Reverse transcription primer group, primer combination, sequencing library construction method and kit

Abstract

The invention discloses a reverse transcription primer group, a primer combination, a construction method of a sequencing library and a kit. The reverse transcription primer group comprises a reverse transcription primer and a template conversion primer, the structure of the reverse transcription primer sequentially comprises a universal sequence, a random sequence, Oligo (dT) and an anchoring sequence from the 5'end to the 3 'end; the structure of the template conversion primer sequentially comprises the universal sequence and rGrG + G from the 5'end to the 3 'end, rG is ribose guanosine (RNA), and + G is LNA modified guanosine. According to the template conversion primer, the library yield is effectively increased, the sequencing accuracy and sensitivity are improved, the sequencing data output is increased, the splitting rate of the full-length sequence is increased, and the length of the full-length sequence is increased.

Description

Technical Field

[0001] The present invention relates to the technical field of gene sequencing, and in particular to a reverse transcription primer set, a primer combination, a method for constructing a sequencing library, and a kit. Background Art

[0002] The full-length transcriptome is based on the third-generation sequencing platform. Without interrupting the splicing, the full-length mRNA sequence and complete structural information including 5'UTR, 3'UTR, and polyA tail can be directly obtained, thereby accurately analyzing the structural information such as alternative splicing and fusion genes of species with reference genomes, overcoming the problem of short transcript splicing and incomplete information of species without reference genomes.

[0003] ONT (Oxford nanopore technologie) full-length transcriptome sequencing is a third-generation sequencing technology that has emerged in recent years. While retaining the full-length sequence information, it also has the advantage of throughput. With conventional data volume, it can saturate most of the transcripts in the sample to be tested and then quantify the transcripts. At present, the data output of a single cell of the ONT sequencer can reach 100G, while the data required for a single library is generally only 6-8G. Multiple libraries need to be pooled and built before sequencing. However, the sequencing yield of the official ONT library construction kit is low. Summary of the invention

[0004] According to the first aspect, in one embodiment, there is provided a reverse transcription primer set, comprising: a reverse transcription primer and a template switching primer;

[0005] The reverse transcription primer comprises a structure including, from the 5' end to the 3' end, a universal sequence, a random sequence, Oligo (dT) and an anchor sequence;

[0006] The structure of the template switching primer includes the universal sequence, rGrG+G in sequence from the 5' end to the 3' end, where rG is riboguanosine (RNA) and +G is LNA-modified guanosine.

[0007] According to the second aspect, in one embodiment, a primer combination is provided, comprising: the reverse transcription primer set and the PCR primer described in the first aspect;

[0008] The structure of the PCR primer includes, from the 5' end to the 3' end, a linker connection sequence, a sample tag sequence, and a target fragment complementary sequence;

[0009] The 5' end of the PCR primer is modified with a phosphate group;

[0010] The adapter connection sequence is used for splitting sample tags;

[0011] The sample label sequences of different samples are different;

[0012] The target fragment is the product obtained by extending the above reverse transcription primer set.

[0013] According to the third aspect, in one embodiment, a method for constructing a sequencing library is provided, comprising the following steps:

[0014] A reverse transcription step, comprising reverse transcribing the RNA sample using a reverse transcription primer set to obtain a reverse transcription product;

[0015] The amplification step includes performing PCR amplification on the reverse transcription product to obtain a PCR amplification product.

[0016] According to the fourth aspect, in one embodiment, a sequencing library construction kit is provided, comprising the reverse transcription primer set described in the first aspect or the primer combination described in the second aspect. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a schematic diagram of the experimental principle of full-length transcriptome library construction in an embodiment of the present invention;

[0018] Figure 2.1 Amplification detection diagram of the ONT official kit provided in Example 1 of the present invention;

[0019] Figure 2.2 This is an amplification detection diagram for the construction of the full-length transcriptome library provided in embodiment 2 of the present invention. DETAILED DESCRIPTION

[0020] The present invention is further described in detail below by specific embodiments in conjunction with the accompanying drawings. In the following embodiments, many detailed descriptions are intended to enable the present application to be better understood. However, those skilled in the art can effortlessly recognize that some of the features can be omitted in different situations, or can be replaced by other materials and methods. In some cases, some operations related to the present application are not shown or described in the specification, in order to avoid the core part of the present application being overwhelmed by too much description, and for those skilled in the art, it is not necessary to describe these related operations in detail, and they can fully understand the related operations according to the description in the specification and the general technical knowledge in the art.

[0021] In addition, the features, operations or characteristics described in the specification can be combined in any appropriate manner to form various implementations. At the same time, the steps or actions in the method description can also be interchanged or adjusted in a manner that is obvious to those skilled in the art. Therefore, the various sequences in the specification and the drawings are only for the purpose of clearly describing a certain embodiment and are not meant to be a required sequence, unless otherwise specified that a certain sequence must be followed.

[0022] The serial numbers assigned to the components in this article, such as "first", "second", etc., are only used to distinguish the objects described and do not have any order or technical meaning.

[0023] ONT sequencing has the problem of low sequencing accuracy; the ONT official kit has low efficiency in linker connection for full-length transcriptome library construction, and the low efficiency of linker connection is mainly manifested in: 1. The sequencing output is low, less than half of the chip output; 2. The fragments of reverse transcription products are relatively short, and the proportion of small fragments obtained by splitting is high; 3. If the existing library construction method is changed and the original primers are continued to be used, the full-length sequence splitting rate after pooling will not be high.

[0024] Therefore, new protocols need to be developed to improve sequencing yield and the efficiency of resolution of full-length sequences.

[0025] According to the first aspect, in one embodiment, a reverse transcription primer set is provided, comprising:

[0026] Reverse transcription primers and template switching primers;

[0027] The reverse transcription primer comprises a structure including, from the 5' end to the 3' end, a universal sequence, a random sequence, Oligo (dT) and an anchor sequence;

[0028] The structure of the template switching primer includes the universal sequence, rGrG+G in sequence from the 5' end to the 3' end, where rG is riboguanosine (RNA) and +G is LNA-modified guanosine.

[0029] From the experimental data of the present invention, it can be found that the reverse transcription primer set provided in this embodiment can increase the sequencing data output and increase the length of the full-length sequence.

[0030] In one embodiment, a landmark base sequence is provided between the universal sequence and the random sequence in the reverse transcription primer;

[0031] The landmark base sequence consists of at least one base.

[0032] In one embodiment, the marker base sequence consists of 1 to 20 bases.

[0033] The present example unexpectedly discovered that adding a landmark base sequence between the universal sequence and the random sequence can improve the sequencing data resolution rate without significantly reducing the reverse transcription efficiency or causing significant nonspecific amplification.

[0034] In one embodiment, the landmark base sequence consists of n landmark base units, where n is at least 1 and is an integer; the sequence of the landmark base units consists of at least 1 base, and the landmark base is the same as the 3' terminal sequence of the universal sequence.

[0035] In one embodiment, n is 1 or 2.

[0036] Exemplarily, the universal sequence of the reverse transcription primer from 5' to 3' is: AAGCAGTGGTATCAACGCAGAGTAC, when the 3' terminal sequence is GTAC, and n is 1 or 2, the iconic base sequence from 5' to 3' is: GCAC or GTACGTAC.

[0037] In one embodiment, the random sequence consists of 6 to 12 random bases N, specifically 6, 7, 8, 9, 10, 11, 12, where N is any base.

[0038] In one embodiment, the random sequence consists of 8 random bases N, where N is any base.

[0039] Exemplarily, the random sequence is: NNNNNNNN.

[0040] It should be noted that the difference in bases in the random sequence will not affect the experimental results.

[0041] In one embodiment, the Oligo(dT) consists of 15 to 40 thymine Ts.

[0042] In one embodiment, Oligo(dT) consists of 30 thymine Ts.

[0043] Illustratively, Oligo(dT) is TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.

[0044] In one embodiment, the anchor sequence is VN, V is adenine A, guanine G or cytosine C, and N is any base.

[0045] In one embodiment, the reverse transcription primer comprises the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 9;

[0046] SEQ ID NO: 1:

[0047] SEQ ID NO: 2:

[0048] SEQ ID NO:9:

[0049] In one embodiment, the template switching primer comprises the nucleotide sequence shown in SEQ ID NO: 3;

[0050] SEQ ID NO: 3: 5'-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3'.

[0051] The reverse transcription principle of the reverse transcription primer set of the present invention is as follows: when reverse transcription is performed, the universal sequence of the reverse transcription primer is used as the primer recognition sequence for PCR amplification, Oligo (dT) recognizes the poly (A) sequence at the end of RNA, and the anchor sequence can be specifically anchored at the junction of the 3' end of RNA and connected to Poly (A). When transcribing to the 5' end of RNA, the reverse transcriptase will add several C bases to the 3' end of the cDNA chain to synthesize the first cDNA chain. The G base at the 3' end of the template switching primer TSO is complementary to the aforementioned C base, and the primer is extended to synthesize double-stranded cDNA.

[0052] Furthermore, the RNA is reverse transcribed using a reverse transcription primer combination to synthesize double-stranded cDNA, and the PCR primer is used for amplification using the double-stranded cDNA as a template.

[0053] According to the second aspect, in one embodiment, a primer combination is provided, comprising: the reverse transcription primer set and PCR primers described in the first aspect;

[0054] The structure of the PCR primer includes, from the 5' end to the 3' end, a linker connection sequence, a sample tag sequence, and a target fragment complementary sequence;

[0055] The 5' end of the PCR primer is modified with a phosphate group;

[0056] The adapter connection sequence is used for splitting sample tags;

[0057] The sample label sequences of different samples are different;

[0058] The target fragment is the product obtained by extending the above reverse transcription primer set.

[0059] In this embodiment, the adapter connection sequence is used to connect with the adapter in the process of sequencing library construction. In addition, the adapter connection sequence is also used to detect the accuracy of the barcode. Since the accuracy of ONT is relatively low, when the detected sequence is consistent with the known sequence at both ends of the barcode, it can be confirmed that the detected barcode sequence is accurate, and the barcode can be directly split.

[0060] The linker connection sequence in this embodiment preferably adopts the sequence officially provided by ONT: 5'-ATCGCCTACCGTGAC-3'.

[0061] The target fragment is specifically a double-stranded cDNA obtained by extension of the template switching primer, and therefore, the complementary sequence of the target fragment is partially identical or completely identical to the universal sequence of the reverse transcription primer.

[0062] The sample tag sequence is a barcode, which is used to distinguish different RNA samples. Therefore, different samples have different barcodes. The barcodes can be purchased commercially.

[0063] In one embodiment, the PCR primer includes the nucleotide sequence shown in SEQ ID NO: 4;

[0064] SEQ ID NO: 4: 5'-phos / ATCGCCTACCGTGAC-barcode-AAGCAGTGGTATCAACGCAGAGT-3'.

[0065] The upstream primer and downstream primer of the PCR primer of the present invention are the same, that is, the two ends of the single-stranded cDNA are complementary, and sequences less than 500 bp are easy to be attached to each other and cannot be combined with the primer for amplification, thereby increasing the length of the cDNA library.

[0066] According to the third aspect, in one embodiment, a method for constructing a sequencing library is provided, comprising the following steps:

[0067] A reverse transcription step, comprising reverse transcribing the RNA sample using the reverse transcription primer set provided in the first aspect to obtain a reverse transcription product;

[0068] The amplification step includes performing PCR amplification on the reverse transcription product to obtain a PCR amplification product of the sequencing library.

[0069] The reverse transcription step specifically includes the following steps:

[0070] 1) Mix the RNA sample with the reverse transcription primer for reaction.

[0071] In this step, the RNA sample is total RNA; the reverse transcription primer includes a structure including: a universal sequence, a random sequence, an Oligo (dT) and an anchor sequence from the 5' end to the 3' end. The reverse transcription primer is the same as the reverse transcription primer described in the first aspect, and will not be repeated here.

[0072] The RNA sample is mixed with the reverse transcription primer for reaction at 72°C for 3-5 minutes and 42°C for 1-5 minutes. The reaction procedure is preferably 72°C for 3 minutes and 42°C for 2 minutes, wherein the temperature is lowered from 72°C to 42°C at a rate of -0.1°C / s. The RNA sample is first mixed with the reverse transcription primer for reaction, the purpose of which is to open the secondary structure of the RNA.

[0073] 2) Mixing the reverse transcription system containing the template switching primer with the reaction product of step 1) to perform a reverse transcription reaction.

[0074] In this step, the template switching primer is the same as the reverse transcription primer described in the first aspect and will not be described in detail here.

[0075] In this step, before mixing the reverse transcription system containing the template switching primer with the reaction product of step 1), the step further includes: incubating the configured reverse transcription system on a PCR instrument, and the incubation condition is preferably incubated at 42° C. for 1 min.

[0076] After the reverse transcription system containing the template switching primer is mixed with the reaction system of step 1), the reaction temperature is set to 42°C, the reverse transcription reaction time is 60-90min, and after the reaction is completed, the temperature is lowered to 4°C. Preferably, after the reaction product of step 1) is mixed with the reverse transcription system containing the template primer, the PCR instrument is preheated to 42°C, and the reverse transcription reaction is performed according to the following procedure: 42°C 90min, 4°C∞.

[0077] The reverse transcription system includes: template switching primer, reverse transcriptase, dNTP, dithiothreitol (DTT), template chain, and buffer, wherein the reverse transcriptase is preferably Superscript II RT.

[0078] 3) Purifying the product of the reverse transcription reaction in step 2) to obtain a reverse transcription product.

[0079] In this step, one purpose of purification is to remove the excess template switching primer TSO to prevent TSO from participating in the amplification reaction; the second purpose is to remove the reverse transcriptase in the reaction to prevent the reverse transcriptase from affecting the amplification reaction. The purification is preferably magnetic bead purification, and the reverse transcription product obtained after magnetic bead purification is double-stranded cDNA.

[0080] The magnetic bead purification specifically comprises the following steps:

[0081] Add nuclease-free water to the product of the reverse transcription reaction in step (2), and then add magnetic beads and mix well.

[0082] In this step, the magnetic beads are preferably 1 volume of AMPure XP magnetic beads; after adding the magnetic beads and mixing, it is preferably left at room temperature for 5 minutes.

[0083] (1) Place the reaction tube on a magnetic rack and let it stand until the liquid becomes clear. Remove the supernatant.

[0084] In this step, the standing time is preferably 2-5 minutes.

[0085] (3) Keep the reaction tube on the magnetic rack, add ethanol to rinse the magnetic beads, and remove the supernatant after standing.

[0086] In this step, the mass concentration of ethanol is 80%; step (3) is preferably repeated twice, and the washing is performed three times.

[0087] (4) Open the lid and let it dry. Remove the reaction tube from the magnetic rack and add the eluent.

[0088] In this step, the elution solution is preferably Elution Buffer; and the storage condition is preferably room temperature for 4 minutes.

[0089] (5) Centrifuge the reaction tube and place it on a magnetic rack. After the solution is clarified, save the supernatant.

[0090] In this step, the centrifugation is preferably short centrifugation, and the present invention has no particular limitation on the centrifugation conditions; the storage temperature of the supernatant is preferably -20°C.

[0091] The PCR amplification step specifically includes the following steps:

[0092] 1) Mix the reverse transcription product with the PCR reaction system for amplification reaction.

[0093] In this step, the PCR reaction system includes: nuclease-free water, amplification enzyme and PCR primers.

[0094] The amplification enzymes used in PCR amplification include 1) KAPA HiFi HotStart Uracil+ReadyMix, or 2) KAPA HiFi HotStart ReadyMix. The fidelity of the two amplification enzymes is better than that of ONT's official amplification enzyme 2x LongAmpTaq Master Mix. The experimental results show that using KAPA HiFi HotStart Uracil+ReadyMix can obtain a higher library yield.

[0095] The PCR primers in this step are the same as those described in the second aspect and will not be described in detail here.

[0096] In this step, the procedure of each cycle of the amplification reaction is preferably as follows: 95-98°C, 15-30s; 62-65°C, 15-30s; 72°C, 4-6min. Preferably, it is 98°C, 20s; 65°C, 15s; 72°C, 4.5min. The number of cycles is preferably 16-19, including but not limited to 16, 17, 18, 19.

[0097] After the cycle is completed, keep it in a 72℃ environment for 5 to 10 minutes and then cool it down to 12℃.

[0098] 2) Purify the reaction product of step 1) to obtain a PCR amplification product.

[0099] In this step, purification is preferably performed by magnetic bead purification.

[0100] The magnetic bead purification preferably comprises the following steps:

[0101] (1) Add magnetic beads to the reaction product and mix well.

[0102] In this step, the magnetic beads are preferably 1 volume of AMPure XP magnetic beads; after adding the magnetic beads and mixing, it is preferably left to stand at room temperature for 10 minutes.

[0103] (2) Place the reaction tube on a magnetic rack, add ethanol to rinse the magnetic beads, and remove the supernatant after standing.

[0104] In this step, the mass concentration of ethanol is 80%; the standing time is preferably 30 seconds; step (2) is preferably repeated once, and rinsing is performed twice.

[0105] (3) Remove the ethanol from the reaction tube, open the lid and let it dry, remove the reaction tube from the magnetic rack, add the eluent and place it aside.

[0106] In this step, the elution solution is preferably Elution Buffer; and the storage condition is preferably room temperature for 4 minutes.

[0107] (4) Centrifuge the reaction tube and place it on a magnetic rack. After the solution is clarified, take the supernatant.

[0108] The purpose of this step is to remove dimers and recover most of the fragments.

[0109] In this step, the centrifugation is preferably short centrifugation, and the present invention has no particular limitation on the centrifugation conditions.

[0110] (5) Take 1 / 3 of the purified product obtained in step (4), mix it with water and magnetic beads and set aside.

[0111] In this step, the magnetic beads are preferably 0.4 times the volume of AMPure XP magnetic beads.

[0112] (6) Place the reaction tube from step (5) on a magnetic rack and take out the supernatant after the solution becomes clear.

[0113] In this step, the solution is allowed to stand until it becomes clear; the standing time is preferably 2-5 minutes.

[0114] (7) Keep the reaction tube in step (6) on the magnetic rack at all times, add ethanol to rinse the magnetic beads, and remove the supernatant after standing.

[0115] In this step, the mass concentration of ethanol is 80%; the standing time is preferably 30 seconds; and step (7) is preferably repeated once more, with rinsing twice.

[0116] (8) Remove the ethanol from the reaction tube in step (7), open the lid and dry it, then take it out from the magnetic rack, add the remaining 2 / 3 of the purified product in step (4), mix well and set aside.

[0117] In this step, it is preferably placed at room temperature for 4 minutes.

[0118] (9) Centrifuge the reaction tube in step (8) and place it on a magnetic rack. After the solution is clarified, take the supernatant to obtain the purified PCR amplification product.

[0119] The purpose of this purification step is to remove small fragments and recover large fragments.

[0120] Furthermore, after obtaining the PCR amplification product, the sequencing library construction method further includes: linking the PCR product to obtain a sequencing library.

[0121] After the PCR amplification step is completed, the full-length transcript sequence is obtained, and then the libraries of different samples are pooled and sequencing adapters are added before sequencing.

[0122] In this step, the adapter is preferably an ONT sequencing adapter, which is commercially available.

[0123] According to the fourth aspect, in one embodiment, a sequencing library construction kit is provided, comprising the reverse transcription primer set described in the first aspect or the primer combination described in the second aspect.

[0124] In one embodiment, the sequencing library construction kit further includes: a sequencing adapter, and the sequencing adapter is preferably an ONT sequencing adapter.

[0125] In one embodiment, the sequencing library construction kit further includes: a reverse transcriptase and an amplification enzyme, wherein the reverse transcriptase is preferably Super script II RT, and the amplification enzyme is preferably 1) KAPA HiFi HotStart Uracil and ReadyMix, or 2) KAPA HiFi HotStart ReadyMix.

[0126] The reverse transcription primer set provided by the present invention improves the accuracy and sensitivity of sequencing, increases the output of sequencing data, increases the length of the full-length sequence, improves the data splitting rate, and improves the utilization of effective data; the F end of the PCR primer is the same as the R end, which increases the length of the cDNA library; KAPA HiFi HotStart Uracil+ReadyMix (2x) is used to improve the library output. Therefore, the reverse transcription primer set, primer combination, sequencing library construction method and sequencing library construction kit provided by the present invention can effectively improve the sequencing library output and fragment size, so as to obtain more offline data, and make the splitting rate of the full-length sequence higher, and obtain more effective data that can be used for analysis.

[0127] Example 1

[0128] This example uses four test samples (total RNA samples of human, rice, mouse, and chrysanthemum) to construct the ONT full-length transcriptome library. The library construction process of the ONT official full-length transcriptome is as follows:

[0129] a) Take 1 μg of total RNA into a 0.2 mL PCR tube, add water to 9 μL, then add 1 μL of 2 μM VN Primers (VNP) and 1 μL of 10 mM dNTPs, the total system is 11 μL, pipette to mix well and centrifuge;

[0130] b) Incubate at 65°C for 5 minutes and then cool rapidly on a pre-chilled ice box;

[0131] c) Prepare a mix in a new tube with the following reagents: 4 μL 5x RT Buffer, 1 μL RNaseOUT, 1 μL Nuclease-free water, 2 μL Strand-Switching Primer (SSP, at 10 μM), a total of 8 μL, pipette to mix well, and centrifuge;

[0132] d) adding the prepared mix in the previous step to the mRNA rapidly cooled and annealed in step b), pipetting and mixing, centrifuging, and incubating at 42° C. for 2 min in a PCR instrument;

[0133] e) Add 1 μL Maxima H Minus Reverse Transcriptase, so that the total system is 20 μL, pipette and mix well, centrifuge, and place on a PCR instrument for reverse transcription according to the following program: 42°C, 90 min; 85°C, 5 min; 4°C, ∞;

[0134] f) Divide the reaction from step e) into 4 equal parts, take 5μL of each part into a new 0.2mL PCR tube, and add 45μL of PCR amplification reaction solution. The PCR amplification reaction solution includes: 1.5μL Barcode Primers (BP01-BP12), 18.5μL Nuclease-free water, 25μL 2x LongAmp Taq Master Mix, and the total PCR reaction system is 50μL.

[0135] Use 5 μL of reverse transcribed RNA sample per PCR reaction (20 μL total). Therefore, there is enough material for up to 4 PCR reactions per sample. The same sample is added with the same barcode number.

[0136] g) Mix by pipetting and centrifugation, and place on a PCR instrument for amplification reaction according to the following program: 95°C, 30s; then enter 11-18 cycles: 95°C for 15s, 62°C for 15s, 65°C for 50s; after the cycle, 65°C for 6min, and maintain at 4°C;

[0137] h) Add 1 μL of NEB Exonuclease 1 to the PCR product, mix well by pipetting, and centrifuge. Place the product on a PCR machine and perform digestion according to the following program: 37°C for 15 min, 80°C for 15 min, and 4°C for ∞;

[0138] i) Pool the PCR reactions containing different barcode samples into a new 1.5 mL centrifuge tube;

[0139] i) resuspending AMPure XP beads by vortexing, adding 0.8 times the resuspended AMPure XP beads to step i), pipetting to mix, and placing on a room temperature mixer for 5 minutes;

[0140] k) Centrifuge the reaction tube briefly and place it on a magnetic rack. After the solution is clear, carefully remove the supernatant;

[0141] l) Keep the centrifuge tube on the magnetic rack, add 200 μL of freshly prepared 70% ethanol to rinse the magnetic beads, incubate at room temperature for 30 seconds, and then carefully remove the supernatant;

[0142] m) Repeat the previous step once, rinsing twice in total;

[0143] n) Remove any residual 70% ethanol, open the lid and briefly dry, remove the centrifuge tube from the magnetic rack, add 12μL of Eliution Buffer (EB), gently pipette to mix, and place on a room temperature mixer for 10 minutes.

[0144] o) Briefly centrifuge the reaction tube and place it on a magnetic rack. After the solution is clear, carefully pipette all the supernatant into a new 1.5 mL EP tube;

[0145] p) Take 1 μL of the purified product to detect the fragment size and concentration of DNA;

[0146] q) Take 100 fmol of the purified product into a new 1.5 mL EP tube, add Elution Buffer (EB) to a final volume of 11 μL, add 1 μL Rapid Adapter (RAP), mix by pipetting, centrifuge, incubate at room temperature for 5 min, centrifuge briefly, and place at -20 °C to wait for sequencing.

[0147] r) The primer nucleotide sequences and modifications used in the above experimental process are as follows:

[0148] VNP: 5′-phos / ACTTGCCTGTCGCTCTATCTTCTTTTTTTTTTTTTTTTTTTTVN-3′ (SEQ IDNO: 5)

[0149] V is A, C or G, and N is any base.

[0150] SSP: 5′-TTTCTGTTGGTGCTGATATTGCTmGmGmG-3′ (SEQ ID NO: 6)

[0151] In the nucleotide sequence shown in SEQ ID NO: 6, "m" indicates methylation.

[0152] Barcode Primer:

[0153] F-terminal: 5′-ATCGCCTACCGTGAC-barcode-ACTTGCCTGTCGCTCTATCTTC-3′ (SEQ ID NO: 7)

[0154] R-terminal: 5′-ATCGCCTACCGTGAC-barcode-TTTCTGTTGGTGCTGATATTGC-3′ (SEQ ID NO: 8)

[0155] The reagents mentioned in the above method are all provided in the PCR-cDNA Barcoding (SQK-PCB109) kit.

[0156] Example 2

[0157] This example uses 4 test samples (the same 4 test samples as in Example 1) to construct an ONT full-length transcriptome library. The experimental process for constructing the full-length transcriptome library is as follows:

[0158] 1. Reverse Transcription

[0159] a) Take 1 μg of Total RNA into a 0.2 mL PCR tube, add water to 3 μL, then add 1 μL of 12 μM dT Primer, the total system is 4 μL, pipette to mix well and centrifuge;

[0160] SMART technology reverse transcription primer dT primer:

[0161] 5'-AAGCAGTGGTATCAACGCAGAGTACNNNNNNNNTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3' (SEQ ID NO: 1)

[0162] b) V is A, C or G, and N is any base. Place in PCR instrument for reaction: 72℃, 3min; 42℃, 2min (72℃ to 42℃ with a cooling rate of -0.1℃ / s);

[0163] c) Prepare the reverse transcription mix in a new 0.2 mL PCR tube using the following reagents:

[0164] Table 1

[0165]

[0166]

[0167] TSO: 5'-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3' (SEQ ID NO: 3)

[0168] d) Mix the reverse transcription mix prepared in the previous step by pipetting and incubate it on a PCR instrument at 42° C. for 1 min, then add it to the PCR tube that has been reacted in step b), mix it by pipetting and centrifuge it;

[0169] e) Preheat the PCR instrument to 42°C and perform the reverse transcription reaction according to the following program: 42°C for 90 min, 4°C for ∞:

[0170] f) Add 40 μL of Nuclease-Free Water to the reaction in step e), then add 1 volume (50 μL) of AMPure XP magnetic beads, mix well by pipetting with a pipette tip, and leave at room temperature for 5 minutes.

[0171] AMPure XP beads were rotated and mixed at room temperature for 30 minutes before use to improve nucleic acid binding efficiency.

[0172] g) Place the reaction tube on a magnetic rack and let it stand for 2-5 minutes until the liquid becomes clear. Use a pipette to aspirate and discard the supernatant.

[0173] h) Keep the reaction tube on the magnetic rack, add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads, let stand at room temperature for 30 seconds, and then carefully discard the supernatant;

[0174] i) Repeat the previous step twice, rinsing three times in total, and remove the supernatant with a 10 μL pipette tip;

[0175] j) Open the lid and let it dry briefly. The standard of dryness is that the surface of the magnetic beads has no reflection and no cracks. Take the reaction tube out of the magnetic rack, add 51 μL Elution Buffer, gently pipette and mix, and leave at room temperature for 4 minutes;

[0176] k) Briefly centrifuge the reaction tube and place it on a magnetic rack. After the solution is clarified, carefully pipette all the supernatant into a new 1.5 mL EP tube and store it at -20°C for long-term storage.

[0177] 2. PCR Amplification

[0178] a) Take out all reagents needed for PCR, thaw on ice, vortex each reagent gently, spin off, and store on ice;

[0179] b) Prepare the PCR reaction mix according to the following reagents:

[0180] Table 2

[0181] Reagents Dosage (μL) Nuclease-Free Water 23.6 KAPA HiFi HotStart Uracil+ReadyMix(2x) 50 PCR primer (12 μM) 6.4 Total volume 80

[0182] The F and R ends of the PCR primer in Table 2 are both: 5'-phos / ATCGCCTACCGTGAC-barcode-AAGCAGTGGTATCAACGCAGAGT-3' (SEQ ID NO: 4)

[0183] c) Take 20 μL of the purified product obtained by reverse transcription in the previous step and put it into a new 0.2 mL PCR tube, add 80 μL of the prepared PCR reaction mix, mix by pipetting, and centrifuge;

[0184] d) Place the sample on a PCR instrument and perform PCR amplification according to the following procedure:

[0185] Table 4

[0186]

[0187]

[0188] e) Take 1 μL of PCR product and measure the concentration using Qubit. The concentration should be between 20-40 ng / μL. If the concentration is lower than 20 ng / μL, the backup should also be amplified by PCR and then merged.

[0189] 3. PCR Product Purification

[0190] a) Take out the Ampure XP Beads 30 minutes in advance and place them at room temperature. Vortex and mix thoroughly before use.

[0191] b) Add 1 volume (100 μL) of Ampure XP beads to the PCR product, mix well by pipetting, and leave at room temperature for 10 min;

[0192] c) Place the reaction tube on a magnetic rack and let it stand for 2-5 minutes until the liquid becomes clear. Use a pipette to aspirate and discard the supernatant.

[0193] d) Keep the reaction tube on the magnetic rack, add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads, let it stand at room temperature for 30 seconds, and then carefully discard the supernatant;

[0194] e) Repeat the previous step once, rinsing twice in total;

[0195] f) Remove any residual 80% ethanol, open the lid and briefly air dry, remove the reaction tube from the magnetic rack, add 51 μL of Eliution Buffer (EB), pipette gently to mix, and place at room temperature for 4 minutes;

[0196] g) Briefly centrifuge the reaction tube and place it on a magnetic rack. After the solution is clarified, carefully pipette all the supernatant into a new 1.5 mL EP tube;

[0197] h) Take 1 / 3 of the purified product (17 μL) from the previous step into a new 1.5 mL centrifuge tube, add water to the system to 50 μL, add 0.4 times the volume (20 μL) of Ampure XP beads, mix well with a pipette tip, and leave at room temperature for 10 min;

[0198] i) Place the reaction tube on a magnetic rack and let it stand for 2-5 minutes until the liquid becomes clear. Use a pipette to aspirate and discard the supernatant.

[0199] j) Keep the reaction tube on the magnetic rack, add 200 μL of freshly prepared 80% ethanol to rinse the magnetic beads, let it stand at room temperature for 30 seconds, and then carefully discard the supernatant;

[0200] k) Repeat the previous step once, rinsing twice in total;

[0201] l) Remove any residual 80% ethanol, open the lid and briefly air dry, remove the reaction tube from the magnetic rack, add the remaining volume from step g), gently pipette to mix, and place at room temperature for 4 minutes;

[0202] m) Briefly centrifuge the reaction tube and place it on a magnetic rack. After the solution is clarified, carefully pipette all the supernatant into a new 1.5 mL EP tube;

[0203] n) Take 1 μL of the purified product to detect the fragment size and concentration of DNA.

[0204] 4. Add ONT connector

[0205] Pool the libraries with different barcodes, add 1 μL Rapid Adapter (RAP), mix by pipetting, centrifuge, and incubate at room temperature for 5 min.

[0206] 5. Sequencing on Nanopore

[0207] Figure 2.1 This is the amplification detection diagram of library construction using the ONT official kit in Example 1. Figure 2.2 This is an amplification detection diagram for the construction of the full-length transcriptome library provided in this example.

[0208] Figure 2.1 , 2.2 By comparison, it can be seen that the effects of using the PCR amplification primers in Example 1 (SEQ ID NO: 7 and SEQ ID NO: 8) and the PCR amplification primers in Example 2 (SEQ ID NO: 4) on the size of the amplified fragment are different. Compared with the PCR amplification primers in Example 1 with different F ends and R ends, the PCR amplification primers in Example 2 have the same F end and R end, which greatly increases the length of the cDNA library.

[0209] Example 3

[0210] In this example, a full-length transcriptome library construction method was used to construct an ONT full-length transcript library.

[0211] The experimental process of the full-length transcriptome library construction method used in this embodiment is the same as that in Example 2, with the only difference being that: 1) the RNA sample is: Universal Human Reference RNA (UHRR, purchased from Agilent, catalog number 740000) sample; 2) PCR amplification enzymes are KAPA HiFi HotStart Uracil+ReadyMix (2x) and KAPA HiFi HotStartReadyMix (2x) for PCR amplification.

[0212] Table 3 shows the effect of using UHRR to test two amplification enzymes. The results show that KAPA HiFi HotStartUracil+ReadyMix (2x) has better amplification effect, and the library yield is about twice that of the other enzyme.

[0213] Table 3: Amplification results of different amplification enzymes

[0214]

[0215] Example 4

[0216] In this example, a full-length transcriptome library construction method was used to construct an ONT full-length transcript library.

[0217] The experimental process of this embodiment and the method of constructing a full-length transcriptome library in embodiment 2 is the same, except that the reverse transcription primers used in this embodiment are: SEQ ID NO: 2, SEQ ID NO: 9 are:

[0218] SEQ ID NO: 2:

[0219] V is A, C or G, and N is any base.

[0220] SEQ ID NO:9:

[0221] V is A, C or G, and N is any base.

[0222] Since the sequence before the random primer of the reverse transcription primer in Example 2 (universal sequence) is the same as the sequence before the template switching primer TSOrGrG+G (universal sequence), the sequences at both ends of the target fragment of the sequencing library in Example 2 are the same. Since the sequence before the random primer of the reverse transcription primer in Example 4 (universal primer + landmark base sequence) is different from the sequence before TSOrGrG+G (universal sequence), the sequences at both ends of the target fragment of the library in Example 4 are different. Using Example 2 and Example 4 for comparison, the effects of using the reverse transcription primers in Example 2 and Example 4 on the splitting of the full-length sequence are compared, and the results of the full-length sequence splitting comparison are shown in Table 5.

[0223] Table 5 Full-length sequence splitting comparison results

[0224]

[0225]

[0226] Table 5 shows the splitting rates of the full-length sequences of the ONT official library construction kit used in Example 1, and the full-length transcription library construction methods used in Examples 2 and 4. As can be seen from Table 5, the splitting rate of the full-length sequence in Example 2 is low, and the splitting rate of the full-length sequence in Example 4 is at the same level as that of the ONT official kit in Example 1, wherein the full-length sequence splitting rates of the two reverse transcription primers used in Example 4 are not much different. From the experimental results of Examples 2 and 4 in Table 5, it can be shown that when splitting the full-length sequence, there is a difference between the sequence before the random primer of the reverse transcription primer and the sequence before TSO rGrG+G, which can reduce judgment errors and thus improve the splitting rate.

[0227] Regarding the splitting rate of full-length sequences, full-length sequences refer to sequences containing a complete cDNA structure (containing 5′ and 3′ primers at both ends and correctly paired), and the full-length sequence splitting rate refers to the ratio of the number of full-length sequences to the number of sequenced sequences.

[0228] Table 6 Comparison of sequencing results

[0229]

[0230] Table 6 shows the data output and full-length sequence length of Example 1 using the ONT official library construction kit, and Example 2 and Example 4 using the full-length transcription library construction method. As can be seen from Table 6, compared with Example 1, the library output of Example 2 and Example 4 increased by more than 130%, and the full-length sequence length increased by an average of about 36%. The full-length sequence lengths of the two reverse transcription primers used in Example 4 were not much different.

[0231] The above specific examples are used to illustrate the present invention, which is only used to help understand the present invention and is not intended to limit the present invention. For those skilled in the art, according to the concept of the present invention, some simple deductions, modifications or substitutions can be made.

Claims

1. A reverse transcription primer set, characterized in that: include: Reverse transcription primers and template switching primers; The structure of the reverse transcription primer includes, from the 5' end to the 3' end, a universal sequence, a random sequence, Oligo (dT) and an anchor sequence; The structure of the template switching primer includes the universal sequence, rGrG+G in sequence from the 5' end to the 3' end, where rG is riboguanosine (RNA) and +G is LNA-modified guanosine.

2. The reverse transcription primer set according to claim 1, characterized in that A landmark base sequence is arranged between the universal sequence and the random sequence of the reverse transcription primer; The iconic base sequence consists of at least one base; Preferably, the landmark base sequence consists of 1 to 20 bases.

3. The reverse transcription primer set according to claim 1 or 2, characterized in that: The landmark base sequence consists of n landmark base units, where n is at least 1 and is an integer; The sequence of the marker base unit consists of at least one base, and the sequence of the marker base unit is identical to the 3' terminal sequence of the universal sequence.

4. The reverse transcription primer set according to any one of claims 1 to 3, characterized in that: The universal sequence is 5'-AAGCAGTGGTATCAACGCAGAGTAC-3'; Preferably, the random sequence consists of 6 to 12 random bases N, where N is any base; Preferably, the Oligo(dT) consists of 15 to 40 thymine Ts; Preferably, the anchor sequence is VN, V is adenine A, guanine G or cytosine C, and N is any base.

5. The reverse transcription primer set according to any one of claims 1 to 4, characterized in that: The landmark base is GTAC or GTACGTAC.

6. The reverse transcription primer set according to any one of claims 1 to 5, characterized in that: The reverse transcription primer includes the nucleotide sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 9; The template switching primer includes the nucleotide sequence shown in SEQ ID NO:

3.

7. A primer combination, characterized in that: include: The reverse transcription primer set and PCR primer according to any one of claims 1 to 6; The structure of the PCR primer includes, from the 5' end to the 3' end, a linker connection sequence, a sample tag sequence, and a complementary sequence of the target fragment; The 5' end of the PCR primer is modified with a phosphate group; The adapter connection sequence is used for splitting sample tags; The sample label sequences of different samples are different; The target fragment is the product obtained by extending the reverse transcription primer set according to claim 1.

8. The primer combination according to claim 7, characterized in that: The PCR primer includes the nucleotide sequence shown in SEQ ID NO:

4.

9. A method for constructing a sequencing library, characterized in that: The following steps are involved: A reverse transcription step, comprising reverse transcribing the RNA sample using the reverse transcription primer set according to any one of claims 1 to 6 to obtain a reverse transcription product; The amplification step includes performing PCR amplification on the reverse transcription product to obtain a PCR amplification product.

10. The construction method according to claim 9, characterized in that: In the reverse transcription step, the RNA sample is first mixed with a reverse transcription primer for reaction, and then the reaction product is mixed with a reverse transcription system containing a template switching primer for reverse transcription reaction to obtain double-stranded cDNA.

11. The construction method according to claim 9 or 10, characterized in that: In the amplification step, the reverse transcription product is PCR amplified using PCR primers; The structure of the PCR primer includes, from the 5' end to the 3' end, a linker connection sequence, a sample tag sequence and a target fragment complementary sequence, and the 5' end of the PCR primer is modified with a phosphate group; The sample label sequences of different samples are different; The target fragment is the reverse transcription product according to claim 9; Preferably, the PCR primer comprises the nucleotide sequence shown in SEQ ID NO:

4.

12. The construction method according to any one of claims 9 to 11, characterized in that: In the amplification step, the amplification enzyme used for PCR amplification includes 1) KAPA HiFi HotStart Uracil and ReadyMix, or 2) KAPA HiFi HotStart ReadyMix.

13. The construction method according to any one of claims 9 to 12, characterized in that: In the reverse transcription step, the RNA sample is mixed with the reverse transcription primer for reaction at the following procedures: 72°C, 3 to 5 min; 42°C, 1 to 5 min; Preferably, after the reaction product is mixed with the reverse transcription system containing the template switching primer, the reaction temperature is set to 42° C., the reverse transcription reaction time is 60 to 90 min, and after the reaction is completed, the temperature is lowered to 4° C.

14. The construction method according to any one of claims 9 to 13, characterized in that: In the amplification step, the program of each cycle was as follows: 95-98°C, 15-30s; 62-65°C, 15-30s; 72°C, 4-6min; Preferably, in the amplification step, the number of cycles is 16 to 19; Preferably, in the amplification step, after the cycle is completed, the environment is maintained at 72°C for 5 to 10 minutes and then cooled to 12°C; Preferably, the method further comprises a linker connection step, including linking the PCR products to obtain a sequencing library.

15. A sequencing library construction kit, characterized in that: Comprising the reverse transcription primer set according to any one of claims 1 to 6 or the primer combination according to claim 7 or 8; Preferably, it also includes: a sequencing adapter.

Images