Rice AFR1 gene and application thereof in controlling occipital development and leaf included angle

Abstract

The invention discloses a rice AFR1 gene and application of the rice AFR1 gene in controlling occipital development and leaf included angle. The gene sequence is shown as a sequence table SEQ ID No: 1, and the protein sequence is shown as a sequence table SEQ ID No: 2. It is identified for the first time that AFR1 gene expression can obviously control rice leaf pillow development and leaf included angle size, rice AFR1 protein mutation enables the leaf pillow length to be increased, cells to be increased and the leaf included angle to be increased, and rice AFR1 protein overexpression enables the leaf pillow length to be shortened, the cells to be reduced and the leaf included angle to be reduced. The protein and the coding gene thereof have important theoretical and practical significance for improving the close planting property of plants and the yield of crops, can play an important role in genetic breeding of crops, and have wide application prospects.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and in particular relates to a rice AFR1 gene and an application thereof in controlling pulvinus development and leaf angle size. Background Art

[0002] Among the world's food crops, rice is the main food source for about half of the population, especially in Asian countries, where rice is an indispensable staple food in people's daily diet. Under high-density planting conditions, too many rice plants may affect the plant's sensitivity to light and effective absorption of nutrients, leading to a decrease in yield. Therefore, the implementation of a reasonable close planting strategy is particularly important in agricultural production. Improving rice plant type and optimizing the use of space between plants can effectively improve rice's photosynthesis efficiency and nutrient acquisition ability, thereby increasing overall yield. This strategy not only helps to enhance the growth potential of rice, but is also one of the important ways to achieve sustainable agricultural development.

[0003] The main traits of an ideal rice plant type include plant height, number of tillers, panicle type, leaf shape, leaf angle, and tiller angle (CHENL, XIAO Y, TANG W, et al. Practices and Prospects of Super Hybrid Rice Breeding [J]. Rice Science, 2007, 14 (2): 71-77.). Among them, tiller angle and leaf angle are considered to be important agronomic traits that affect rice planting density. Ideal tiller angle and leaf angle can maximize yield. The pulvinus is composed of the pulvinus band, auricle, and ligule, and is a mechanical tissue unique to monocotyledonous grasses. The presence and development of the pulvinus directly affect the size of the leaf angle. Appropriately reducing the leaf angle helps to increase light transmittance, thereby enhancing the leaf's ability to capture light energy. Therefore, further identification and isolation of genes involved in controlling rice leaf angles has a high application value. Summary of the invention

[0004] The purpose of the present invention is to provide an AFR1 gene and its application in controlling the development of rice pulvinus and the size of leaf angle.

[0005] Rice AFR1 gene, wherein the polynucleotide of the AFR1 gene is as shown in (a), (b), (c) or (d):

[0006] (a) a polynucleotide as shown in SEQ ID No: 1 in the sequence listing; or

[0007] (b) a polynucleotide that can hybridize with the complementary sequence of SEQ ID No: 1 under stringent hybridization conditions, wherein the protein encoded by the polynucleotide still has the function of controlling pulvinus development and leaf angle;

[0008] (c) a polynucleotide having at least 90% homology with the polynucleotide shown in SEQ ID No: 1; or

[0009] (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1, and the protein encoded by the polynucleotide mutant still has the function of controlling pulvinus development and leaf angle.

[0010] Rice AFR1 protein, wherein the amino acid sequence of the AFR1 protein is as shown in (a), (b) or (c):

[0011] (a) the amino acid sequence shown in SEQ ID No: 2 in the sequence listing; or

[0012] (b) an amino acid having at least 90% homology with the amino acid shown in SEQ ID No: 2; or

[0013] (c) A protein mutant obtained by deleting, substituting or inserting one or more amino acids on the basis of the protein shown in SEQ ID No: 2, and the protein still has the function of controlling pulvinus development and leaf angle.

[0014] A vector containing the rice AFR1 gene.

[0015] An engineered bacterium containing the rice AFR1 gene vector.

[0016] Primers for amplifying any fragment of the rice AFR1 gene.

[0017] The rice AFR1 gene is used in controlling the development of rice pulvinus and the size of leaf angle.

[0018] A method for increasing the angle of rice leaves and reducing the expression level of AFR1 protein in rice.

[0019] A method for reducing the angle of rice leaves and increasing the expression level of AFR1 protein in rice.

[0020] Beneficial effects of the present invention: The present invention identifies for the first time that the expression of the AFR1 gene can significantly control the development of rice pulvinus and the size of the leaf angle. The rice AFR1 protein mutation increases the pulvinus length, increases the cell size, and increases the leaf angle. The rice AFR1 protein overexpression shortens the pulvinus length, reduces the cell size, and reduces the leaf angle. The protein of the present invention and its encoding gene have important theoretical and practical significance for improving the dense planting of plants and crop yields, and will play an important role in crop genetic breeding, with broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1It was obtained for the rice AFR1 mutant;

[0022] In the figure, a is the target site of the AFR1CDS sequence; b is the wild type and three mutant sequences.

[0023] Figure 2 is the expression level of AFR1 in the overexpression strain.

[0024] Figure 3 The whole plant phenotypes of rice mutants and overexpressing plants;

[0025] In the figure, a is a mutant plant; b is an overexpression plant.

[0026] Figure 4 is the leaf angle of rice mutants and overexpression plants;

[0027] In the figure, a is phenotype; b is data statistics.

[0028] Figure 5 The dorsal pulvinus phenotypes of rice mutants and overexpressing plants.

[0029] Figure 6 The dorsal length of the occipital was measured.

[0030] Figure 7 Longitudinal section of the dorsal occipital lobe (a) and cell length analysis (b). DETAILED DESCRIPTION

[0031] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0032] Example 1 Obtaining Rice AFR1 Mutants

[0033] The 45-66 bp of the CDS sequence of gene AFR1 (Os10g21460) was selected as the target site (e.g. Figure 1a), the homology arm primers were AFR1-u3-F: ggcACGAGATGTCCGTGCTACCG (SEQ ID NO: 3), AFR1-u3-R: aaacCGGTAGCACGGACATCTCG (SEQ ID NO: 4), the identification primers were AFR1-cas9-Seq-F: CCAACTGTCCCTGCAAGAAA (SEQ ID NO: 5), AFR1-cas9-Seq-R: TGGAACCCTAGATGCACAAC (SEQ ID NO: 6), and the specific steps of CRIPSR / Cas9 vector construction were referred to Zeng Dongchang et al. (Zeng Dongchang, Ma Xingliang, Xie Xianrong, et al. Operational methods for plant CRISPR / Cas9 multi-gene editing vector construction and mutation analysis [J]. Chinese Science: Life Sciences, 2018, 48(07): 783-794.). The constructed vector was introduced into Nipponbare using Agrobacterium EHA105-mediated transgenic method (commissioned by the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences), and three independent afr1 mutants were obtained, namely, one missing base A, two missing bases TA, and TA replaced by C. They were named afr1-1, afr1-2, and afr1-3, respectively. Figure 1 b.

[0034] Example 2 Obtaining AFR1 overexpression material

[0035] Using Nipponbare as the background material, the CDS sequence of AFR1 was cloned by PCR amplification technology, and was connected to the pCAMBIA1300 vector by restriction digestion and ligation. The restriction sites were KpnI and SalI, and the primers used were AFR1-CDS-F: CGGGGTACCATGATTGCGGCGGTCGGC (SEQ ID NO: 7), AFR1-CDS-R: CGCGTCGACTCAGGCCACTTTCACGTTTGTCT (SEQ ID NO: 8). After the sequencing was correct, the transgenic plants were obtained by Agrobacterium EHA105-mediated transgenic method (commissioned by the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences), and the rice lines identified as positive and with high gene expression were named AFR1-OE-1, AFR1-OE-2 and AFR1-OE-3. The AFR1-OE lines used in this article are all transgenic homozygous lines. After 14 days of pot culture, RNA from the aerial parts of AFR1-overexpressing rice was extracted and reversed using ACTIN-qRT-F:

[0036] TGACGGAGCGTGGTTACTCAT (SEQ ID NO: 9), ACTIN-qRT-R: GCAATGCCAGGGAACATAGTG (SEQ ID NO: 10), AFR1-qRT-F: CACAATCACCAAAGCCACAGA (SEQ ID NO: 11), AFR1-qRT-R: GAGCCCTTGAGGAGGAAGAAA (SEQ ID NO: 12) primers to detect AFR1 expression, Figure 2 The results showed that the expression level of AFR1 in the AFR1 overexpression strain was significantly higher than that in the wild type, among which the relative expression level of AFR1 gene in AFR1-OE-1 was the highest.

[0037] Example 3 Phenotypic Identification of Rice Mutants and Overexpression Materials

[0038] The obtained rice mutants and overexpression plants were cultured in pots for 50 days and their phenotypes were observed. Figure 3 . Randomly select individual rice plants of various types and take photos ( Figure 4 a), with the pulvinus as the intersection point, the sheath and the leaf blade as one edge each ( Figure 4 a white dotted line), and the angle of the fourth leaf at the top of the main tiller was measured and statistically analyzed using ImageJ software ( Figure 4 b) It was found that the AFR1 mutant material showed a significant increase in leaf angle phenotype compared to the wild type, while the material overexpressing the gene showed a significant decrease in leaf angle phenotype, indicating that AFR1 can change the leaf angle of rice.

[0039] Example 4 Observation of pulvinus development in rice mutants and overexpression materials

[0040] The pulvinus was cut off from the rice seedlings, and the dorsal length of the pulvinus was observed and measured under a microscope ( Figure 5 The red double-headed arrow position), the analysis results are as follows Figure 6 The pulvinus length of the mutant was significantly longer than that of the wild type, and the pulvinus length of the overexpressing plant was significantly shorter than that of the wild type. The longitudinal sections of the pulvinus were made and the cell morphology was observed under an ultraviolet microscope ( Figure 7 a), use the software that comes with the microscope to measure the cell length and analyze it ( Figure 7 b), it was found that the mutant cells were larger than the wild type, while the overexpression strain had an increased number of cells, smaller cells, and more densely arranged cells compared to the wild type.

[0041] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A rice AFR1 gene, characterized in that: The polynucleotide of the AFR1 gene is shown in (a), (b), (c) or (d): (a) a polynucleotide as shown in SEQ ID No: 1 in the sequence listing; or (b) a polynucleotide that can hybridize with the complementary sequence of SEQ ID No: 1 under stringent hybridization conditions, wherein the protein encoded by the polynucleotide still has the function of controlling pulvinus development and leaf angle; (c) a polynucleotide having at least 90% homology with the polynucleotide shown in SEQ ID No: 1; or (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1, and the protein encoded by the polynucleotide mutant still has the function of controlling pulvinus development and leaf angle.

2. Rice AFR1 protein, characterized in that The amino acid sequence of the AFR1 protein is shown in (a), (b) or (c): (a) the amino acid sequence shown in SEQ ID No: 2 in the sequence listing; or (b) an amino acid having at least 90% homology with the amino acid shown in SEQ ID No: 2; or (c) A protein mutant obtained by deleting, substituting or inserting one or more amino acids on the basis of the protein shown in SEQ ID No: 2, and the protein still has the function of controlling pulvinus development and leaf angle.

3. A vector containing the rice AFR1 gene according to claim 1.

4. An engineered bacterium containing the rice AFR1 gene vector according to claim 3.

5. Primers for amplifying any fragment of the rice AFR1 gene according to claim 1.

6. Use of the rice AFR1 gene according to claim 1 in controlling the development of rice pulvinus and the size of leaf angle.

7. A method for increasing the angle of rice leaves, characterized in that: Reduce the expression level of AFR1 protein in rice.

8. A method for reducing the angle of rice leaves, characterized in that: Increase the expression level of AFR1 protein in rice.

Images