System and method for cloning toxic genes

Abstract

The invention belongs to the technical field of synthetic biology, and particularly relates to a system and a method for cloning toxic genes, and the system comprises a host transformed by a cryptographic subsystem, a cloning vector transformed by a codon and a target gene transformed by the codon. By using the system, the expression of the toxic gene can be completely blocked, and the problem that the toxic gene protein expression product seriously interferes with the growth state and mutation of cells of hosts such as escherichia coli is solved, so that the target gene can be successfully cloned in an anti-toxic strain, and the success rate and timeliness of gene synthesis are guaranteed.

Description

Technical Field

[0001] The present invention belongs to the technical field of synthetic biology, and in particular relates to a system and method for cloning toxic genes, including a cloning host and a cloning vector. Background Art

[0002] Synthetic biology is an emerging discipline that has developed in recent years. Its main goal is to design and construct a variety of new devices, networks and biological pathways through DNA-encoded biological component modules. The most critical issue is how to synthesize or modify genes.

[0003] In gene synthesis production, various types of genes are involved, such as genes expressed as cell surface receptors, genes expressed as antibodies, genes expressed as DNA polymerases, genes expressed as salivary amylases, genes expressed as sugar synthesis-related proteins, etc. In general, the gene synthesis process includes splitting the gene into oligo DNA and chemically synthesizing it, and then synthesizing multiple segments of oligo DNA into double-stranded DNA under the action of DNA polymerase. The double-stranded DNA is connected to various DNA vectors by enzyme cutting, enzyme ligation or recombination, and then transformed into Escherichia coli cells for propagation. The propagated plasmid is finally sequenced and verified to obtain the target gene.

[0004] However, after the gene cloning is completed, further protein expression will be performed in the host. Although the synthetic / cloned product of the gene is not toxic, the protein expression product of some genes (expressed by non-expected leakage, also known as the product produced by background expression) will seriously interfere with the growth state of cells such as Escherichia coli, resulting in abnormal bacterial growth or even death. In this application, such genes are referred to as "toxic genes", such as restriction endonuclease genes (restriction endonucleases can cut host DNA to cause toxicity), certain glycosyltransferase genes (adding glycosylation modification at certain sites of host proteins, resulting in abnormal function), certain antibody genes (certain antibodies target and bind host proteins, resulting in inhibition of the protein activity), etc. At the same time, the Escherichia coli host cell may also spontaneously undergo gene deletion mutations, transversion mutations, insertion mutations, etc. to survive itself due to the inability to tolerate the expression products of some of the above genes, such as EcoRI, BamHI restriction endonucleases, UDG uracil glycosyltransferases, etc., which will seriously affect the success rate and timeliness of gene synthesis.

[0005] More importantly, with the development of synthetic biology, the demand for reconstruction of synthetic pathways for a variety of natural products continues to increase, such as paclitaxel, squalene, lycopene, etc. These synthetic pathways often contain more than a dozen or even dozens of functional genes rearranged into clusters. Functional genes are more likely to produce E. coli host toxicity, and as long as one of these genes is toxic to the E. coli host, the final large plasmid cannot be successfully synthesized. Therefore, solving the synthesis of toxic genes is of great significance to the development of synthetic biology.

[0006] Currently, there are some methods for synthesizing toxic genes: ① Replace the high-copy replicon of the vector with a low-copy replicon. ② Use special strains EPI300 and EPI400 to reduce the vector copy number, reduce the copy number of toxic genes in the host cell, and then reduce leakage expression (i.e. background expression). ③ Use an inhibitory expression sequence, such as adding a LacO sequence to the 5' end of the target gene. ④ Cultivate at low temperature to reduce protein activity. ⑤ Replace the strong promoter with a weak promoter. ⑥ Use a rigorous promoter to more rigorously control leakage expression.

[0007] It is understandable that these methods have changed the characteristics of the vector to a large extent, but they can only reduce the background expression and cannot completely block the leakage expression. More importantly, in actual production, for genes with strong toxicity, even a trace amount of leakage expression will still cause the death of the host bacteria or mutation of the toxic gene, and the use of the above methods still cannot avoid toxicity. Therefore, an expression system that completely blocks leakage expression is needed, and will not have a significant impact on the subsequent application scenarios of the vector carrying the target gene. Summary of the invention

[0008] In order to solve the above technical problems, the present invention will provide a gene cloning system and method that can smoothly complete the biosynthesis of toxic genes and completely block the expression of toxic genes.

[0009] The technical route for achieving the above-mentioned purpose of the present invention is as follows:

[0010] One of the technical solutions provided by the present invention is a gene cloning system, which comprises: a host with a modified codon system, a cloning vector with a modified codon system, and a target gene with a modified codon system;

[0011] The host with modified codon system is to perform codon degeneration on the host genome while ensuring normal expression of the host genome, wherein the codon degeneration refers to deleting at least one of the multiple codons encoding the same amino acid, retaining at least one codon, replacing the deleted codon with a synonymous codon, and deleting the tRNA corresponding to the deleted codon;

[0012] Furthermore, when the deleted codon corresponds to multiple tRNAs, all corresponding tRNAs need to be deleted;

[0013] Furthermore, after the codon degeneracy and the corresponding tRNA are deleted, it is ensured that the host genome can continue to express normally. If the codon degeneracy and the corresponding tRNA are deleted, it is necessary to select other codons for degeneracy and deletion of the corresponding tRNA.

[0014] Preferably, codons encoding leucine, alanine, glycine, proline, arginine, serine, and threonine are selected for degeneracy;

[0015] Preferably, codons encoding leucine, arginine, and serine are selected for degeneracy;

[0016] Optimally, serine was selected for codon degeneracy;

[0017] Preferably, the host includes but is not limited to Escherichia coli, Bacillus subtilis, Bacillus pumilus, Saccharomyces cerevisiae, Pichia pastoris, etc.;

[0018] More preferably, the host is Escherichia coli;

[0019] More preferably, TCT, TCA, TCG, TCC, AGT, and AGC all encode serine, and the codons TCG and TCA encoding serine on the E. coli genome are deleted and replaced with synonymous codons AGC and AGT, respectively, and the tRNAs corresponding to the TCG and TCA codons are deleted: serT and serU;

[0020] The most optimal host cell is Escherichia coli Syn61Δ3(ev5) which has undergone serine codon degeneration and corresponding tRNA deletion.

[0021] The codon-modified cloning vector refers to a vector in which the entire sequence is codon-optimized and the codons are degenerated, that is, the modification method is consistent with the codon degeneration of the host. For example, if the TCG codon in the host is degenerated and replaced with other synonymous codons, the TCG codon on the vector is also degenerated and replaced with other synonymous codons;

[0022] Preferably, it is not necessary to optimize the entire sequence of the vector, and only the codons of the relevant functional genes that affect the proliferation of the vector are optimized, and the functional genes include but are not limited to: resistance screening genes, genes for maintaining plasmid distribution, etc.;

[0023] Furthermore, the cloning vector includes commonly used vectors in the art, including but not limited to pUC57, pET28a, pClone, pENTR vectors, etc.

[0024] The codon-modified target gene refers to a target gene nucleotide sequence to be synthesized that contains at least one of the codons that are degenerate in the host; for example, the codons TCG and TCA encoding serine are degenerate in the host Escherichia coli Syn61Δ3 (ev5), then the target gene to be synthesized should contain at least one of TCG and TCA;

[0025] Furthermore, the target gene is a toxic gene, which refers to a gene that will be toxic to the host or affect cell growth after expression, such as a restriction endonuclease gene (restriction endonucleases will cut host DNA and cause toxicity), certain glycosyltransferase genes (glycosylation modifications are added to certain sites of the host protein, resulting in abnormal function), certain antibody genes (certain antibodies target and bind to host proteins, resulting in inhibition of the activity of the protein), etc.; further, such as BsaI restriction endonuclease, EcoRI restriction endonuclease, EcoRV restriction endonuclease, DnaseI nuclease, SSB single-stranded binding protein protein, HupA protein, etc.

[0026] The second technical solution provided by the present invention is the application of the gene cloning system described in the first technical solution, especially its application in cloning toxic genes, and more particularly its application in blocking gene leakage expression while cloning genes.

[0027] The third technical solution provided by the present invention is a method for cloning a target gene using the gene cloning system described in the first technical solution, and the method can be a commonly used gene cloning method in the art;

[0028] Furthermore, the method is as follows: the gene is connected to the vector according to common molecular cloning techniques such as T4 enzyme ligation and recombination methods, and then transformed into a modified host strain for propagation to obtain a vector carrying a toxic gene, namely a toxic gene clone.

[0029] Beneficial effects:

[0030] The present invention obtains a gene cloning system by modifying the host, vector and target gene. The use of this system can completely block the expression of toxic genes, change the problem that the toxic gene protein expression products seriously interfere with the growth state and mutation of host cells such as Escherichia coli, etc., so that the target gene can be successfully cloned in the resistant strain, ensuring the success rate and timeliness of gene synthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is a diagram of the relationship between the host, vector, and target gene before and after transformation.

[0032] Figure 2 This is the pUC57 plasmid map.

[0033] Figure 3 This is the pET28a plasmid map.

[0034] Figure 4 This is the transformation status of LB+Amp resistance plate.

[0035] Figure 5 This is the colony PCR identification picture.

[0036] Figure 6 The sequence alignment result. DETAILED DESCRIPTION

[0037] In order to make the purpose, technical solution and advantages of this patent more clear, this patent is further described in detail in combination with specific embodiments. It should be understood that the specific embodiments described here are only used to explain this patent and are not used to limit the present invention.

[0038] As we all know, there are 61 codons corresponding to the 20 amino acids and 3 termination signals, which will produce a "redundant" situation in which multiple codons correspond to the same amino acid, and the codons encoding the same amino acid are called synonymous codons.

[0039] Therefore, in theory, the codons of the E. coli host genome can be degenerated, "redundant" codons can be deleted, replaced with synonymous codons, and the tRNA corresponding to the "redundant" codons can be deleted. Since the degenerate codons are replaced with synonymous codons, the host protein expression will not be blocked.

[0040] As mentioned above, since the tRNA corresponding to the "redundant" codons in the strain is deleted, the vacated "redundant" codons cannot be recognized by the modified strain.

[0041] For the biosynthesis of toxic genes, ① other expression elements on the vector other than toxic genes, such as resistance genes and or sopA, are maintained to be expressed normally; ② the expression of toxic genes is completely blocked at the same time. Only by meeting these two requirements can a stable plasmid that can be replicated be obtained. Based on the above analysis conclusions, the codon-optimized vector can be combined with the toxic gene (including at least one degenerate codon) and transformed into the above-mentioned modified tRNA-deficient strain, which can achieve: the functional genes on the vector, such as resistance genes, sopA and other genes are expressed normally, ensuring the normal cloning and replication of the target gene (toxic gene) loaded thereon, and at the same time completely blocking the expression of the toxic gene. This is because: the genes on the vector can be codon-optimized, and the degenerate codons are replaced with synonymous codons, so they can be recognized and translated by the above-mentioned modified tRNA-deficient strain; while the toxic gene contains at least one degenerate codon, and the degenerate codon cannot be recognized by the above-mentioned modified tRNA-deficient strain, the translation of the toxic gene is interrupted, and the toxicity is lost. Finally, the normal synthesis of the toxic gene is achieved, but its translation process is blocked, so that it loses the ability to produce toxicity to cells.

[0042] According to the above principles, it is necessary to perform codon modification on the gene synthesis system including the host, vector and target gene. Among them, the host is codon degenerate, and the tRNA corresponding to the degenerate codon is deleted. The vector is subjected to the same codon degeneracy as the host, and at the same time, it is ensured that the target gene (toxic gene) sequence contains at least one degenerate codon. Even if the mRNA of the toxic gene is produced by leakage transcription, the translation process of the toxic gene mRNA will be interrupted due to the lack of corresponding tRNA in the host, thereby achieving the purpose of completely blocking the leakage expression of the toxic gene. In this application, these strains that have undergone codon degeneracy modification and tRNA deletion are also referred to as resistant strains. Because it does not contain tRNA for degenerate codons, the resistant strain can theoretically completely block the leakage expression of the toxic gene. The details are as follows:

[0043] (1) Taking E. coli as an example, the E. coli host genome is subjected to codon degeneration, "redundant" codons are deleted, replaced with synonymous codons, and the tRNA corresponding to the "redundant" codons is deleted. The codon degeneration refers to degenerating the 61 codons corresponding to 20 amino acids and at least one of the three termination signals on the host genome (after degeneration, at least one codon must be retained for each amino acid and terminator to ensure that the host genome can be expressed normally), deleting the degenerated codons, replacing them with synonymous codons, and deleting the tRNA corresponding to the degenerated codons.

[0044] For example, if the codons XXX and YYY (which can represent 3 identical nucleotides or 3 completely different nucleotides or 3 non-identical nucleotides) both encode AAA amino acids, one of the XXX or YYY codons in the genome can be deleted, and the codons that have not been deleted in XXX and YYY can be used as synonymous codons to replace the deleted codons to ensure the normal expression of the gene, and the tRNA corresponding to the degenerate codons can be deleted at the same time. If the degenerate codons correspond to multiple tRNAs, all the tRNAs corresponding to them need to be deleted. Specifically, for example, tRNA-serV only recognizes codons AGT and AGC (encoding serine), and AGT and AGC can only be recognized by tRNA-serV. And TCG, TCA, TCT, and TCC can all encode serine, so AGT and AGC codons can be deleted, and at least one of TCG, TCA, TCT, and TCC can be used for codon synonymous replacement, and tRNA-serV can be deleted, so that the host cannot read AGT and AGC codons.

[0045] After the above codon degeneration and tRNA deletion, it is necessary to ensure that the host genome can be expressed normally. If a codon is degenerate and its corresponding tRNA is deleted, resulting in the normal expression of the host genome being blocked, the degenerate codon and its corresponding tRNA need to be replaced. For example, if the degenerate codon is XXX, its corresponding tRNAX is responsible for transporting the amino acid BBB corresponding to the codon ZZZ in addition to transporting XXX, and the deletion of tRNAX will cause the transport of the amino acid BBB corresponding to the codon ZZZ to be blocked, thereby resulting in the normal expression of the host genome being blocked, and the degenerate codon XXX needs to be replaced. If an amino acid AAA is encoded by only two codons XXX and YYY, and XXX and YYY correspond to the same tRNA, then degenerating one of XXX and YYY and deleting its corresponding tRNA will result in the amino acid AAA not being expressed normally, thereby resulting in the host genome not being expressed normally. At this time, the codons of other amino acids need to be replaced for degeneration.

[0046] In short, the following conditions must be met after codon degeneration and corresponding tRNA deletion in the host: ① All tRNAs corresponding to the degenerated codons must be deleted; ② After codon degeneration and corresponding tRNA deletion, ensure that the host genome can continue to express normally.

[0047] Further, the following modifications can be performed according to the codon table, at least one of the codons being modified:

[0048] TTT and TTC both encode phenylalanine, so one of the TTT or TTC codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNA that recognizes TTT and TTC is not the same*, delete the tRNA corresponding to the degenerate codon (*due to the tRNA swing characteristics, sometimes different codons can be recognized by the same tRNA);

[0049] TTA, TTG, CTT, CTC, CTA, and CTG all encode leucine, so one or more of the TTA, TTG, CTT, CTC, CTA, and CTG codons in the genome can be deleted (at least one codon is retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport leucine is retained);

[0050] ATT, ATC, and ATA all encode isoleucine, so one or more of the ATT, ATC, and ATA codons in the genome can be deleted (at least one codon can be retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport isoleucine can be retained);

[0051] GTT, GTC, GTA, and GTG all encode valine, so one or more of the GTT, GTC, GTA, and GTG codons in the genome can be deleted (at least one codon can be retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport valine can be retained);

[0052] TCT, TCA, TCG, TCC, AGT, and AGC all encode serine, so one or more of the TCT, TCA, TCG, TCA, AGT, and AGC codons in the genome can be deleted (at least one codon is retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport serine is retained);

[0053] CCT, CCA, CCG, and CCC all encode proline, so one or more of the CCT, CCA, CCG, and CCC codons in the genome can be deleted (at least one codon is retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport proline is retained);

[0054] ACT, ACA, ACG, and ACC all encode threonine, so one or more of the ACT, ACA, ACG, and ACC codons in the genome can be deleted (at least one codon is retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport threonine is retained);

[0055] GCT, GCA, GCG, and GCC all encode alanine, so one or more of the GCT, GCA, GCG, and GCC codons in the genome can be deleted (at least one codon is retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport alanine is retained);

[0056] TAT and TAC both encode tyrosine, so one of the TAT and TAC codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize TAT and TAC are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport tyrosine is retained);

[0057] CAT and CAC both encode histidine, so one of the CAT and CAC codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize CAT and CAC are not the same, delete one of the corresponding tRNAs (retain at least one tRNA that can transport histidine);

[0058] CAA and CAG both encode glutamine, so one of the CAA and CAG codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize CAA and CAG are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport glutamine is retained);

[0059] AAT and AAC both encode asparagine, so one of the AAT and AAC codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize AAT and AAC are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport asparagine is retained);

[0060] AAA and AAG both encode lysine, so one of the AAA and AAG codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize AAA and AAG are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport lysine is retained);

[0061] GAT and GAC both encode aspartic acid, so one of the GAT and GAC codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize GAT and GAC are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport aspartic acid is retained);

[0062] GAA and GAG both encode glutamate, so one of the GAA and GAG codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize GAA and GAG are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport glutamate is retained);

[0063] Both TGT and TGC encode cysteine, so one of the TGT and TGC codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize TGT and TGC are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport cysteine ​​is retained);

[0064] CGT, CGA, CGG, CGC, AGA, and AGG all encode arginine, so one or more of the CGT, CGA, CGG, CGC, AGA, and AGG codons in the genome can be deleted (at least one codon can be retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport arginine can be retained);

[0065] AGT and AGC both encode cysteine, so one of the AGT and AGC codons in the genome can be deleted and replaced with a synonymous codon to ensure normal gene expression; if the tRNAs that recognize AGT and AGC are not the same, all tRNAs corresponding to the degenerate codons are deleted (at least one tRNA that can transport cysteine ​​is retained);

[0066] GGT, GGA, GGG, and GGC all encode glycine, so one or more of the GGT, GGA, GGG, and GGC codons in the genome can be deleted (at least one codon is retained) and replaced with synonymous codons to ensure normal gene expression; if the tRNAs that recognize the above codons are not the same, all tRNAs corresponding to the degenerate codons can be deleted (at least one tRNA that can transport glycine is retained);

[0067] Preferably, the codons encoding leucine, alanine, glycine, proline, arginine, serine, and threonine are selected for degeneracy, because the number of codons corresponding to these amino acids is ≥ 4, which can relatively slightly change the strain genome and relatively little affect the natural state of the host;

[0068] Preferably, codon degeneracy is selected for leucine, arginine, and serine, because the number of codons corresponding to these amino acids is ≥ 6, which will lessen the change of the strain genome and less affect the natural state of the host;

[0069] Optimally, serine is selected for codon degeneracy, because serine tRNA has been thoroughly studied, and serine is the active center of most functional proteins, which plays an important role in maintaining protein activity. More optimally, TCT, TCA, TCG, TCC, AGT, and AGC all encode serine. The codons TCG and TCA encoding serine on the Escherichia coli genome are deleted and replaced with synonymous codons AGC and AGT, respectively, and the tRNAs corresponding to the TCG and TCA codons: serT and serU are deleted. This strain is named Syn61Δ3, and the Syn61Δ3 strain is further subjected to several rounds of induced random mutation transformation to obtain its derivative strain Syn61Δ3 (ev5). This application further uses Syn61Δ3 (ev5) as a host to construct a toxic gene synthesis system (the detailed construction process of Syn61Δ3 (ev5) can be found in Chinese invention patent application CN202180101101.6, which can also be purchased from the Addgene official website: Bacterial strain #174514).

[0070] (2) Codon optimization is performed on the vector. Codon optimization is performed on the entire sequence of the vector. The optimization method should be consistent with the codon degeneracy of the host. For example, if the TCG codon in the host is degenerate and replaced with other synonymous codons, the TCG codon on the vector is also degenerate and replaced with other synonymous codons.

[0071] Preferably, in order to reduce the workload of vector modification, it is not necessary to optimize the entire sequence of the vector, and only the codons of the relevant functional genes that affect the propagation of the vector are optimized, including but not limited to: ① Resistance screening genes: such as Amp, Kana, Chl, etc.; ② Genes that maintain plasmid distribution: such as sopA, sopB, repE, etc.; ③ Special functional genes, such as LacI genes that reduce background expression, etc. Some genes that have no effect on the propagation of plasmids and strain growth do not need to be optimized, such as the LacZ gene, which is only a β-galactosidase used for blue-white screening, and has no effect on plasmid propagation and host growth, so codon optimization is not required; some other vectors, such as the shuttle vector: pCC1BAC plasmid, also have genes encoding tryptophan, but this gene only needs to be expressed in yeast to perform its function, so it is not necessary to codon optimize it when Escherichia coli is used as a host.

[0072] The above-mentioned codon-optimized vectors can replicate normally in the aforementioned codon-optimized hosts. At the same time, unmodified E. coli such as DH5α, TOP10, BL21 (DE3) contain complete codons and tRNA, so even codon-optimized vectors can still replicate normally in normal strains.

[0073] (3) The target gene (toxic gene) to be synthesized may or may not be codon optimized. However, regardless of whether codon optimization is performed or not, it is necessary to ensure that the nucleotide sequence of the target gene to be synthesized contains at least one of the codons that are degenerate in the host. Only in this way can the degenerate codons on the toxic gene not be recognized by the above-mentioned modified tRNA-deficient strain, and the translation of the toxic gene is interrupted, thereby losing its toxicity.

[0074] In the present invention, the vector is a vector that has undergone codon degeneracy modification. The modified vector can not only replicate normally in the strain with codon degeneracy modification, but also replicate normally in unmodified Escherichia coli such as DH5α, TOP10, BL21 (DE3) and other cells. The strain described in the present invention is a strain that has undergone codon degeneracy modification and tRNA deletion modification. The relationship between the modified vector and the unmodified vector, the modified strain and the unmodified strain, and the toxic gene Figure 1 shown.

[0075] Unless otherwise specified, the experimental materials used in the present invention are all commercially available.

[0076] Unless otherwise specified, the test methods used in the present invention are all conventional operating methods in the art.

[0077] In the toxic gene synthesis systems constructed in the following examples, the hosts used were all Escherichia coli Syn61Δ3 (ev5), purchased from Addgene.

[0078] The present invention will be further explained below through specific examples.

[0079] Example 1 Optimization of cloning vector pUC57

[0080] Cloning vector pUC57 codon modification: Delete TCG and TCA in the vector gene and replace them with AGC and AGT synonymous codons respectively:

[0081] Figure 2 Figure 1 is the plasmid map of pUC57. It can be observed that pUC57 contains two functional genes: the resistance screening marker AmpR gene and the lacZα gene for blue-white screening. The Syn61Δ3 (ev5) host cannot be used for blue-white screening, so only the essential gene AmpR needs to be codon optimized.

[0082] The AmpR gene in the original pUC57 plasmid (GenBank: Y14837.1) contains one TCG codon, which is replaced with AGC; two TCA codons, which are replaced with AGT. The amino acid sequence expressed before and after the codon replacement remains unchanged. In this embodiment, the complementary chain of Y14837.1 is used to replace and synthesize the pUC57 codons, and the sequence shown in the complementary chain is equivalent to the Y14837.1 sequence. The full-length pUC57 vector sequence after the codon replacement is shown in SEQ ID NO.1.

[0083] The whole sequence was sent to Qingke Biotechnology for whole gene synthesis and circularization to obtain the codon-optimized pUC57 vector.

[0084] Example 2 Optimization of cloning vector pET28a

[0085] Expression vector pET28a codon modification: Delete TCG and TCA in the vector gene and replace them with AGC and AGT synonymous codons respectively:

[0086] Figure 3 This is the plasmid map of pET28a. It can be observed that pET28a contains three genes: the resistance screening marker KanR gene, the lacI gene for expressing the repressor protein, and the rop gene for maintaining plasmid stability. These three genes have their functions, so they all need to be codon optimized.

[0087] The KanR gene of the original pET28a plasmid (SEQ ID NO.2) contained one TCG codon, which was replaced with AGC; seven TCA codons, which were replaced with AGT; the lacI gene contained five TCG codons, which were replaced with AGC; three TCA codons, which were replaced with AGT; the rop gene contained one TCG codon, which was replaced with AGC; the amino acid sequence expressed before and after the codon replacement remained unchanged. The full-length pET28a vector sequence after the codon replacement is shown in SEQ ID NO.3.

[0088] The entire sequence was sent to Qingke Biotechnology for full gene synthesis and circularization to produce the codon-optimized pET28a vector.

[0089] Example 3 Preparation of competent cells of the resistant strain Syn61Δ3 (ev5) (calcium chloride method)

[0090] ① Inoculate Syn61Δ3(ev5) one day in advance: pipette 100 μL of glycerol bacteria into 50 mL of LB medium and culture at 37°C in a shaking incubator overnight (about 20 hours);

[0091] ② Transfer 15 mL of overnight culture into 500 mL of LB medium and culture vigorously on a shaker at 37°C for about 5 hours (250-300 rpm);

[0092] ③ Pre-cool 0.1M CaCl2 solution on ice;

[0093] ④ When the OD of the bacterial solution reaches 0.4-0.5, take it out and place it on ice to cool for 10 minutes;

[0094] ⑤ Centrifuge at 3000 rpm for 5 minutes at 4°C;

[0095] ⑥Discard the supernatant, add 100 mL of pre-cooled 0.1 M CaCl2 solution, gently pipette up and down to mix well, resuspend the cells, and place on ice again for 20 minutes;

[0096] ⑦ Centrifuge at 3000 rpm for 5 minutes at 4°C;

[0097] ⑧Discard the supernatant, add 20mL of pre-cooled 0.1M CaCl2 + 20% glycerol solution, and gently pipette up and down to mix well to resuspend the cells;

[0098] ⑨ Store in ultra-low temperature (-70℃) for future use.

[0099] Example 4 Comparative Experiment (Synthesis of BsaI Gene)

[0100] Using DH5α competent cells and toxicity-resistant competent cells Syn61Δ3 (ev5) as hosts, the BsaI restriction endonuclease gene was synthesized de novo and constructed into the codon-optimized pUC57 cloning vector (shown in SEQ ID NO.1) in Example 1 above. The expected full plasmid sequence is shown in SEQ ID NO.4 (wherein the parts of the BsaI restriction endonuclease gene that may involve AGC and AGT are replaced with synonymous codons TCG and TCA):

[0101] (1) Target synthetic gene: Gene encoding BsaI restriction endonuclease. BsaI restriction endonuclease is a type IIS endonuclease with typical extremely strong toxicity to E. coli hosts. Even in some promoter-less cloning vectors, it can still cause cell death or random mutations in the BsaI gene due to toxicity. The mechanism is still unclear, but it may be related to the read-through of the resistance gene promoter or to the occasional random binding and transcription of RNA polymerase. At the same time, there is a Lac promoter upstream of the BsaI gene, which further enhances leaky expression, that is, increases toxicity, making the experimental results more comparative.

[0102] In the process of converting the amino acid sequence into a nucleotide sequence, some serine codons were optimized to tcg and tca, and the optimized BsaI gene sequence is shown in SEQ ID NO.5.

[0103] (2) Cloning vector: the codon-optimized pUC57 vector obtained in Example 1 (shown in SEQ ID NO. 1).

[0104] (3) Host cells: DH5α competent cells and anti-toxin competent cells Syn61Δ3(ev5).

[0105] The specific process is as follows:

[0106] ① Gene synthesis: synthesize the BsaI gene according to the sequence shown in SEQ ID NO.5.

[0107] ② Recombination: The BsaI gene was constructed into the optimized pUC57 by homologous recombination. The system was as follows, and the reaction was carried out at 50℃ for 30min:

[0108] Components Volume (μL) 2×SoSoo Mix 10 BsaI DNA product 7 Optimized linearized pUC57 vector 3 Total volume 20

[0109] ③Transformation: Take 5 μL of the recombinant product in step ② and transform it into chemical competent cells DH5α and anti-toxic competent cells Syn61Δ3 (ev5), respectively, apply LB+Amp resistance plates, and culture at 37°C overnight;

[0110] At the same time, other transformation systems with different hosts, vectors and target genes were constructed according to the above recombination and transformation methods. All transformants are shown in the following table:

[0111]

[0112] ④ The transformants on the plate are as follows Figure 4 As shown. Figure 4 It can be seen that only the plate No. 8 has transformants, and there are no transformants on other plates, indicating that the host, vector and target gene all need to be optimized and modified by the codon system described in the present invention to solve the toxicity of toxic gene clone expression to the host.

[0113] ⑤ Pick Figure 4 PCR identification was performed on 16 transformant colonies (transformants 1-8 and 9-16) with Syn61Δ3 (ev5) as the host on plate 8. The gene size was 1635 bp, plus the vector sequence at both ends was about 1200 bp, so the total length of the colony PCR product was about 2800 bp. The results are as follows Figure 5 shown.

[0114] The identification primers are as follows:

[0115] Check-F: CGGTCACAGCTTGTCTGTAAG

[0116] Check-R: CAGACCAAGTTTACTCATATATACTTTAGATTG

[0117] A, the reaction system is as follows:

[0118] Components Volume (μL) 2× T5 Master Mix 25 Check-F 2 Check-F 2 <![CDATA[ddH2O]]> 21 Total volume 50

[0119] B, PCR procedure is as follows:

[0120]

[0121] C, bacterial test gel picture Figure 5 As shown, among the 16 transformants, 13 transformants except 5, 7, and 14 amplified the target band, and the positive transformation rate was 81.25%, which was much higher than the transformation rate of toxic gene cloning in the prior art.

[0122] ⑥ The positive transformants of colony PCR were sent for next generation sequencing, and the comparison results were as follows Figure 6 As shown, the result of synthesized BsaI gene sequence is completely in line with expectations. There are no mutations in the promoter region and the entire gene sequence, indicating that the BsaI gene synthesis system constructed in this example (including Syn61Δ3 (ev5) host, optimized cloning vector pUC57, and optimized target gene) can synthesize the BsaI gene, and the host will not be poisoned by the BsaI expression product.

[0123] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the patent. It should be pointed out that, for ordinary technicians in this field, the above-mentioned implementation methods can also be modified, combined and improved without departing from the concept of this patent, which all belong to the protection scope of this patent. Therefore, the protection scope of this patent shall be based on the claims.

Claims

1. A gene cloning system, characterized in that: The system comprises: a host with a modified codon system, a cloning vector with a modified codon system, and a target gene with a modified codon system; The host with modified codon system is to perform codon degeneration on the host genome, wherein the codon degeneration refers to deleting at least one of multiple codons encoding the same amino acid, retaining at least one codon, ensuring the normal expression of the host genome, replacing the deleted codon with a synonymous codon, and deleting the tRNA corresponding to the deleted codon; The codon-modified cloning vector refers to a vector in which the entire sequence is codon-optimized and the codons are degenerate, that is, the modification method is consistent with the codon degeneracy of the host; The codon-modified target gene refers to a target gene nucleotide sequence to be synthesized that contains at least one of the codons that are degenerate in the host.

2. A gene cloning system as claimed in claim 1, characterized in that: In the host, when the deleted codon corresponds to multiple tRNAs, all the corresponding tRNAs need to be deleted.

3. A gene cloning system as claimed in claim 1, characterized in that: The host, after codon degeneration and corresponding tRNA deletion, ensures that the host genome can continue to express normally. If codon degeneration and corresponding tRNA deletion affect the normal expression of the host genome, other codons need to be selected for degeneration and corresponding tRNA deletion.

4. A gene cloning system as claimed in claim 1, characterized in that: The host after codon system modification is to delete the codons TCG and TCA encoding serine on the Escherichia coli genome, replace them with synonymous codons AGC and AGT respectively, and delete the tRNAs corresponding to the TCG and TCA codons: serT and serU.

5. A gene cloning system as claimed in claim 4, characterized in that: Escherichia coli Syn61Δ3 (ev5) obtained by degenerating serine codons and deleting corresponding tRNA was used as a host cell.

6. A gene cloning system as claimed in claim 1, characterized in that: When the cloning vector is modified with codons, it is not necessary to optimize the entire sequence of the vector, and only the functional genes that affect the expansion of the vector are optimized with codons, and the functional genes include but are not limited to: resistance screening genes and genes for maintaining plasmid distribution; The target gene is a toxic gene, which refers to a gene that is toxic to the host or affects cell growth after expression, including but not limited to restriction endonuclease genes, glycosyltransferase genes, and antibody genes.

7. A gene cloning system as claimed in claim 6, characterized in that: The toxic genes include, but are not limited to, genes encoding BsaI restriction endonuclease, EcoRI restriction endonuclease, EcoRV restriction endonuclease, DnaseI nuclease, SSB single-stranded binding protein or HupA protein.

8. A gene cloning system as claimed in claim 1, characterized in that: The host with modified codon system is Escherichia coli Syn61Δ3 (ev5), the cloning vector with modified codon is pUC57 shown in SEQ ID NO.1, and the target gene with modified codon is the BsaI restriction endonuclease encoding gene shown in SEQ ID NO.

5.

9. Use of the gene cloning system according to any one of claims 1 to 8 in gene cloning.

10. The use according to claim 9, characterized in that It is used in cloning toxic genes; or in blocking gene leakage expression while cloning gene claims.

Images