenosine aptamer is added dropwise, incubated, and rinsed to obtain the aptamer / material / electrode;

[0006] (2) 6-Mercapto-1-hexanol (MCH) was added dropwise onto the surface of the aptamer / material / electrode to block unoccupied nonspecific sites, followed by rinsing to obtain a sensor.

[0007] Preferably, the electrode in step (1) is a screen-printed electrode SPE; wherein the preparation method of the screen-printed electrode SPE comprises: pre-treating a polyethylene terephthalate plastic PET plate, then printing a conductive silver layer on the PET plate, curing to ensure that the silver layer is firmly attached, then printing an Ag / AgCl layer, curing to ensure that the Ag / AgCl layer is firmly attached, then printing a carbon layer, curing to ensure that the carbon layer is firmly attached, then printing an insulating layer, irradiating under ultraviolet conditions to ensure that it is firmly attached, and drying and storing at room temperature for subsequent use;

[0008] The polyethylene terephthalate plastic PET plate is pre-treated to be cut and cleaned.

[0009] Further, the PET plastic sheet is pre-treated by cutting the PET sheet and then wiping it with ethanol to ensure that its surface is clean and dust-free.

[0010] Preferably, the curing temperature ranges from 60 to 150° C. and the curing time ranges from 3 to 15 minutes; the irradiation time under ultraviolet conditions ranges from 1 to 4 minutes.

[0011] Preferably, the material in step (1) is one or more of metal nanomaterials, carbon nanomaterials, and metal composite nanomaterials; the metal nanomaterial is one or more of gold, platinum, and nickel; the carbon nanomaterial is one or more of redox graphene rGO and hollow mesoporous carbon spheres HMCS; the metal composite nanomaterial includes one of AuPt composite materials and AuCu composite nanomaterials, such as AuPt / rGO composite materials and AuCu-HMCS composite materials.

[0012] The material can be a metal nanomaterial, mainly precious metal materials such as gold, platinum and nickel. Dropping it on the electrode can enhance the conductivity of the electrode. On the other hand, precious metals such as gold, platinum and nickel can connect with the thiol (-SH) on the aptamer to form Au-S bonds and Pt-S bonds, thereby greatly improving the tightness of its connection with the aptamer.

[0013] Further, in the preparation process of the AuPt@rGO material (AuPt / rGO composite material: gold nanoparticles and platinum nanoparticles loaded on reduced graphene oxide (rGO)), the redox graphene rGO is dispersed in methanol, and chitosan is added to the dispersion, and then chloroauric acid and chloroplatinic acid are added to further stir the mixture, and then ascorbic acid solution is added to the above mixture, and the resulting solution is stirred for 10-12 hours. At the end of stirring, when a large amount of precipitate appears, the mixture is separated from methanol. After separation, the product obtained at this time is AuPt@rGO; wherein the ratio of the redox graphene rGO, chloroauric acid, and chloroplatinic acid is 10-20 mg:40-50 mmol:40-50 mmol.

[0014] The preparation process of the AuCu-HMCS material is as follows: first, HMCS is dissolved in water by ultrasonic treatment, then, chloroauric acid and copper chloride are added, and ultrasonic homogenization is continued for 10-30 minutes, then, the pH of the solution is adjusted to 10 (such as using Na2CO3 (1M)), and stirring is continued for 2-4 hours. Then, N2H4·H2O is added, and stirring is continued for 0.5-1h for pre-reduction. Finally, the obtained uniform suspension is transferred to a high-pressure reactor, reacted at 115-120°C for 10-12h, cooled, centrifuged, and the precipitate is collected, and freeze-dried to obtain AuCu-HMCS; wherein the ratio of HMCS, chloroauric acid, copper chloride, and N2H4·H2O is 25mg: 100-200mmol: 40-60mmol: 1-4mL.

[0015] The Aptamer1 is an adenosine specific aptamer, and the activated adenosine aptamer Aptamer1 is a -SH-modified adenosine aptamer1; wherein the base sequence of Aptamer1 is:

[0016] 5'-AGAGAACCTGGGGGAGTATTGCGGAGGAAGGT-3', such as SEQ ID NO1;

[0017] Furthermore, the -SH-modified adenosine aptamer Aptamer1 is:

[0018] 5'-AGAGAACCTGGGGGAGTATTGCGGAGGAAGGT–(CH2)6–SH-3'.

[0019] The aptamer is a well-known nucleotide sequence reported in literature and produced by Shanghai Biotech Co., Ltd.

[0020] The Hcy specific aptamer Aptamer2 has the following base sequence:

[0021] 5′ACCAGCACATTCGATTATACCAGCTTATTCAATTCACAGCTATGTCCTATACCAGCTTATTCAATT-3′, such as SEQ ID NO2.

[0022] The base sequence of thiol-activated Aptamer2 is:

[0023] 5′-SH-(CH2)6-ACCAGCACATTCGATTATACCAGCTTATTCAATTCACAGCTATGTCCTATACCAGCTTATTCAATT-3′.

[0024] The aptamer (aptamer2) is a well-known nucleotide sequence reported in literature and produced by Shanghai Biotech Co., Ltd.

[0025] The preparation of the activated aptamer Aptamer solution in step (1) includes: dissolving the activated aptamer Aptamer in tris(2-carboxyethyl)phosphine (TCEP) tris(hydroxymethylaminomethane) hydrochloride buffer, and shaking at room temperature to obtain the activated aptamer Aptamer solution; the concentration of the activated aptamer Aptamer solution is 1-40 μM; wherein the activated aptamer Aptamer is an activated adenosine aptamer Aptamer1 or an activated Hcy aptamer Aptamer2.

[0026] The concentration of the activated adenosine aptamer Aptamer1 solution is 1-20 μM; the concentration of the activated Hcy aptamer Aptamer2 solution is 20-40 μM.

[0027] Furthermore, the concentration of the activated adenosine aptamer Aptamer1 solution is 10-20 μM.

[0028] The activated aptamer solution in step (1) comprises: dissolving the activated aptamer in TH buffer (10 mM, pH = 7.4) containing 5 mM TCEP (tris(2-carboxyethyl)phosphine (TCEP) in tris(hydroxymethylaminomethane) hydrochloride buffer) and shaking at 1000-3000 r / min for 1-3 h at 25°C.

[0029] The concentration of 6-mercapto-1-hexanol MCH in step (2) is 1-5 mM.

[0030] Preferably, the incubation in step (1) is carried out at 4° C. for 8-12 hours;

[0031] Preferably, the blocking in step (2) is carried out at room temperature for 1 to 2 hours.

[0032] The present invention provides a biosensor prepared by the method, wherein the biosensor is combined with electrochemistry to quantitatively detect adenosine and Hcy through differential pulse voltammetry (DPV).

[0033] The present invention provides a microfluidic electrochemical aptamer sensor, which comprises a microfluidic chip and the biosensor. The microfluidic electrochemical aptamer sensor is connected to a microfluidic electrochemical analysis device. Differential pulse voltammetry (DPV) is used to generate different electrical signals for different concentrations of adenosine to quantitatively analyze adenosine. The microfluidic electrochemical analysis device can directly drip whole blood, convert the whole blood into plasma through the microfluidic chip, and thus directly measure the content of adenosine or Hcy in the plasma.

[0034] The microfluidic electrochemical aptamer sensor is manufactured by PDMS soft etching process. Figure 4 As shown, a microfluidic chip can be made by surface plasma treatment or chemical bonding. Usually, the PDMS chip bonding method is to treat the surface of the PDMS structure to be bonded and the surface of the carrier to be bonded by oxygen plasma (plasma), and then bond the PDMS structure to the surface of the slide.

[0035] The microfluidic chip includes a first part and a second part; wherein the first part includes a connected whole blood inlet 15, a fluid channel 16, a plasma separator 17, an expansion microfluidic channel 18, and a blood cell outlet 19; the second part includes a buffer inlet 20, a buffer channel 21, a biosensor detection area 22 and a sample outlet 23 connected in sequence; wherein the first part and the second part are connected through a buffer area 24, wherein the buffer area 24 connects the separator 17 of the first part and the buffer channel 21 of the second part; wherein the biosensor detection area 14 is provided with the biosensor.

[0036] Furthermore, the width of the buffer channel 21 and the size of the biosensor detection area 22 can be adjusted specifically according to the size of the biosensor; wherein the plasma separator 17 is provided with a connected transition channel and an arcuate microfluidic channel, wherein the arcuate microfluidic channel is connected to one corner of the end of the expansion microfluidic channel 18, and the other corner of the end is connected to the bifurcation channel 26, wherein the bifurcation channel 26 is connected to the buffer area 24.

[0037] The whole blood is converted into plasma through the microfluidic chip, and the combination of inertial focusing and Fahraeus effect is used. Based on the design principle of combining contraction and expansion zones, a combination of a contraction semicircular curved microfluidic channel and an expansion microfluidic channel zone is designed at the end of the whole blood fluid channel zone and the transition zone, and a bifurcated channel with an asymmetric flow rate ratio with the microfluidic channel zone is designed in the expansion microfluidic channel zone. The plasma separated from the whole blood is collected in the high flow resistance channel zone designed next to the cell-free zone, while the blood cells flow out from the area with lower flow resistance. The structure of the microfluidic chip is as follows Figure 5As shown. The plasma separation method based on this structure requires that the whole blood enters the fluid channel at a certain flow rate (0.3mL / min-0.8mL / min) to convert the whole blood into serum. The process of filtering blood into serum takes a very short time, so additional pressure is required to drive the whole blood into the fluid channel. The electrochemical aptamer sensor quickly detects the adenosine content in the serum. In some special environments, such as in anoxic environments, it can monitor the adenosine or Hcy content in the body in real time to ensure the health of the body.

[0038] The present invention provides a microfluidic electrochemical analysis system, which comprises any one of the microfluidic electrochemical aptamer sensors, a potentiometer, a pump, and a pump driver; wherein the microfluidic electrochemical aptamer sensor is connected to the potentiometer.

[0039] The pump comprises a pump 1 and a pump 2, wherein the pump 1 is connected to the inlet of the buffer solution of the microfluidic electrochemical aptamer sensor; the pump 2 is connected to the blood sample inlet; the potentiometer is connected to the biosensor in the microfluidic electrochemical aptamer sensor, and the potentiometer is used to perform differential pulse voltammetry DPV and / or chronoamperometry it detection;

[0040] The microfluidic electrochemical analysis system also includes a waste liquid collection container, wherein the waste liquid collection container includes a first waste liquid collection container and a second waste liquid collection container; wherein the first waste liquid collection container is connected to the blood cell outlet, and the second waste liquid collection container is connected to the sample outlet 23.

[0041] The microfluidic electrochemical analysis system also includes a computer terminal; the computer terminal software is used to control and adjust the fluid of the micropump controller.

[0042] Taking into account the requirement of the POCT system for portability of the overall volume, the present invention adopts a small-volume micropump to drive the whole blood. This micropump can be a micro piezoelectric pump or a micro peristaltic pump. For example, the volume of the micropump is about 30mm*10mm*3mm (length*width*height), and the fluid can be controlled and adjusted by the computer software on the micropump controller.

[0043] The pump and pump driver are important components of the portable microfluidic electrochemical analysis system. The micropump is small and easy to carry. The pump provides power for whole blood filtration and plasma. The pump driver is connected to the computer by a USB cable, and the power of the pump can be controlled by the corresponding program. It should be noted that the micropump can only be flushed or filled (only sucked) at the outlet, otherwise the maximum pressure of 1 bar will be exceeded. This will cause the pump to malfunction. Foreign matter (such as villi) in the fluid channel will affect the working mode of the micropump. Therefore, the cleaning of the micropump is particularly important. If it is not cleaned properly, it will cause the pump to malfunction. The particle size of the liquid passing through the pump cannot be greater than 50μm. Otherwise, this will affect the performance of the micropump.

[0044] After the whole blood passes through the microfluidic plasma separator, the separated plasma enters the electrochemical aptamer sensor for electrochemistry. The biomarkers in the plasma are connected to the aptamer. Due to the non-conductivity of the biomarker, the DPV value changes with the number of connections during the connection process of the aptamer. The more connections, the smaller the DPV value will be. Under the action of different concentrations of biomarkers, the change value of its DPV is different. Based on this condition, the biomarkers are quantitatively analyzed at different changes in electrical signals.

[0045] The portable microfluidic electrochemical analysis system consists of four parts: microfluidic integrated electrochemical aptamer sensor, potentiometer, pump and pump driver. The process of the portable microfluidic electrochemical analysis system is as follows: Figure 1 As shown. The computer program controls the pump drive to pump out the whole blood sample from pump 2 and enter the microfluidic integrated electrochemical aptamer sensor. After the whole blood passes through the separation area in the microfluidic integrated electrochemical aptamer sensor, the plasma flows to the plasma channel, and the separated blood cells flow out from the other end and enter the waste liquid pipe for subsequent processing. After the whole blood is processed, the pump drive is controlled to pump the electrochemical buffer to the working electrode area from pump 1. The microfluidic integrated electrochemical aptamer sensor is connected to the potentiometer, and the concentration of biomarkers in the whole blood is quantitatively analyzed using differential pulse voltammetry (DPV).

[0046] In the design of portable microfluidic electrochemical analysis system Figure 2 For example, the overall system is 160*160cm in length and width and weighs about 1000g.

[0047] like Figure 2 As shown, the portable microfluidic electrochemical analysis system includes: an upper cover plate 1; a position 2 for fixing the pump; a first gap 3 for connecting the pump drive and the pump connection wire; a position 4 for placing the potentiometer, which is designed to be concave for placing the potentiometer and also to prevent the potentiometer from being damaged by collision during carrying; a position 5 for connecting the microfluidic electrochemical aptamer sensor to the potentiometer for detection; a middle layer 6; a left cover plate 7; a second gap 8 for connecting the potentiometer to the wire; a position 9 for placing the whole blood to be tested and the treated waste liquid; a third gap 10 for connecting the pump drive to the wire; a right cover plate 11; a position 12 for fixing the pump drive; a lower cover plate 13; and a front cover plate 14. It is suitable for evaluating human health in special environments. Because its POCT is also suitable for monitoring vital signs in emergency situations to determine subsequent treatment plans.

[0048] Portable microfluidic electrochemical analysis system Figure 3As shown, it is composed of four parts: a microfluidic electrochemical aptamer sensor, a potentiometer, a pump and a pump driver. The potentiometer can perform differential pulse voltammetry (DPV) and chronoamperometry (IT) detection. DPV and IT are electrochemical analysis techniques that can be used to measure the concentration of substances or surface charge characteristics in electrochemical reaction systems. DPV is selected as the detection method in the present invention. Two DPV detections are required for one detection. The first DPV is before the whole blood is added, and the second DPV is after the whole blood is added. A certain current difference appears in the two DPV data, and the magnitude of the current difference is positively correlated with the logarithm of the concentration of the biomarker added and detected. The concentration of the biomarker is determined by the current difference generated by the electrical signal.

[0049] The present invention provides applications of the biosensor, the microfluidic electrochemical aptamer sensor, and the microfluidic electrochemical analysis system in the detection of adenosine and homocysteine.

[0050] The present invention provides a detection method, comprising:

[0051] Prepare whole blood standards with different concentrations of adenosine or homocysteine ​​Hcy;

[0052] The biosensor, the microfluidic electrochemical aptamer sensor or the microfluidic electrochemical analysis system is used to test the whole blood current value I by differential pulse voltammetry DPV. 全血 ; Then test the current value I of the whole blood standard of each concentration 测 , establish a standard curve of adenosine or homocysteine ​​Hcy concentration or concentration logarithm and ΔI value; where ΔI is I 全血 with I 测 The difference between

[0053] The sample to be tested is tested, and the concentration of adenosine or Hcy in the sample to be tested is obtained by the standard curve method.

[0054] The concentration range of adenosine in the whole blood standard of adenosine is 10nM to 10μM;

[0055] The Hcy concentration range in the whole blood standard of Hcy is 0.02 μM-20.00 μM.

[0056] The whole blood standard product is prepared by adding adenosine or homocysteine ​​Hcy into whole blood to obtain whole blood standard products with a series of concentrations of adenosine or homocysteine ​​Hcy.

[0057] The sample to be tested is a blood sample.

[0058] The experimental process of the present invention (adenosine detection in whole blood) is as follows: the microfluidic electrochemical adapter sensor is connected to the microfluidic electrochemical analysis device to form a portable microfluidic electrochemical analysis system, and the pump 1 is turned on to allow the potassium ferrocyanide solution to flow from the Figure 5 The whole blood enters at 20 and flows to the electrode at 22, so that the electrode is covered with potassium ferrocyanide solution. At this time, DPV is used to measure the background current, and the data is saved after the test is completed. After saving the data, turn on pump 1 and extract the potassium ferrocyanide solution from 23. Connect the whole blood sample tube to 15, turn on pump 2, and the whole blood passes through 16 to 17. By combining inertial focusing and Fahraeus effect, the whole blood is actively separated, and the red blood cells will flow through 18 and finally flow out from 19 into the waste liquid tube. The plasma after the whole blood separation enters channel 21 after passing through 24, and then enters the electrode area 22 to incubate the electrode. After incubation, turn on pump 1, so that the potassium ferrocyanide solution enters from 20 and flows to the electrode at 22, so that the electrode is covered with potassium ferrocyanide solution. At this time, DPV is used to measure the background current, and the data is saved after the test is completed. Process the data and calculate ΔI.

[0059] Experimental process (Hcy detection in whole blood) in the present invention: connect the microfluidic electrochemical adapter sensor to the microfluidic electrochemical analysis device to form a portable microfluidic electrochemical analysis system, turn on the pump 1, and make the PBS (pH = 7.4) solution flow from Figure 5 The whole blood enters at 20 and flows to the electrode at 22, so that the electrode is covered with PBS solution. At this time, DPV is used to measure the background current, and the data is saved after the test. After saving the data, turn on pump 1 and extract the PBS solution from 23. Connect the whole blood sample tube to 15, turn on pump 2, and the whole blood passes through 16 to 17. By combining inertial focusing and Fahraeus effect, the whole blood is actively separated, and the red blood cells will flow through 18 and finally flow out from 19 into the waste liquid tube. The plasma after the whole blood separation enters channel 21 after passing through 24, and then enters the electrode area 22 to incubate the electrode. After incubation, turn on pump 1, allow the PBS solution to enter from 20, flow to the electrode at 22, so that the electrode is covered with PBS solution. At this time, DPV is used to measure the background current, and the data is saved after the test is completed. Process the data and calculate ΔI.

[0060] Beneficial Effects

[0061] The present invention plays an important role in multiple emergency medicine-related scenarios such as pre-hospital emergency care, in-hospital emergency, EICU, sudden incidents and emergency rescue. By rapidly detecting relevant biomarkers, it assists doctors in quickly assessing the condition and provides support and basis for clinical decision-making. The present invention proposes a portable microfluidic electrochemical analysis system that can rapidly detect the content of relevant biomarkers in the blood, and provide a reference for rapid diagnosis of the disease by quantifying the biomarkers. Common rapid detection application scenarios include rapid detection of cardiac markers and coagulation function related to acute cardiovascular and cerebrovascular diseases; immediate assessment of circulation and volume in severe trauma; rapid detection of etiology of infectious diseases; and rapid bedside assessment of various critical blood gas analyses, electrolytes and lactate, etc.

[0062] The present invention can be used to quickly and accurately quantitatively detect a series of important biomarkers such as adenosine and homocysteine ​​in the blood sample of an organism to determine the health status of the organism for subsequent treatment. In addition to instant and rapid detection, the present invention has a moderate size and weight, is easy to carry, and is suitable for detecting physical health in various environments such as hospitals, homes, and the wild, and uses the obtained physiological parameters to warn people of their health status.

[0063] The portable microfluidic electrochemical analysis system of the present invention is used for directly detecting biomarkers in whole blood, and has the advantages of high sensitivity, no need for sample processing, and convenient carrying.

[0064] The microfluidic electrochemical aptamer sensor used in the present invention has a simple preparation process and can be mass-produced, and has certain applicability for one-time on-site detection of some biomarkers.

[0065] The portable microfluidic electrochemical analysis system of the present invention has the advantages of high specificity and low cost, is not easily affected by environmental factors such as pH value and temperature, is more stable and easy to store. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 Simplified diagram of a portable microfluidic electrochemical analysis system;

[0067] Figure 2 Design and construct diagram for microfluidic electrochemical analysis device;

[0068] Figure 3 It is a microfluidic electrochemical analysis device;

[0069] Figure 4 It is a microfluidic electrochemical aptamer sensor;

[0070] Figure 5 The internal structure diagram of the microfluidic chip in the microfluidic electrochemical adapter sensor;

[0071] Figure 6 Constructed electrochemical sensors for cyclic voltammetry;

[0072] Figure 7 Built for electrochemical impedance spectroscopy electrochemical sensors;

[0073] Figure 8 Linear data of the logarithm of adenosine concentration and the current difference of the electrical signal; (A) DPV of adenosine aptamer sensor MCH / Aptamer / AuPt@rGO / SPE with different concentrations added in potassium ferrocyanide solution; (B) corresponding linear fitting curve; for all the above tests, the error bars are standard deviations (n=3). DETAILED DESCRIPTION

[0074] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms fall within the scope limited by the appended claims of the application equally.

[0075] In the preparation process of the AuPt@rGO material, 20.0 mg of rGO was dispersed in methanol, chitosan was added to the dispersion, and then 5.0 mL of chloroauric acid (10.0 mM) and 5.0 mL of chloroplatinic acid (10.0 mM) were added to further stir the mixture, and then a freshly prepared ascorbic acid solution was added to the mixture, and the resulting solution was stirred for 12 hours. At the end of the stirring, when a large amount of precipitate appeared, the mixture was separated from methanol, and after separation, the product obtained at this time was AuPt@rGO.

[0076] The rGO material was purchased from Shenzhen Nano Technology Port Co., Ltd.

[0077] Detection of adenosine in whole blood: Connect the microfluidic electrochemical adapter sensor to the microfluidic electrochemical analysis device to form a portable microfluidic electrochemical analysis system. Turn on pump 1 to allow potassium ferrocyanide solution to flow from the Figure 5 Enter at 20 and flow to the electrode at 22, so that the electrode is covered with potassium ferrocyanide solution. At this time, use DPV to measure the background current and save the data after the test. After saving the data, turn on pump 1 and draw out the potassium ferrocyanide solution from 23. Connect the whole blood sample tube to Figure 5 At 15, pump 2 is turned on and whole blood passes through Figure 5From point 16 to point 17, the whole blood is actively separated by combining inertial focusing and the Fahraeus effect. The red blood cells will flow through point 18 and finally flow out from point 19 into the waste liquid tube. The plasma after the whole blood separation will enter channel 21 after passing through point 24, and then enter the electrode area 22 to incubate the electrode. After incubation, turn on pump 1 to allow the potassium ferrocyanide solution to enter from point 20 and flow to the electrode at position 22, so that the electrode is covered with the potassium ferrocyanide solution. At this time, DPV is used to measure the background current, and the data is saved after the detection is completed. Process the data and calculate ΔI.

[0078] Example 1

[0079] Method for detecting adenosine in whole blood using a portable microfluidic electrochemical analysis system

[0080] (1) Preparation and pretreatment of SPE. The specific methods are as follows:

[0081] The SPE used in the experiment was homemade in the laboratory. First, the PET plastic plate was cut and then carefully wiped with ethanol to ensure that its surface was clean and dust-free. After it was completely dry, it was firmly fixed on the screen printer. First, the conductive silver layer was printed on the PET plate and cured at 120°C for 5 minutes to ensure that the silver layer was firmly attached; then the Ag / AgCl layer was printed and further cured at 120°C for 5 minutes. To ensure that the Ag / AgCl layer was firmly attached; then the carbon layer was printed and further cured at 120°C for 10 minutes. To ensure that the carbon layer was firmly attached; then the insulating layer was printed and irradiated with ultraviolet light for 2 minutes to ensure that it was firmly attached. The pretreated electrode was carefully washed with ultrapure water and dried and stored at room temperature for subsequent use.

[0082] (2) Construction of microfluidic electrochemical aptamer sensor MCH / Aptamer / AuPt@rGO / SPE Aptamer is an adenosine-specific aptamer, and the base sequence of Aptamer is:

[0083] 5'-AGAGAACCTGGGGGAGTATTGCGGAGGAAGGT-3'

[0084] The aptamer is a well-known nucleotide sequence reported in the literature.

[0085] The -SH modified adenosine aptamer Aptamer is:

[0086] 5'-AGAGAACCTGGGGGAGTATTGCGGAGGAAGGT–(CH2)6–SH-3'

[0087] Produced by Shanghai Biotech Co., Ltd.

[0088] After dropping AuPt@rGO material on the electrode, 10μL, 20μM-SH-modified Aptamer was modified on the homemade AuPt@rGO / SPE and incubated overnight at 4°C. Rinse with ultrapure water and dry for use. Further, 10μL, 5mM MCH was added to the surface of the electrode to block the unoccupied nonspecific sites. After blocking for 2h at room temperature, the electrode was rinsed in ultrapure water to remove excess MCH to obtain the sensor MCH / Aptamer / AuPt@rGO / SPE.

[0089] The electrochemical aptamer sensor MCH / Aptamer / AuPt@rGO / SPE was obtained.

[0090] (3) Verification of sensor construction steps

[0091] Cyclic voltammetry and electrochemical impedance spectroscopy were used to verify the construction of the electrochemical aptasensor. Figure 6 The results show that in 5 mM [Fe(CN)6] 3- / [Fe(CN)6] 4- Cyclic voltammetry curves of the electrode constructed step by step in solution (the electrode was inserted into 5 mM [Fe(CN)6] 3- / [Fe(CN)6] 4- CV and EIS were performed in solution. Since Aptamer has a certain steric hindrance and there is a repulsive effect with the same charge in the solution system, the redox peak current decreased after the modification of Aptamer. Subsequently, MCH was used to block the nonspecific sites of the electrode, and the peak current was significantly reduced. When the target adenosine was further incubated on the electrode surface, the peak current continued to decrease, indicating that the constructed sensor can successfully capture adenosine.

[0092] Electrochemical impedance spectroscopy can be used to reflect the resistance change of the electrode, where the larger the diameter of the high-frequency semicircle part, the greater the electrode resistance. Figure 7 It can be seen that the unmodified SPE has a smaller semicircle diameter, indicating a smaller resistance. When its surface is modified with Aptamer and MCH, the semicircle diameter gradually increases, and with further incubation of adenosine, the electrode resistance increases significantly. The results of the electrochemical impedance spectroscopy are consistent with the expected resistance change, indicating that the sensor MCH / Aptamer / AuPt@rGO / SPE was successfully constructed.

[0093] (4) The sensor constructs a linear relationship for whole blood spiked with different concentrations of adenosine

[0094] The method for detecting adenosine using an electrochemical aptamer sensor specifically includes the following steps: using a portable microfluidic electrochemical analysis system to detect whole blood, and constructing a linear system after adding standard solutions of adenosine of different concentrations. First, the change in the electrical signal of whole blood, i.e., ΔI 全血 . Then, the adenosine standard solution was spiked with whole blood at a ratio of 1:9. The spike concentrations of the adenosine standard solution were 100, 1000, 5000, 10000 and 50000 nM, respectively. After the spike, the concentrations were diluted 10 times. The current response difference of 100 nM adenosine standard solution spiked with a ratio of 1:9 in whole blood was ΔI 测 , then the current response difference ΔI corresponding to 10nM adenosine is ΔI 测 —ΔI 全血 Then the remaining concentrations were tested in turn. It can be seen that the concentration range of the test is 10nM-5μM, and the linear relationship is as follows Figure 8 B, the corresponding linear regression equation is ΔI(μA)=1.47lg C(nM)+0.0287(R 2 =0.998).

Claims

1. A method for preparing a biosensor, comprising: (1) After modifying the material on the electrode surface, the activated aptamer is added dropwise, incubated, and rinsed to obtain the aptamer / material / electrode; (2) 6-Mercapto-1-hexanol (MCH) was added dropwise onto the surface of the aptamer / material / electrode to block unoccupied nonspecific sites, followed by rinsing to obtain a sensor.

2. The preparation method according to claim 1, characterized in that: The electrode in step (1) is a screen-printed electrode SPE; The method for preparing the screen-printed electrode SPE comprises: pre-treating a polyethylene terephthalate plastic PET plate, then printing a conductive silver layer on the PET plate, curing, printing an Ag / AgCl layer, curing, then printing a carbon layer, curing, then printing an insulating layer, and irradiating under ultraviolet conditions; The curing temperature is 60-150° C. and the curing time is 3-15 minutes; the irradiation time under the ultraviolet condition is 1-4 minutes.

3. The preparation method according to claim 1, characterized in that: The material in step (1) is one or more of metal nanomaterials, carbon nanomaterials, and metal composite nanomaterials; the metal nanomaterials include one or more of gold, platinum, and nickel; the carbon nanomaterials are one or more of redox graphene rGO and hollow mesoporous carbon spheres HMCS; the metal composite nanomaterials include one or more of AuPt composite materials and AuCu composite materials; The activated aptamer Aptamer in step (1) includes at least one of an activated adenosine aptamer Aptamer1 and an activated homocysteine ​​(Hcy) aptamer Aptamer2; The activated adenosine aptamer Aptamer1 is -SH-modified adenosine aptamer1; wherein the base sequence of Aptamer1 is: 5′-AGAGAACCTGGGGGAGTATTGCGGAGGAAGGT-3′; The activated homocysteine ​​Hcy aptamer Aptamer2 is a thiol-activated Aptamer2, wherein the base sequence of Aptamer2 is: 5′ACCAGCACATTCGATTATACCAGCTTATTCAATTCACAGCTATGTCCTATACCAGCTTATTCAATT-3′.

4. The preparation method according to claim 1, characterized in that: The preparation of the activated aptamer Aptamer solution in step (1) comprises: dissolving the activated aptamer Aptamer in a tris(2-carboxyethyl)phosphine (TCEP) tris(hydroxymethylaminomethane) hydrochloride buffer solution, and shaking at room temperature to obtain an activated aptamer Aptamer solution; the concentration of the activated aptamer Aptamer solution is 1-40 μM; The concentration of 6-mercapto-1-hexanol MCH in step (2) is 1-5 mM.

5. The preparation method according to claim 1, characterized in that: The incubation in step (1) is carried out at 4° C. for 8-12 hours; and the blocking in step (2) is carried out at room temperature for 1-2 hours.

6. A biosensor prepared by the method according to any one of claims 1 to 5.

7. A microfluidic electrochemical aptamer sensor, characterized in that: The microfluidic electrochemical aptamer sensor comprises a microfluidic chip and the biosensor according to claim 6.

8. The microfluidic electrochemical aptamer sensor according to claim 7, characterized in that: The microfluidic chip includes a first part and a second part; wherein the first part includes a connected sample inlet 15, a fluid channel 16, a separator 17, an expansion microfluidic channel 18, and an outlet 19; the second part includes a buffer sample inlet 20, a buffer channel 21, a biosensor detection area 22, and a sample outlet 23 that are connected in sequence; wherein the first part and the second part are connected through a buffer area 24, wherein the buffer area 24 connects the separator 17 of the first part and the buffer channel 21 of the second part; wherein the biosensor detection area 14 is provided with the biosensor described in claim 6.

9. A microfluidic electrochemical analysis system, characterized in that: The microfluidic electrochemical analysis system comprises the microfluidic electrochemical aptamer sensor according to any one of claims 7-8, a potentiometer, a pump, and a pump driver; wherein the microfluidic electrochemical aptamer sensor is connected to the potentiometer.

10. The microfluidic electrochemical analysis system according to claim 9, characterized in that: The pump comprises pump 1 and pump 2, wherein pump 1 is connected to the inlet of the buffer solution of the microfluidic electrochemical aptamer sensor; pump 2 is connected to the blood sample inlet; the potentiometer is connected to the biosensor in the microfluidic electrochemical aptamer sensor, and the potentiometer is used to perform differential pulse voltammetry DPV and / or chronoamperometry it detection.

11. Use of the biosensor according to claim 1, the microfluidic electrochemical aptamer sensor according to claim 7, and the microfluidic electrochemical analysis system according to claim 9 in the detection of adenosine and homocysteine.

12. A detection method comprising: Prepare whole blood standards with different concentrations of adenosine or homocysteine ​​Hcy; The whole blood current value I is tested by differential pulse voltammetry (DPV) using the biosensor described in claim 1, the microfluidic electrochemical aptamer sensor described in claim 7, or the microfluidic electrochemical analysis system described in claim 9. 全血 ; Then test the current value I of the whole blood standard of each concentration 测 , establish a standard curve of adenosine or homocysteine ​​Hcy concentration or concentration logarithm and ΔI value; where ΔI is I 全血 with I 测 The difference between The sample to be tested is tested, and the concentration of adenosine or Hcy in the sample to be tested is obtained by the standard curve method.

Images