Application of pelteobagrus fulvidraco lncRNA in regulation and control of miR-21-y and / or gene DAPK2

Abstract

The invention discloses an application of pelteobagrus fulvidraco lncRNA (long non-coding RNA) in regulation and control of miR-21-y and / or a gene DAPK2, the pelteobagrus fulvidraco lncRNA is lnc432, and the Gene ID (Identity) of the pelteobagrus fulvidraco lncRNA is 125146191. The lnc432 disclosed by the invention can be used as ceRNA to be combined with miR-21-y in a targeted manner so as to regulate and control the expression of DAPK2. Under the low-oxygen condition, when the expression quantity of lnc432 is increased, bacterial infection of pelteobagrus fulvidraco can be remarkably inhibited, the immunity of fish is improved by regulating and controlling the mitochondrial apoptosis pathway and inflammatory response, and finally the antibacterial effect under the low-oxygen condition is affected.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to an application of yellow catfish lncRNA in regulating miR-21-y and / or gene DAPK2. Background Art

[0002] Long non-coding RNA (lncRNA) is a class of non-coding RNAs with a length of more than 200 nucleotides. It is widely present in organisms and plays an important role in regulating gene expression, chromatin remodeling, transcriptional regulation, and RNA processing. Recent studies have found that lncRNA plays a key role in the immune and stress responses of fish. Endogenous non-coding small RNA (microRNA, miRNA) is an RNA molecule of approximately 21 to 23 nucleotides in length. It participates in the regulation of various life processes in organisms, such as cell proliferation, differentiation, metabolism, and immunity, and plays a particularly important role in the fight against pathogen infection.

[0003] Competing endogenous RNA (ceRNA) is a crucial regulatory mechanism linking non-coding RNA (ncRNA) and mRNA. LncRNAs act as ceRNAs, acting as "sponges" to absorb microRNAs (miRNAs), thereby attenuating the inhibitory effects of miRNAs on mRNA expression. CeRNAs play a crucial role in development, metabolism, and immune regulation, providing important targets for the diagnosis and treatment of malignant diseases. In fish, ceRNAs have become a hot topic in immune research.

[0004] Pelteobagrus fulvidraco, an important freshwater fish species in my country, has seen its aquaculture scale expand continuously in recent years. Under high-density intensive aquaculture, frequent bacterial diseases have severely hampered the healthy development of the yellow catfish aquaculture industry. Furthermore, global warming, coupled with reduced dissolved oxygen in the water, has made the fish susceptible to hypoxic stress. Hypoxia and disease exacerbate each other, leading to mass fish mortality. However, the molecular mechanisms underlying fish responses to bacterial infection under hypoxic conditions remain largely unknown, hindering the development of effective prevention and control measures. Therefore, studying the ceRNA regulatory mechanisms underlying yellow catfish responses to bacterial infection under hypoxia will help improve our understanding of fish immune regulation and provide new insights into the development of green biopharmaceuticals for antimicrobial effects in fish under hypoxic conditions. Summary of the Invention

[0005] Purpose of the invention: The purpose of the present invention is to provide a yellow catfish lncRNA and its application.

[0006] Technical solution: The present invention provides an application of a yellow catfish lncRNA in regulating miR-21-y and / or gene DAPK2, wherein the yellow catfish lncRNA is lnc432, and its Gene ID is 125146191.

[0007] Furthermore, the nucleotide sequences of the primers used to detect the lncRNA are shown in SEQ ID NOs. 2 to 3.

[0008] Furthermore, the nucleotide sequences of the primers used to detect the miR-21-y are shown in SEQ ID NOs. 4 to 5.

[0009] Furthermore, the nucleotide sequences of the primers used to detect the DAPK2 are shown in SEQ ID NOs. 6 to 7.

[0010] The present invention also provides the use of yellow catfish lncRNA in regulating the infection of yellow catfish by Aeromonas vernix under hypoxic conditions. The yellow catfish lncRNA is lnc432, and its Gene ID is 125146191.

[0011] Furthermore, the yellow catfish lncRNA is used to regulate any of the following:

[0012] (1) Regulate the expression of miR-21-y;

[0013] (2) regulating the expression of the gene DAPK2;

[0014] (3) Regulate the number of Aeromonas vickers under hypoxia.

[0015] The present invention also provides a drug for preventing and / or treating infections caused by Aeromonas veronii under hypoxic conditions, wherein the active ingredient in the drug is a substance that increases the expression of lnc432 and / or DAPK2 or inhibits the expression of miR-21-y.

[0016] Furthermore, the drug is used to regulate the expression of pro-apoptosis regulatory factors and inflammatory response-related genes.

[0017] Furthermore, the pro-apoptotic regulatory factors include BAX, BCL2L1, APAF1, DDIT3, PDPK1, and CASP8.

[0018] Furthermore, the inflammatory response-related genes include NLRP9, RELA, NFKB2, and IL-1β.

[0019] Beneficial Effects: Compared with existing technologies, the present invention has the following significant advantages: lnc432 disclosed in the present invention can act as a ceRNA to target and bind to miR-21-y, thereby regulating the expression of DAPK2. Under hypoxic conditions, when lnc432 expression is elevated, it can significantly inhibit bacterial infection in yellow catfish. By regulating the mitochondrial apoptosis pathway and inflammatory response, it improves the fish's immunity, ultimately affecting its antibacterial effect under hypoxic conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the ceRNA regulatory network composed of lnc432-miR-21-y-DAPK2 in the embodiment of the present invention.

[0021] Figure 2 : The expression patterns of lnc432, miR-21-y and target gene DAPK2 in the liver tissue of yellow catfish without infection (Ct), hypoxia stress and Aeromonas vermiformis infection (HB double stimulation) for 6 hours in the examples of the present invention.

[0022] Figure 3 In the embodiment of the present invention, primary yellow catfish hepatocytes were transfected with si-lnc432 and subjected to HB double treatment, and the expression levels of lnc432, miR-21-y and DAPK2 in the hepatocytes and the bacterial load in the hepatocytes under hypoxia were changed.

[0023] Figure 4 This is a graph showing the results of a dual luciferase assay 24 hours after co-transfection of the miR-21-y and lnc432 recombinant vectors in an embodiment of the present invention.

[0024] Figure 5 The figures show the changes in the expression of miR-21-y and its target gene DAPK2 in primary hepatocytes and the changes in the bacterial load of hepatocytes under hypoxia after transfection of miR-21-y (mimic) in primary hepatocytes of yellow catfish and dual stimulation with HB in the examples of the present invention.

[0025] Figure 6 In the embodiment of the present invention, the expression levels of miR-21-y and its target gene DAPK2 in primary hepatocytes and the bacterial load of hepatocytes under hypoxia were changed after transfection of miR-21-y inhibitor in primary hepatocytes of yellow catfish and double stimulation with HB.

[0026] Figure 7 This is a graph showing the results of a dual luciferase experiment 24 hours after co-transfection of the miR-21-y, DAPK2 recombinant vector and the lnc432 overexpression recombinant vector in an embodiment of the present invention.

[0027] Figure 8In the embodiment of the present invention, primary yellow catfish hepatocytes were transfected with si-DAPK2 and then double-treated with HB, and the expression levels of DAPK2 in the hepatocytes, the bacterial load in the hepatocytes under hypoxia, and the expression levels of genes related to the apoptosis pathway and inflammatory response were changed. DETAILED DESCRIPTION

[0028] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0029] Example 1 lncRNA discovery process

[0030] Healthy yellow catfish (Petrospora fulvidraco) were randomly divided into two groups. Hypoxic stress was established by aerating the water with nitrogen to maintain the dissolved oxygen concentration at 2.0 ± 0.1 mg / L. The fish were then infected intraperitoneally with 60 μL of an Aeromonas vermiformis suspension (HB double-stimulation group). The control group was maintained under normoxic conditions and injected with an equal volume of sterile PBS buffer. Three biological replicates were set up in each group. Six hours after infection, the fish were anesthetized with MS-222 and aseptically dissected, and liver tissue samples were collected. Sequencing libraries were constructed and high-throughput sequencing was performed using the Illumina HiSeq 2500 sequencing platform. Sequencing sequences were aligned to the yellow catfish genome using TopHat 2 software. Subsequently, transcripts longer than 200 bp were analyzed for protein-coding potential using CNCI, CPC, and Feelnc software, and verified against the UniProtKB / SwissProt database. Transcripts without coding potential were identified as lncRNAs. By constructing the ceRNA network, the results are as follows Figure 1 As shown. It was preliminarily determined that lnc432 can act as a ceRNA by targeting and binding miR-21-y, thereby regulating the expression of the gene DAPK2. The sequence of miR-21-y is shown in SEQ ID NO. 1 (5'-CGACAACAGTCTGTAGGCTGAC-3'), and the Gene ID of DAPK2 is 113660178.

[0031] Example 2 Preliminary Verification of lnc432 Targeting and Regulating Gene DAPK2 via miR-21-y

[0032] First, RT-qPCR was used to detect the changes in the expression levels of lnc432, miR-21-y, and DAPK2 in the liver of yellow catfish in the HB dual stimulation group and the control group. The primer sequences used were: lnc432: SEQ ID NO.2 (5'-GGCAGTTCTCGTAGTTCAAGC-3'), SEQ ID NO.3 (5'-AAACTGTCTGAAAGGCTG GGT-3'); miR-21-y: SEQ ID NO.4 (5'-GCGACAACAGUCUGUAGGCUGAC-3'), SEQ ID NO.5 (5'-GTATCAACGCAGAGTACT-3'); DAPK2: SEQ ID NO.6 (5'-CTCT AGACAAGTTCTGGTGCG-3'), SEQ ID NO.7 (5'-ACAATCCTGAAGGAGAACTTCC-3'). The RT-qPCR reaction system was:

[0033]

[0034] The above system was placed in the ABI Step One Plus system RT-qPCR instrument and the reaction was carried out according to the 2-step standard procedure. -△△Ct The relative expression level was calculated by Figure 2 As shown in the results, preliminary analysis showed that compared with the control group, lnc432 and DAPK2 were significantly downregulated, and miR-21-y was significantly upregulated in the liver tissue of yellow catfish subjected to hypoxia stress and Aeromonas vermiformis infection (HB dual stimulation) for 6 hours. This preliminarily demonstrated that lnc432 may affect DAPK2 expression by regulating miR-21-y.

[0035] Example 3 Further verification of lnc432 targeting and regulating gene DAPK2 through miR-21-y

[0036] 1. Construction of lnc432 overexpression plasmid

[0037] In this example, pcDNA3.1(+) vector (Thermo Fisher, V79020) was used to construct the overexpression vector.

[0038] The lnc432 sequence used to construct the overexpression vector contains the site TGTTGTC that binds to miR-21-y.

[0039] In this example, the lnc432 target sequence was successfully cloned and inserted into the pcDNA3.1(+) overexpression vector by homologous recombination to successfully construct the lnc432 overexpression recombinant vector.

[0040] PCR was used to amplify the target sequence of lnc432. During the PCR reaction, we introduced restriction enzyme sites for BamHI and XhoI, and designed forward and reverse primers represented by SEQ ID NO. 8 (pcDNA-lnc432-F: 5'-GCGTTTAAACTTAAG CTTGGTACCGAGCTCGGATCCGAATTGGTATATATGAATCTGGGGTTCAAGTT-3') and SEQ ID NO. 9 (pcDNA-lnc432-R: 5'-TGATCAGCGGGTTTAAACGGGCCCTCTAGAC TCGAGAGCTCGTTTGTGTGTTTAAACATTTAACCATTCATCTC-3'), respectively. The specific PCR amplification reaction system and procedures were performed according to the instructions of the TaKaRa primer STAR max kit. The pcDNA3.1(+) vector was double-digested with BamHI and XhoI endonucleases using the following enzyme digestion system:

[0041]

[0042] The reaction procedure was as follows: after double enzyme digestion at 37°C for 15 min, the reaction was stopped.

[0043] The lnc432 amplified product and the double-enzyme digested pcDNA3.1(+) vector were homologously recombined using the Vazyme homologous recombination kit.

[0044] The reaction system was as follows: 2 μL of lnc432 amplified product, 6 μL of double-enzyme digested pcDNA3.1(+) vector, 4 μL of 5×CEⅡBuffer, 2 μL of Exnase II, and 6 μL of sterile water.

[0045] The reaction procedure was: 37°C metal bath for 30 min.

[0046] Transform the ligation product into competent cells.

[0047] 2. Construction of recombinant vectors expressing the dual-luciferase reporter gene of yellow catfish lnc432 and yellow catfish DAPK2

[0048] In this example, the pmirGLO vector (Promega, E1330) was used to construct a dual-luciferase reporter gene vector.

[0049] The lnc432 sequence used to construct the dual-luciferase reporter gene vector contains the miR-21-y binding site TGTTGTC. The 3'UTR region of the DAPK2 gene used to construct the dual-luciferase reporter gene vector contains the miR-21-y binding site TGTTGTC.

[0050] In this example, the target sequences of lnc432 and DAPK2 were successfully cloned and inserted into the pmirGLO dual-luciferase reporter gene vector via homologous recombination, successfully constructing the lnc432 dual-luciferase reporter gene recombinant expression vector and the DAPK2 dual-luciferase reporter gene recombinant expression vector. PCR was used to amplify the 3'UTR region of the DAPK2 gene and the lnc432 miR-21-y target sequence. In the PCR reaction, we introduced NheI and SalI restriction sites and designed primers pmirGLO-lnc432-F (SEQ ID NO.10: 5'-CCGTGTAATTCTAGTTGTTTAAACGAGCTCGCTAGCGAATTGGTATATATGAATCT GGGGTTCAAGTTAATCTC-3') and pmirGLO-lnc432-R (SEQ ID NO.11: 5'-TAGCAGCCGGATCAGCTTGCATGCCTGCAGGTCGACAGCTCGTTTGT-3') for amplifying lnc432, and primers pmirGLO-DAPK2-F (SEQ ID NO.12: 5'-CCGTGTAATTCTAGTTGTTTAAACGAGCTCGCTAGCATATATTTTCCTGATACAAT TTCCGTATTTTCTTATGCC-3') and pmirGLO-DAPK2-R (SEQ ID NO.13: 5'-CCGTGTAATTCTAGTTGTTTAAACGAGCTCGCTAGCATATATTTTCCTGATACAAT TTCCGTATTTTCTTATGCC-3') for amplifying DAPK2 gene. The specific PCR amplification reaction system and procedures were performed according to the instructions of the TaKaRaprimer STAR max kit. The pmirGLO vector was double-digested with NheI and SalI endonucleases. The digestion system is as follows:

[0051]

[0052] The reaction procedure was as follows: after double enzyme digestion at 37°C for 15 min, the reaction was stopped.

[0053] The DAPK2 gene 3'UTR region, lnc432 amplified product and double-enzyme digested pmirGLO vector were homologously recombined using the Vazyme homologous recombination kit.

[0054] The reaction system was as follows: 2 μL of DAPK2 gene 3'UTR region amplification product / 2 μL of lnc432 amplification product, 6 μL of pmirGLO vector after double enzyme digestion, 4 μL of 5×CEⅡBuffer, 2 μL of Exnase II, and 6 μL of sterile water.

[0055] The reaction procedure was: 37°C metal bath for 30 min.

[0056] Transform the ligation product into competent cells.

[0057] 3. Synthesis of lnc432 and DAPK2 interferors

[0058] In this embodiment, an interferor that can reduce the expression of lnc432 and an interferor that can reduce the expression of DAPK2 are provided.

[0059] The lnc432 interferor si-lnc432 was synthesized by GENEray (Shanghai) using the following primers: lnc432 interferor F (SEQ ID NO. 14: 5′-AAGUGCCUGAUUAGCUCCUAAUUAU-3′) and lnc432 interferor R (SEQ ID NO. 15: 5′-AUAAUUAGGAGCUAAUCAGGCACUU-3′).

[0060] DAPK2 interferor si-DAPK2 was synthesized by GENEray (Shanghai) using the following primers: DAPK2 interferor F (SEQ ID NO. 16: 5'-CAGUUUGCUAUAGUGAAGAUGUA-3') and DAPK2 interferor R (SEQ ID NO. 17: 5'-UACAUCUCUUCACUAUAGCAAACUG-3').

[0061] 4. Further verification of lnc432 targeting and regulating the gene DAPK2 through miR-21-y

[0062] 4.1 lnc432 interferor can significantly increase the expression of miR-21-y, reduce the expression of DAPK2, and regulate the response of yellow catfish to bacterial infection under hypoxia

[0063] Culture of primary hepatocytes of Pelteobagrus fulvidraco: in accordance with patent ZL202210856289.1.

[0064] After the cells grew to about 80% in the six-well plate, transfection was performed according to the instructions of lip3000 transfection (Novagen).

[0065] In this example, three transfection groups were set up: (1) no transfection, as a blank control; (2) transfection with si-NC (synthesized by GENEray (Shanghai) Co., Ltd.), as a negative control; and (3) transfection with an interferor of lnc432 (si-lnc432), as an experimental group.

[0066] 48 hours after transfection, cells were infected with Aeromonas vermiformis at an MOI (multiplicity of infection) of 3 and placed in an anaerobic incubator under hypoxic conditions (0.5%) for 30 minutes. Total cellular RNA was extracted using the Trizol method and reverse transcribed into cDNA according to the instructions for the Yisheng cDNA reverse transcriptase reagent. RT-qPCR was then used to measure the expression of lnc432, miR-21-y, and DAPK2 genes in hepatocytes. Cells were harvested, plated, and bacterial counts were performed.

[0067] The results are as follows Figure 3 As shown, the lnc432 interferor si-lnc432 significantly inhibited the expression of lnc432 in primary hepatocytes of yellow catfish, promoted the expression of miR-21-y, and inhibited the expression of DAPK2. In addition, the lnc432 interferor significantly increased the number of bacteria in primary hepatocytes of yellow catfish under hypoxic conditions.

[0068] 4.2 Dual luciferase reporter gene assay to determine the binding relationship between lnc432 and miR-21-y

[0069] The ligation product was transferred into competent HEK-293T cells. These cells were cultured in DMEM medium containing 10% FBS and 1% double-antibody in a 37°C, 5% CO2 cell culture incubator. After the cells reached 70%-80% adherence in 24-well plates, transfection was performed according to the instructions for the Lip3000 transfection reagent (Novagen). After transfection, the plates were plated for single colony selection, and the accuracy of the ligation was verified using bacterial PCR combined with Sanger sequencing.

[0070] In this example, three transfection groups were set up: (1) transfection of lnc432 dual luciferase reporter gene recombinant expression vector (pmirGLO-lnc432) as a negative control; (2) co-transfection of lnc432 dual luciferase reporter gene recombinant expression vector and miR-NC (NC mimic) as a negative control; (3) co-transfection of lnc432 dual luciferase reporter gene recombinant expression vector and miR-21-y mimic (miR-21-y mimic, the mimic is the same as patent CN116836983A, synthesized by GenePharma (sense chain: 5'-CGACAACAGUCUGUAGGCUGAC-3', antisense chain: 5'-CAGCCUACAGACUGUUGUCGUU-3')) as the experimental group. Luciferase activity was measured after 24 hours. The results are shown in Figure 2. Figure 4 As shown, in HEK-293T cells co-transfected with miR-21-y mimic and pmirGLO-lnc432, luciferase activity was significantly inhibited, indicating that miR-21-y and lnc432 have a binding relationship.

[0071] 4.3 Overexpression of miR-21-y significantly inhibited the expression of DAPK2, thereby affecting the antibacterial ability of yellow catfish under hypoxic conditions

[0072] The primary hepatocytes of Pelteobagrus fulvidraco were cultured in the same manner as in step 4.1. When the primary hepatocytes of Pelteobagrus fulvidraco grew to about 80% in the six-well plate, transfection was performed according to the instructions of lip3000 transfection (Novagen).

[0073] In this example, three transfection groups were set up: (1) no transfection, serving as a blank control (Ct); (2) transfection with miR-NC, serving as a negative control; and (3) transfection with miR-21-y mimics (mimic), serving as an experimental group.

[0074] 24 hours after transfection, cells were infected with Aeromonas vermiformis at an MOI of 3 and placed in an anaerobic incubator under hypoxic conditions (0.5%) for 30 minutes. Total cellular RNA was extracted using the Trizol method and reverse transcribed into cDNA according to the instructions of the Yisheng cDNA reverse transcriptase reagent. The expression levels of miR-21-y and DAPK2 were then determined by RT-qPCR. Cells were harvested, plated, and bacterial counts were performed.

[0075] The results are as follows Figure 5 As shown in the results, during HB stimulation, miR-21-y mimic significantly promoted the expression of miR-21-y, which in turn significantly reduced the expression of DAPK2. At the same time, miR-21-y mimic significantly increased the number of bacteria in primary catfish hepatocytes under hypoxic conditions.

[0076] 4.4 miR-21-y inhibitors can significantly increase the expression of lnc432 and DAPK2 and inhibit bacterial infection under hypoxic conditions

[0077] The primary hepatocytes of Pelteobagrus fulvidraco were cultured in the same manner as in step 4.1. The primary hepatocytes of Pelteobagrus fulvidraco were grown in a six-well plate until about 80% of the cells were transfected according to the instructions of lip3000 transfection (Novagen).

[0078] In this example, three transfection groups were set up: (1) no transfection, serving as a blank control (Ct); (2) transfection with miR-NC, serving as a negative control (miR-NC); and (3) transfection with a miR-21-y inhibitor (the inhibitor is the same as that in patent CN116836983A, synthesized by GenePharma, 5'-GUCAGCCUACAGACUGUUGUCG-3') as an experimental group.

[0079] 24 hours after transfection, cells were infected with Aeromonas vermiformis at an MOI of 3 and placed in an anaerobic incubator under hypoxic conditions (0.5%) for 30 minutes. Total cellular RNA was extracted using the Trizol method and reverse transcribed into cDNA according to the instructions of the Yisheng cDNA reverse transcriptase reagent. The expression levels of miR-21-y and DAPK2 were then determined by RT-qPCR. Cells were harvested, plated, and bacterial counts were performed.

[0080] The results are as follows Figure 6 As shown in the results, during HB stimulation, the miR-21-y inhibitor significantly suppressed the expression of miR-21-y, thereby significantly increasing the expression of DAPK2. At the same time, the miR-21-y inhibitor significantly suppressed the number of bacteria in primary hepatocytes of yellow catfish under hypoxic conditions.

[0081] 4.5 Dual luciferase reporter gene assay to confirm that lnc432 acts as a ceRNA and competes with DAPK2 for binding to miR-21-y

[0082] The cells used for transfection were HEK-293T cells, which were cultured in a cell culture incubator at 37°C and 5% CO2 using DMEM medium containing 10% FBS and 1% double-antibody. After being cultured in a 24-well plate until the number of cells attached to the wall reached 70%-80%, transfection was performed according to the instructions of the lip3000 transfection reagent (NoviZan).

[0083] In this example, five transfection groups were set up: (1) transfection of the DAPK2 gene dual-luciferase reporter gene recombinant vector (pmirGLO-DAPK2) as a blank control group; (2) co-transfection of the DAPK2 gene dual-luciferase reporter gene recombinant vector and pcDNA3.1(+) vector as a negative control group; (3) co-transfection of the DAPK2 gene dual-luciferase reporter gene recombinant vector and miR-NC as a negative control group; (4) co-transfection of the DAPK2 gene dual-luciferase reporter gene recombinant vector and miR-21-y as a positive control group; (5) co-transfection of the DAPK2 gene dual-luciferase reporter gene recombinant vector, miR-21-y and lnc432 overexpression recombinant vector (pcDNA-lnc432) as an experimental group. After transfection into HEK-293T cells, they were continued to be cultured in a cell culture incubator. The cell culture medium was replaced 6 hours after transfection, and the luciferase activity was measured 24 hours later.

[0084] Cells were lysed and centrifuged using the Vazyme Dual-Luciferase Reporter Gene Assay Kit according to the manufacturer's instructions, and luciferase activity was measured in the supernatant. The fluorescence values ​​of firefly luciferase and Renilla luciferase were recorded sequentially, and the ratio of the two values ​​was calculated and normalized. The mean of the three groups was calculated, and statistical analysis was performed using Graphpad Prism (9.5) software.

[0085] The results are as follows Figure 7 As shown, compared with co-transfection of miR-21-y and pmirGLO-DAPK2, the luciferase activity of cells co-transfected with miR-21-y, pmirGLO-DAPK2 and pcDNA-lnc432 was significantly increased, indicating that lnc432 and DAPK2 competed for binding to miR-21-y, that is, lnc432 alleviated the inhibition of miR-21-y on DAPK2.

[0086] 4.6 DAPK2 interferors can significantly reduce the expression of DAPK2 and affect the antibacterial ability of yellow catfish under hypoxic conditions. DAPK2 interferors significantly reduce the expression of DAPK2 after HB dual stimulation, thereby regulating the expression of genes related to the mitochondrial apoptosis pathway and inflammatory pathway

[0087] The primary hepatocytes of Pelteobagrus fulvidraco were cultured in the same manner as in step 4.1. When the primary hepatocytes of Pelteobagrus fulvidraco grew to about 80% in the six-well plate, transfection was performed according to the instructions of lip3000 transfection (Novagen).

[0088] In this example, three transfection groups were set up: (1) no transfection, serving as a blank control; (2) transfection with si-NC, serving as a negative control; and (3) transfection with a DAPK2 interferor (si-DAPK2), serving as an experimental group.

[0089] Cells were collected 48 hours after transfection, and total cellular RNA was extracted using the trizol method. The extracted RNA was reverse transcribed into cDNA according to the instructions of Yisheng cDNA reverse reaction reagent and miRNA First-Strand Synthesis (Takara), and then RT-qPCR was used to detect the expression level of DAPK2 gene in hepatocytes.

[0090] 48 hours after transfection, cells were infected with Aeromonas vermiformis at an MOI of 3 and placed in an anaerobic incubator under hypoxic conditions (0.5%) for 30 minutes. Total cellular RNA was extracted using the trizol method and reverse transcribed into cDNA according to the instructions of the Yisheng cDNA reverse transcriptase reagent. RT-qPCR was then used to detect the expression levels of DAPK2, BAX, BCL2L1, APAF1, DDIT3, PDPK1, CASP8, NLRP9, RELA, NFKB2, and IL-1β. Cells were harvested, plated, and bacteria counted.

[0091] The results are as follows Figure 8 As shown in the results, during HB stimulation, the DAPK2 interferor si-DAPK2 significantly reduced the expression of DAPK2, while significantly promoting the expression of pro-apoptotic regulatory factors (BAX, BCL2L1, APAF1, DDIT3, PDPK1, CASP8) and inflammatory response-related genes (NLRP9, RELA, NFKB2, IL-1β). In addition, the DAPK2 interferor si-DAPK2 significantly increased the number of bacteria in primary hepatocytes of yellow catfish under hypoxic conditions.

Claims

1. An application of yellow catfish lncRNA in regulating miR-21-y and / or gene DAPK2, characterized in that: The yellow catfish lncRNA is lnc432, and its Gene ID is 125146191.

2. The use according to claim 1, characterized in that: The nucleotide sequences of the primers used to detect the lncRNA are shown in SEQ ID NOs. 2 to 3.

3. The use according to claim 1, characterized in that: The nucleotide sequences of the primers used to detect the miR-21-y are shown in SEQ ID NOs. 4 to 5.

4. The use according to claim 1, characterized in that: The nucleotide sequences of the primers used to detect the DAPK2 are shown in SEQ ID NOs. 6-7.

5. Use of a substance for increasing or inhibiting the expression of lncRNA in yellow catfish in regulating Aeromonas veronii infection of yellow catfish under hypoxic conditions, characterized in that: The yellow catfish lncRNA is lnc432, and its Gene ID is 125146191.

6. The use according to claim 5, characterized in that: The yellow catfish lncRNA is used to regulate any of the following: (1) Regulate the expression of miR-21-y; (2) regulating the expression of the gene DAPK2; (3) Regulate the number of Aeromonas vermifuge under hypoxia.

7. A drug for preventing and / or treating infections caused by Aeromonas veronii under hypoxic conditions, characterized in that: The active ingredient in the drug is a substance that increases the expression of lnc432 and / or DAPK2 or inhibits the expression of miR-21-y.

8. The drug according to claim 7, characterized in that The drug is used to regulate the expression of pro-apoptosis regulatory factors and inflammatory response related genes.

9. The drug according to claim 8, characterized in that The pro-apoptotic regulatory factors include BAX, BCL2L1, APAF1, DDIT3, PDPK1, and CASP8.

10. The drug according to claim 8, characterized in that The inflammatory response-related genes include NLRP9, RELA, NFKB2, and IL-1β.

Images