Engineering strain for efficiently synthesizing shikimic acid as well as construction method and application of engineering strain

Abstract

The invention provides an engineering strain for reducing by-products quinic acid and glutamic acid in the process of biosynthesizing shikimic acid and application of the engineering strain, and belongs to the technical field of bioengineering.According to the engineering strain, an escherichia coli recombinant strain HYY1458 serves as an initial strain, quinic acid dehydrogenase (ydiB) is knocked out, so that the synthetic route of quinic acid is blocked, and the yield of the shikimic acid is increased; glutamate synthetase (gltB) and glutamate dehydrogenase (gdhA) are knocked out to partially hinder a glutamic acid synthesis route, the constructed strain is named as an escherichia coli engineering strain YY1127, the escherichia coli engineering strain YY1127 is used for fermentation culture, the content of quinic acid and glutamic acid is reduced by 85.3%, the purity of biosynthesized shikimic acid is improved, and the yield of the shikimic acid is increased. The subsequent separation and purification difficulty is reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to an engineering strain for efficiently synthesizing shikimic acid and a construction method and application thereof. Background Art

[0002] Shikimic acid, also known as 3,4,5-trihydroxy-1-cyclohexene-1-carboxylic acid, is a white or colorless crystal that is easily soluble in water. It is a key substance for the synthesis of aromatic amino acids by plants and microorganisms. Shikimic acid is an important intermediate in the shikimic acid pathway. As a natural drug, shikimic acid has excellent application prospects in antiviral, antithrombotic, antitumor, anti-inflammatory and antibacterial properties. Shikimic acid is the core raw material for the synthesis of the anti-influenza drug Oseltamivir phosphate, which has strong antiviral activity against almost all influenza viruses (such as H5N1, H1N1, H7N9, etc.) and has great market potential.

[0003] Although chemical synthesis can basically meet the needs of large-scale industrial production, the production cost is high, the yield has a lot of room for improvement, and the raw materials and reagents used in industrial chemical synthesis can cause serious harm to the human body and the environment. Researchers have explored the production of shikimic acid by biosynthesis. The Chinese patent with publication number CN116751729A, entitled A temperature-controlled high-yield shikimic acid recombinant Escherichia coli and its application, discloses an engineered strain for producing shikimic acid. However, the strain will produce a large amount of quinic acid and glutamic acid by-products during the production process, resulting in a decrease in the purity of shikimic acid. In addition, due to the low isoelectric point of glutamic acid, excessive glutamate accumulation during subsequent separation and purification will produce crystals that block the pipeline, affecting the continuous production of shikimic acid extraction. Summary of the invention

[0004] In view of the problems existing in the prior art, the present invention provides an engineered strain for efficiently synthesizing shikimic acid, which can reduce the content of by-products quinic acid and glutamic acid, improve the purity of biosynthesized shikimic acid, and reduce the difficulty of subsequent separation and purification.

[0005] To achieve the above object, the present invention is implemented through the following technical solutions:

[0006] The invention discloses an engineering strain for efficiently synthesizing shikimic acid. The engineering strain is Escherichia coli YY1127, and the preservation number is CCTCC M 2024155.

[0007] Furthermore, Escherichia coli YY1127 was constructed by using the recombinant Escherichia coli strain HYY1458 as the starting strain, and knocking out the quinate dehydrogenase ydiB gene, glutamate synthetase gltB gene and glutamate dehydrogenase gdhA gene in sequence.

[0008] Further, the nucleotide sequence encoding the ydiB gene is shown in SEQ ID No. 1;

[0009] The nucleotide sequence encoding the gltB gene is shown in SEQ ID No. 2;

[0010] The nucleotide sequence encoding the gdhA gene is shown in SEQ ID No.3.

[0011] Furthermore, the recombinant Escherichia coli strain HYY1458 is derived from the China Center for Type Culture Collection, with the collection number being CCTCC NO:M 20222036.

[0012] The present invention discloses a method for constructing an engineering strain for efficiently synthesizing shikimic acid, comprising the following steps:

[0013] S1: The expression vector pCas9 was introduced into the Escherichia coli recombinant strain HYY1458 by electroporation to construct the initial engineered strain SA1;

[0014] S2: Specific primers for the quinate dehydrogenase ydiB gene were designed through the CHOPCHOP website, and the ydiB-pTarget plasmid was obtained by inverse PCR amplification. Subsequently, the ydiB-pTarget plasmid and the upstream and downstream homologous arm fragments of the quinate dehydrogenase ydiB gene were co-introduced into SA1 through electroporation, and the quinate dehydrogenase ydiB gene knockout strain SA2 was obtained through screening and verification;

[0015] S3: Based on the SA2 strain, steps S1 and S2 were repeated to design specific primers for the glutamate synthetase gltB gene and construct the gltB-pTarget plasmid. The upstream and downstream homologous arms of the glutamate synthetase gltB were amplified and then electro-transformed and co-introduced into SA2, and the strain SA3 lacking both the quinate dehydrogenase ydiB gene and the glutamate synthetase gltB gene was screened;

[0016] S4: Based on the SA3 strain, repeat steps S1 and S2 to design specific primers for the glutamate dehydrogenase gdhA gene and construct the gdhA-pTarget plasmid, amplify the upstream and downstream homologous arm sequences of glutamate dehydrogenase gdhA, and introduce the gdhA-pTarget plasmid and the upstream and downstream homologous arm sequences of glutamate dehydrogenase gdhA into SA3 through electroporation, and obtain Escherichia coli YY1127 that is simultaneously lacking the quinate dehydrogenase ydiB gene, glutamate synthetase gltB gene and glutamate dehydrogenase gdhA gene through screening and verification.

[0017] The invention discloses application of an engineered strain in producing shikimic acid.

[0018] Another object of the present invention is to disclose a method for producing shikimic acid, comprising the following steps:

[0019] (1) culturing the primary seed solution of Escherichia coli YY1127 according to claim 1;

[0020] (2) inoculating the primary seed solution cultured in step (1) into a fermentation tank to obtain a secondary seed solution;

[0021] (3) The secondary seed liquid cultured in step (2) is inoculated into the fermentation medium of the fermentation tank, and the fermentation culture is first carried out at 28-32° C. for 22-26 hours, and then the fermentation culture is continued at 36-40° C. and 200-220 rpm for 14-18 hours to obtain a fermentation liquid containing shikimic acid.

[0022] Furthermore, the fermentation medium of the fermentation tank is composed of the following components: glucose, yeast extract, peptone, ammonium sulfate, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium chloride, magnesium sulfate, ferrous sulfate, calcium chloride, sodium citrate, manganese chloride, niacin, cobalt chloride, VB1, glutamic acid, and the balance is water.

[0023] Furthermore, the fermentation medium of the fermenter is composed of the following ingredients: 20 g / L glucose, 5 g / L yeast extract, 2 g / L peptone, 5 g / L ammonium sulfate, 1 g / L dipotassium hydrogen phosphate, 3 g / L potassium dihydrogen phosphate, 2 g / L sodium chloride, 0.02 g / L magnesium sulfate, 0.01 g / L ferrous sulfate, 0.015 g / L calcium chloride, 0.005 g / L sodium citrate, 0.05 g / L manganese chloride, 0.1 mg / L niacin, 0.2 mg / L cobalt chloride, 0.01 mg / L VB1, 0.1 g / L glutamic acid, and the balance is water.

[0024] Furthermore, the pH value of the fermentation medium is 6.8-7.2.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The invention knocks out quinic acid dehydrogenase ydiB, gltB and gdhA in sequence from the recombinant Escherichia coli strain HYY145 to construct an engineering strain YY1127, reduces the generation of byproducts quinic acid and glutamic acid in the process of biosynthesizing shikimic acid, thereby reducing the content of the byproducts quinic acid and glutamic acid, improving the purity of shikimic acid, and also improving the yield of shikimic acid, and ensures that the continuous production of shikimic acid extraction is not affected by glutamic acid crystals blocking a pipeline during subsequent separation and purification. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 : Electrophoresis of colony PCR verification results of strain SA2 (ΔydiB);

[0028] Figure 2 : Electrophoresis of colony PCR verification results of strain SA3 (ΔydiB, ΔgltB);

[0029] Figure 3 : Electrophoresis of the colony PCR verification results of the engineered bacteria Escherichia coli YY1127 (SA4) (ΔydiB, ΔgltB, ΔgdhA);

[0030] Figure 4 OD of recombinant Escherichia coli strain HYY1458 and engineered strain Escherichia coli YY1127 during fermentation of shikimic acid 600 and the change curve of shikimic acid production;

[0031] Figure 5A : HPLC spectrum of quinic acid and shikimic acid in the fermentation supernatant of the recombinant Escherichia coli strain HYY1458 in Example 4;

[0032] Figure 5B : HPLC spectrum of quinic acid and shikimic acid in the fermentation supernatant of the engineered strain Escherichia coli YY1127 in Example 4;

[0033] Fig. 6A : HPLC spectrum of quinic acid in the fermentation supernatant of the recombinant Escherichia coli strain HYY1458 in Example 5;

[0034] Figure 6B : HPLC spectrum of quinic acid in the fermentation supernatant of the engineered strain Escherichia coli YY1127 in Example 5;

[0035] Figure 7 : Glutamic acid production in the fermentation supernatant of the recombinant Escherichia coli strain HYY1458 and the engineered strain Escherichia coli YY1127. DETAILED DESCRIPTION

[0036] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the drawings in the embodiments of the present invention. The described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.

[0037] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources;

[0038] The experimental methods in the following embodiments are conventional methods unless otherwise specified.

[0039] (i) The starting strain Escherichia coli HYY1458 in the following examples is derived from China Center for Type Culture Collection, with the accession number being CCTCC NO: M 20222036.

[0040] (2) The shikimic acid-producing strain Escherichia coli YY1127 constructed by the present invention, whose Latin name is: Escherichiacoli, has been deposited in the China Center for Type Culture Collection (CCTCC for short; address: Wuhan University, Wuhan, China; postal code: 430072) on January 22, 2024, with the deposit number CCTCC M 2024155.

[0041] (III) The culture medium involved in the following embodiments is as follows:

[0042] LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L.

[0043] LB solid medium: peptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, agar 15 g / L.

[0044] LB slant medium: solutes and their concentrations are: tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, agar powder 20g / L, and the balance is water; pH 7.0-7.2, autoclave at 121°C for 20min, cool to 60°C, add ampicillin to make the concentration of ampicillin in the system 50mg / L.

[0045] The fermentation medium composition was: glucose 20 g / L, yeast powder 10 g / L, tryptone 5 g / L, citric acid 2 g / L, K2HPO4 3 g / L, KH2PO4 1 g / L, NaCl 1 g / L, 7H2OMgSO4 3 g / L, tryptophan 0.1 g / L, tyrosine 0.1 g / L, phenylalanine 0.1 g / L, glutamic acid 0.1 g / L, and the pH was adjusted to 7.0.

[0046] Primary seed shake flask medium: peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L, glycerol 5g / L, glutamic acid 0.1g / L, balance water, pH 6.8-7.2, autoclave at 121°C for 20min, cool to 60°C, add ampicillin to make the concentration of ampicillin in the system 50mg / L.

[0047] Secondary seed culture medium: peptone 15g / L, yeast powder 2.5g / L, potassium dihydrogen phosphate 0.5g / L, dipotassium hydrogen phosphate 2g / L, glycerol 1g / L, glucose 6g / L, glutamic acid 0.1g / L, balance water; pH 7.0-7.2, autoclave at 121°C for 20min, cool to 60°C, add ampicillin to make the concentration of ampicillin in the system 50mg / L.

[0048] Fermentation tank fermentation medium: solutes and their concentrations are: glucose 20g / L, yeast extract 5g / L, peptone 2g / L, ammonium sulfate 5g / L, dipotassium hydrogen phosphate 1g / L, potassium dihydrogen phosphate 3g / L, sodium chloride 2g / L, magnesium sulfate 0.02g / L, ferrous sulfate 0.01g / L, calcium chloride 0.015g / L, sodium citrate 0.005g / L, manganese chloride 0.05g / L, niacin 0.1mg / L, cobalt chloride 0.2mg / L, vitamin B1 0.01mg / L, glutamic acid 0.1g / L, the balance is water, pH 6.8-7.2.

[0049] Example 1

[0050] Construction of ydiB gene knockout strain SA2 (ΔydiB)

[0051] (1) The pCas9 plasmid was transferred into the recombinant Escherichia coli strain HYY1458 to construct strain SA1 (pCas9), and the strain SA1 (pCas9) was made competent for electroporation.

[0052] (2) The target site N20 of the gene ydiB was screened through the CHOPCHOP website, and specific primers were designed. The pTarget plasmid was used as a template and ydiB-revF / R was used as primers for reverse PCR amplification. The obtained product was transferred into the Dh5α competent cell, the ydiBpTarget plasmid was extracted, and the constructed plasmid was verified by sequencing.

[0053] (3) Specific primers were designed based on the gene sequence of ydiB in the genome of the strain. The genome of strain HYY1458 was used as a template, and ydiB-F / ydiBR and ydiB-XF / ydiB-XR were used to amplify the 200 bp gene sequence of the upstream and downstream genes of the gene ydiB. The PCR amplification conditions were as follows: denaturation at 98°C for 10 s, annealing at 56°C for 5 s, and extension at 72°C for 10 s for 30 cycles; post-extension at 72°C for 2 min.

[0054] (4) Overlap PCR was performed on the upstream and downstream 200 bp gene sequences obtained in step (3) using overlap extension PCR to obtain the homology arms of ydiB.

[0055] (5) The ydiBpTarget plasmid obtained in step (2) and the upstream and downstream homologous arms of ydiB obtained in step (4) were electroporated into the competent strain SA1 (pCas9). ydiB-F / R was used as primers for verification to obtain the ydiB knockout strain SA2.

[0056] Among them, the primer sequences are shown from 5'-3'

[0057] ydiB-revF:CTGCGTGGCTATAACACCGAgttttagagctagaaatagc

[0058] ydiB-revR:TCGGTGTTATAGCCACGCAGactagtattatacctaggac

[0059] ydiB-F:atggatgttaccgcaaaat

[0060] ydiB-R:tcaggcaccgaaccccatg

[0061] ydiB-XF:ctgccaaactggtggtacatccgggacttc

[0062] ydiB-XR:gaagtcccggatgtaccaccagtttggcag

[0063] The PCR fragment of the recombinant E. coli strain HYY1458 is 867bp, while the PCR fragment of the engineered bacteria SA2 (ΔydiB) is 400bp. When conducting the PCR experiment, a DNA Marker was used as a reference. The coverage range of the DNA Marker was 0-2000bp. Two lanes were set up in the experiment: Lane 1 used the genomic DNA of E. coli HYY1458 as a template for PCR amplification; Lane 2 used the genomic DNA of SA2 (ΔydiB) as a template. Figure 1 As shown, the sizes of the PCR product fragments observed in the two lanes were consistent with expectations, that is, lane 1 showed the amplified product corresponding to the HYY1458 genome, while lane 2 presented the expected 400 bp fragment, indicating that the PCR amplification of the target region in SA2 (ΔydiB) was successful, verifying the accuracy of the experimental operation and the specific amplification of the target gene fragment.

[0064] Example 2

[0065] Construction of strain SA3 lacking both ydiB and gltB genes

[0066] (1) The pCas9 plasmid was transferred into Escherichia coli SA2 to construct strain SA2 (pCas9), and the strain SA2 (pCas9) was made competent for electroporation.

[0067] (2) The target site N20 of the gltB gene was screened through the CHOPCHOP website, and specific primers were designed. The pTarget plasmid was used as a template and gltB-revF / R was used as primers for reverse PCR amplification. The obtained product was transferred into the Dh5α competent cell, the gltBpTarget plasmid was extracted, and the constructed plasmid was verified by sequencing.

[0068] (3) Specific primers were designed based on the gene sequence of gltB in the genome of the strain, and the genome of strain HYY1458 was used as a template to amplify the 900 bp gene sequence of the upstream and downstream genes of the gene gltB using gltB-F / gltBR and gltB-XF / gltB-XR.

[0069] The PCR conditions were as follows: denaturation at 98°C for 10 s, annealing at 56°C for 5 s, and extension at 72°C for 10 s for 30 cycles; post-extension at 72°C for 2 min.

[0070] (4) Overlap PCR was performed on the upstream and downstream 900 bp gene sequences obtained in step (3) using overlap extension PCR to obtain the homologous arms of gltB.

[0071] (5) The gltBpTarget plasmid obtained in step (2) and the upstream and downstream homologous arms of gltB obtained in step (4) were electroporated into the competent strain SA2 (pCas9). Verification sequencing was performed using gltB-F / R as primers to obtain the gltB knockout strain SA3.

[0072] Among them, the primer sequences are shown from 5'-3'

[0073] gltB-revF:CTGCTGAAATACGTCCACGGgttttagagctagaaatagc

[0074] gltB-revR:CCGTGGACGTATTTCAGCAGactagtattatacctaggac

[0075] gltB-F:ATCCCTTGAGAGGGATAACTG

[0076] gltB-R:AACTCAGCTGCGCTACGAC

[0077] gltB-XF: CGTGGGATGGCCCGGCGGGCGCGAGCTGATGGCACAGCTT

[0078] gltB-XR: AAGCTGTGCCATCAGCTCGCGCCCGCCGGGCCATCCCACG

[0079] The PCR fragment of the recombinant E. coli strain HYY1458 is 4461bp, while the PCR fragment of the SA3 engineered bacteria (ΔydiB, ΔgltB) is 1800bp. When conducting the PCR experiment, a DNA Marker was used as a reference. The coverage range of this DNA Marker was 0-5000bp. Two lanes were set up in the experiment: Lane 1 used the genomic DNA of the recombinant E. coli strain HYY1458 as a template for PCR amplification; Lane 2 used the genomic DNA of the SA3 engineered bacteria (ΔydiB, ΔgltB) as a template. Figure 2 As shown, the sizes of the PCR product fragments observed in the two lanes were consistent with expectations, that is, Lane 1 showed the amplified product corresponding to the genome of the recombinant Escherichia coli strain HYY1458, while Lane 2 presented the expected 1800 bp fragment, indicating that the PCR amplification of the target region in SA3 (ΔydiB, ΔgltB) was successful, verifying the accuracy of the experimental operation and the specific amplification of the target gene fragment.

[0080] Example 3

[0081] Construction of engineered bacteria Escherichia coli YY1127

[0082] (1) The pCas9 plasmid was transferred into Escherichia coli SA3 to construct strain SA3 (pCas9), and the strain SA3 (pCas9) was made competent for electroporation.

[0083] (2) The target site N20 of the gdhA gene was screened through the CHOPCHOP website, and specific primers were designed. The pTarget plasmid was used as a template and gdhA-revF / R was used as primers for reverse PCR amplification. The obtained product was transferred into the Dh5α competent cell, and the gdhApTarget plasmid was extracted. The constructed plasmid was verified by sequencing.

[0084] (3) Specific primers were designed according to the gene sequence of gdhA in the genome of the strain, and the genome of strain HYY1458 was used as a template to amplify the 300 bp gene sequence of the upstream and downstream genes of the gene gdhA using gdhA-F / gdhAR and gdhA-XF / gdhA-XR.

[0085] The PCR conditions were as follows: denaturation at 98°C for 10 s, annealing at 56°C for 5 s, and extension at 72°C for 10 s for 30 cycles; post-extension at 72°C for 2 min.

[0086] (4) Overlap PCR was performed on the upstream and downstream 300 bp gene sequences obtained in step (3) using overlap extension PCR to obtain the homologous arms of gdhA.

[0087] (5) The gdhApTarget plasmid obtained in step (2) and the upstream and downstream homologous arms of gdhA obtained in step (4) were electroporated into the competent strain SA2 (pCas9). The gdhA-F / R primers were used for verification to obtain the gdhA knockout engineered strain Escherichia coli YY1127.

[0088] Among them, the primer sequences are shown from 5'-3'

[0089] gdhA-revF:AATCTGCCACTCGACCATCGgttttagagctagaaatagc

[0090] gdhA-revR:CGATGGTCGAGTGGCAGATTactagtattatacctaggac

[0091] gdhA-F: ATGGATCAGACATATTCTCTGG

[0092] gdhA-R:TTAAATCACAACCCTGCGCCAGC

[0093] gdhA-XF:GTATGCGCTTCCATCCGTCAATGCCGACCACCATCGAAGC

[0094] gdhA-XR:GCTTCGATGGTGGTCGGCATTGACGGATGGAAGCGCATAC

[0095] The PCR fragment of the recombinant E. coli strain HYY1458 is 1344bp, while the PCR fragment of the engineered strain E. coli YY1127 (SA4) (ΔydiB, ΔgltB, ΔgdhA) is 600bp. When conducting the PCR experiment, a DNA Marker was used as a reference. The coverage range of the DNA Marker was 0-2000bp. Two lanes were set up in the experiment: Lane 1 used the genomic DNA of E. coli HYY1458 as a template for PCR amplification; Lane 2 used the genomic DNA of the engineered E. coli strain YY1127 (SA4) (ΔydiB, ΔgltB, ΔgdhA) as a template. Figure 3 As shown, the sizes of the PCR product fragments observed in the two lanes were consistent with expectations, that is, lane 1 showed the amplified product corresponding to the HYY1458 genome, while lane 2 showed the expected 600bp fragment, indicating that the PCR amplification of the target region in the engineered strain Escherichia coli YY1127 was successful, verifying the accuracy of the experimental operation and the specific amplification of the target gene fragment.

[0096] Embodiment 4:

[0097] The OD of the engineered strain Escherichia coli YY1127 and the recombinant strain Escherichia coli HYY1458 in the production of shikimic acid was verified by shake flask experiments. 600 The operation method is as follows:

[0098] (1) The recombinant Escherichia coli strain HYY1458 was used as a control group, and the engineered strain Escherichia coli YY1127 obtained in Example 3 was used as an experimental group. A single colony of the experimental group was inoculated into a 250 mL Erlenmeyer flask containing 50 mL of culture medium and cultured at 37° C. overnight. Then, the engineered strain Escherichia coli YY1127 cultured overnight was transferred to an Erlenmeyer flask containing 50 mL of fermentation medium at a 5% inoculum amount, and fermented at 30° C. and 200 rpm for 48 h to obtain a fermentation broth. The recombinant Escherichia coli strain HYY1458 was treated in the same manner as a control.

[0099] (2) The detection method is as follows:

[0100] Pretreatment of fermentation broth: Centrifuge the fermentation broth at 12000r / min for 10min to obtain the supernatant. After diluting to an appropriate multiple, the diluted fermentation broth supernatant is treated with a membrane for further purification to remove impurities that may interfere with the detection.

[0101] Determination of Shikimic Acid:

[0102] A 1g / L concentration of shikimic acid solution was prepared and diluted to 0.1, 0.2, 0.4, 0.6 and 0.8g / L, and detected by high performance liquid chromatography (HPLC), wherein the detection instrument was Shimadzu high performance liquid chromatograph, and the detection parameters were that the chromatographic column used a C18 column; the mobile phase was 5mM sulfuric acid; the flow rate was set to 0.5mL / min; the injection volume was 5μL, the detector was an ultraviolet detector, the detection wavelength was 214nm, and the column temperature was 55°C. The peak time and the peak area corresponding to different concentrations of shikimic acid were obtained, and the concentration of the shikimic acid solution was used as the horizontal coordinate and the peak area was used as the vertical coordinate to draw a standard curve to obtain a linear regression equation, and ensure that the regression coefficient of the obtained linear regression equation was not less than 0.990. After the standard curve was constructed, the pretreated fermentation broth sample was tested under the same HPLC conditions, and the actual concentration of shikimic acid in the sample was calculated by searching the corresponding peak area of ​​the obtained sample on the previously established standard curve.

[0103] The results are as follows Figure 5A and Figure 5BAs shown in the figure, the peak at 4.4 min on the liquid chromatogram is quinic acid, and the peak at 5.5 min is shikimic acid. By comparing the HPLC spectra of the recombinant Escherichia coli strain HYY1458 and the engineered strain Escherichia coli YY1127, the results showed that the shikimic acid production of the recombinant Escherichia coli strain HYY1458 in the control group was 4.722 g / L, and the shikimic acid production of the engineered strain Escherichia coli YY1127 in the experimental group was 5.921 g / L, and the shikimic acid production increased by 25.4%.

[0104] Determination of Quinic Acid:

[0105] A 3g / L concentration quinic acid solution was prepared and diluted to 0.3, 0.6, 0.9, 1.8 and 3.0g / L, and detected by high performance liquid chromatography (HPLC), wherein the detection instrument was a Shimadzu high performance liquid chromatograph, and the chromatographic column was a C18 column; the mobile phase was 0.4% phosphoric acid; the flow rate was set to 0.8mL / min; the injection volume was 5μL, the detector was an ultraviolet detector, the detection wavelength was 254nm, and the column temperature was 55°C. The peak time and the peak area corresponding to different concentrations of quinic acid were obtained, and the concentration of the quinic acid solution was used as the horizontal coordinate and the peak area was used as the vertical coordinate to draw a standard curve, and a linear regression equation was obtained to ensure that the regression coefficient of the obtained linear regression equation was not less than 0.990. After the standard curve was constructed, the pretreated fermentation broth sample was tested under the same HPLC conditions, and the actual concentration of quinic acid in the sample was calculated by searching the corresponding peak area of ​​the obtained sample on the previously established standard curve.

[0106] The test results showed that the quinic acid production of the recombinant Escherichia coli strain HYY1458 in the control group was 0.746 g / L, and the quinic acid production of the engineered strain Escherichia coli YY1127 in the experimental group was 0.125 g / L, and the quinic acid production was reduced by 83.2%.

[0107] Determination of Glutamate:

[0108] Use the M-100 biosensor analyzer for testing. First calibrate with 1g / L standard solution, then put the diluted fermentation liquid into the test rack and click test.

[0109] The test results showed that the glutamate production of the recombinant E. coli strain HYY1458 in the control group was 0.53 g / L, and the glutamate production of the engineered strain E. coli YY1127 in the experimental group was 14 mg / L, and the glutamate production was reduced by 97.4%.

[0110] Example 5

[0111] In order to explore the changes in byproducts quinic acid and glutamic acid produced by the recombinant Escherichia coli strain HYY1458 and the engineered strain Escherichia coli YY1127 during fermentation in a fermenter, a method for producing shikimic acid is provided, comprising the following steps:

[0112] 1. Cultivation of primary seed solution of recombinant E. coli strain HYY1458 and engineered strain E. coli YY1127:

[0113] (1) Single colonies of the recombinant E. coli strain HYY1458 and the engineered strain E. coli YY1127 were inoculated into LB slant medium and cultured at 33°C for 24 h;

[0114] (2) The slant culture media of the recombinant Escherichia coli strain HYY1458 and the engineered strain Escherichia coli YY1127 prepared in step (1) were resuspended with 10 mL of sterile water respectively, and then inoculated into a seed shake flask containing primary seed shake flask culture medium (5L seed shake flask containing 1L of liquid) at an inoculum rate of 2% (v / v), and cultured at 30° C. for 16 h to obtain a primary seed solution.

[0115] 2. Cultivation of secondary seed liquid of recombinant E. coli strain HYY1458 and engineered strain E. coli YY1127

[0116] The first-stage seed solution prepared by the above method was inoculated into a fermenter containing the second-stage seed culture medium at a transplant volume of 5% (v / v), and cultured at 30°C for 12 h. The dissolved oxygen concentration was 40%, and the OD 600 The secondary seed liquid is about 3.

[0117] 3. Fermentation of shikimic acid by recombinant E. coli strain HYY1458 and engineered strain E. coli YY1127

[0118] The secondary seed solution prepared in the step was transferred into a 50L fermentation tank filled with fermentation medium at a transplant volume of 15% (v / v), and cultured at 30°C for 24 hours. The dissolved oxygen concentration can be 15%-20%, and the OD 600 When the temperature is about 80, the temperature is raised to 38°C and cultured for 16 hours. The dissolved oxygen concentration can be 30%-40%. When the glucose content in the fermentation process is lower than 2g / L, 600g / L of glucose aqueous solution is automatically added to the fermentation tank to keep the glucose content of the fermentation system between 0.2g / L-2g / L to obtain a fermentation liquid containing shikimic acid.

[0119] Example 6

[0120] Compared with Example 5, Example 6 changes the conditions for culturing the primary seed solution, the secondary seed solution and fermenting to produce shikimic acid. Specifically, a method for producing shikimic acid comprises the following steps:

[0121] 1. Primary seed culture of recombinant E. coli strain HYY1458 and engineered strain E. coli YY1127

[0122] (1) Single colonies of the recombinant E. coli strain HYY1458 and the engineered strain E. coli YY1127 were inoculated into LB slant medium and cultured at 30°C for 22 h;

[0123] (2) The slant culture media of the recombinant Escherichia coli strain HYY1458 and the engineered strain Escherichia coli YY1127 prepared in step (1) were resuspended with 10 mL of sterile water respectively, and then inoculated into a seed shake flask containing primary seed shake flask culture medium (the liquid volume of a 5L seed shake flask is 1L) at an inoculum size of 1.5% (v / v), and cultured at 27° C. for 14 h to obtain a primary seed solution.

[0124] 2. Secondary seed culture of recombinant E. coli strain HYY1458 and engineered strain E. coli YY1127

[0125] The first-level seed solution prepared by the above method was inoculated into a fermenter containing a second-level seed culture medium at a transplant volume of 4% (v / v), and cultured at 27°C for 10 h. The dissolved oxygen concentration was 60%, and the OD 600 The secondary seed liquid is about 2.5.

[0126] 3. Fermentation of shikimic acid by recombinant E. coli strain HYY1458 and engineered strain E. coli YY1127

[0127] The secondary seed solution prepared by the above method was inoculated into a 50L fermentation tank filled with fermentation medium at a transplant volume of 13% (v / v) and cultured at 28°C for 22 hours. The dissolved oxygen concentration can be 15%-20%, and the OD 600 When the temperature is about 80, the temperature is raised to 36°C and cultured for 14 hours. The dissolved oxygen concentration can be 30%-40%. When the glucose content in the fermentation process is lower than 2g / L, 600g / L of glucose aqueous solution is automatically added to the fermentation tank to keep the glucose content of the fermentation system between 0.2g / L-2g / L to obtain a fermentation liquid containing shikimic acid.

[0128] Example 7

[0129] Compared with Example 5, Example 7 changes the conditions for culturing the primary seed solution, the secondary seed solution and fermenting to produce shikimic acid. Specifically, a method for producing shikimic acid comprises the following steps:

[0130] 1. Cultivation of primary seed solution of recombinant E. coli strain HYY1458 and engineered strain E. coli YY1127:

[0131] (1) Single colonies of the recombinant E. coli strain HYY1458 and the engineered strain E. coli YY1127 were inoculated into LB slant medium and cultured at 33°C for 24 h;

[0132] (2) The slant culture media of the recombinant Escherichia coli strain HYY1458 and the engineered strain Escherichia coli YY1127 prepared in step (1) were resuspended with 10 mL of sterile water respectively, and then inoculated into a seed shake flask containing primary seed shake flask culture medium (5L seed shake flask containing 1L of liquid) at an inoculum rate of 2% (v / v), and cultured at 30° C. for 16 h to obtain a primary seed solution.

[0133] 2. Secondary seed culture of recombinant E. coli strain HYY1458 and engineered strain E. coli YY1127

[0134] The first-stage seed solution prepared by the above method was inoculated into a fermenter containing the second-stage seed culture medium at a transplant volume of 5% (v / v), and cultured at 30°C for 12 h. The dissolved oxygen concentration was 40%, and the OD 600 The secondary seed liquid is about 3.

[0135] 3. Fermentation of shikimic acid by recombinant E. coli strain HYY1458 and engineered strain E. coli YY1127

[0136] The secondary seed solution prepared by the above method was inoculated into a 50L fermentation tank filled with fermentation medium at a transplant volume of 15% (v / v) and cultured at 32°C for 26 hours. The dissolved oxygen concentration can be 15%-20%, and the OD 600 When the temperature is about 80, the temperature is raised to 40°C and cultured for 18 hours. The dissolved oxygen concentration can be 30%-40%. When the glucose content in the fermentation process is lower than 2g / L, 600g / L of glucose aqueous solution is automatically added to the fermentation tank to keep the glucose content of the fermentation system between 0.2g / L-2g / L to obtain a fermentation liquid containing shikimic acid.

[0137] The fermentation broth containing shikimic acid obtained by fermentation with the recombinant strain of Escherichia coli and the engineered strain of Escherichia coli in Example 5 was used to detect the production of shikimic acid, quinic acid and glutamic acid using the determination method of Example 4. The experimental results were as follows:

[0138] Fermentation was carried out in a 50L fermenter for 48 h. The OD values ​​of the recombinant E. coli strain HYY1458 and the engineered strain E. coli YY1127 during the production of shikimic acid were 600 The curve of shikimic acid production is as follows Figure 4 As shown, the final shikimic acid production in the recombinant E. coli strain HYY1458 was 112.824 g / L, and the shikimic acid production in the engineered E. coli strain YY1127 was 143.583 g / L, and the shikimic acid production was increased by 27.3%.

[0139] After 48 h of fermentation, the HPLC spectra of quinic acid in the fermentation supernatant of the recombinant E. coli strain HYY1458 and the engineered strain E. coli YY1127 are as follows: Fig. 6A and Figure 6B As shown, the peak at 4.327 min is quinic acid. The quinic acid yield in the recombinant E. coli strain HYY1458 is 16.361 g / L, and the quinic acid yield produced by the engineered strain E. coli YY1127 is 2.408 g / L, and the quinic acid yield is reduced by 85.3%.

[0140] After 48 h of fermentation, the yield of glutamate in the fermentation supernatant of the recombinant E. coli strain HYY1458 and the engineered strain E. coli YY1127 was as follows: Figure 7 As shown, the glutamate production of the recombinant E. coli strain HYY1458 was 8.94 g / L, and the glutamate production of the engineered strain E. coli YY1127 was 0.06 g / L, and the glutamate production was reduced by 99.3%.

[0141] In summary, the engineered strain Escherichia coli YY1127 obtained in the present invention can effectively reduce the content of by-products quinic acid and glutamic acid during the fermentation process of producing shikimic acid, improve the purity of biosynthesized shikimic acid, reduce the difficulty of subsequent separation and purification, and can be applied to the industrialization of fermentation production of shikimic acid.

[0142] The above descriptions are merely embodiments of the present invention and are not intended to limit the patent scope of the present invention. Any equivalent structure or equivalent process transformation made using the contents of the present invention specification, or directly or indirectly applied in other related technical fields, are also included in the patent protection scope of the present invention.

Claims

1. An engineered strain for efficiently synthesizing shikimic acid, characterized in that: The engineered strain is Escherichia coli YY1127, and the deposit number is CCTCC M 2024155.

2. The engineered strain for efficiently synthesizing shikimic acid according to claim 1, characterized in that: The Escherichia coli YY1127 is constructed by using the Escherichia coli recombinant strain HYY1458 as a starting strain, and knocking out the quinate dehydrogenase ydiB gene, the glutamate synthetase gltB gene and the glutamate dehydrogenase gdhA gene in sequence.

3. The engineered strain for efficiently synthesizing shikimic acid according to claim 2, characterized in that: The nucleotide sequence encoding the ydiB gene is shown in SEQ ID No. 1; The nucleotide sequence encoding the gltB gene is shown in SEQ ID No. 2; The nucleotide sequence encoding the gdhA gene is shown in SEQ ID No.

3.

4. The engineered strain for efficiently synthesizing shikimic acid according to claim 2, characterized in that: The recombinant Escherichia coli strain HYY1458 is from China Center for Type Culture Collection, with the collection number being CCTCC NO:M 20222036.

5. The method for constructing an engineered strain for efficiently synthesizing shikimic acid according to claim 1, characterized in that: The following steps are involved: S1: The expression vector pCas9 was introduced into the Escherichia coli recombinant strain HYY1458 by electroporation to construct the initial engineered strain SA1; S2: Specific primers for the quinate dehydrogenase ydiB gene were designed through the CHOPCHOP website, and the ydiB-pTarget plasmid was obtained by inverse PCR amplification. Subsequently, the ydiB-pTarget plasmid and the upstream and downstream homologous arm fragments of the quinate dehydrogenase ydiB gene were co-introduced into SA1 through electroporation, and the quinate dehydrogenase ydiB gene knockout strain SA2 was obtained through screening and verification; S3: Based on the SA2 strain, steps S1 and S2 were repeated to design specific primers for the glutamate synthetase gltB gene and construct the gltB-pTarget plasmid. The upstream and downstream homologous arms of the glutamate synthetase gltB were amplified and then electro-transformed and co-introduced into SA2, and the strain SA3 lacking both the quinate dehydrogenase ydiB gene and the glutamate synthetase gltB gene was screened; S4: Based on the SA3 strain, repeat steps S1 and S2 to design specific primers for the glutamate dehydrogenase gdhA gene and construct the gdhA-pTarget plasmid, amplify the upstream and downstream homologous arm sequences of glutamate dehydrogenase gdhA, and introduce the gdhA-pTarget plasmid and the upstream and downstream homologous arm sequences of glutamate dehydrogenase gdhA into SA3 through electroporation, and obtain Escherichia coli YY1127 that is simultaneously lacking the quinate dehydrogenase ydiB gene, glutamate synthetase gltB gene and glutamate dehydrogenase gdhA gene through screening and verification.

6. Use of the engineered strain as claimed in claim 1 in producing shikimic acid.

7. A method for producing shikimic acid, characterized in that: The following steps are involved: (1) culturing the primary seed solution of Escherichia coli YY1127 according to claim 1; (2) inoculating the primary seed solution cultured in step (1) into a fermentation tank to obtain a secondary seed solution; (3) The secondary seed liquid cultured in step (2) is inoculated into the fermentation medium of the fermentation tank, and the fermentation culture is first carried out at 28-32° C. for 22-26 hours, and then the fermentation culture is continued at 36-40° C. and 200-220 rpm for 14-18 hours to obtain a fermentation liquid containing shikimic acid.

8. The method for producing shikimic acid according to claim 7, characterized in that: The fermentation medium of the fermentation tank is composed of the following components: glucose, yeast extract, peptone, ammonium sulfate, dipotassium hydrogen phosphate, potassium dihydrogen phosphate, sodium chloride, magnesium sulfate, ferrous sulfate, calcium chloride, sodium citrate, manganese chloride, niacin, cobalt chloride, VB1, glutamic acid, and the balance is water.

9. The method for producing shikimic acid according to claim 8, characterized in that: The fermentation medium of the fermentation tank is composed of the following components: 20g / L glucose, 5g / L yeast extract, 2g / L peptone, 5g / L ammonium sulfate, 1g / L dipotassium hydrogen phosphate, 3g / L potassium dihydrogen phosphate, 2g / L sodium chloride, 0.02g / L magnesium sulfate, 0.01g / L ferrous sulfate, 0.015g / L calcium chloride, 0.005g / L sodium citrate, 0.05g / L manganese chloride, 0.1mg / L niacin, 0.2mg / L cobalt chloride, 0.01mg / L VB1, 0.1g / L glutamic acid, and the balance is water.

10. The method for producing shikimic acid according to claim 8 or 9, characterized in that: The pH value of the fermentation medium is 6.8-7.2.

Images