Preparation method of human type 4 adenovirus genome DNA (deoxyribonucleic acid) standard substance

Abstract

The invention discloses a preparation method of a human type 4 adenovirus genome DNA standard substance, relates to the technical field of gene detection, and comprises a virus strain of a human type 4 adenovirus and a HeLa229 human cervical cancer cell as host cells. According to the preparation method of the human type 4 adenovirus genome DNA standard substance, a detection reagent of the human type 4 adenovirus genome DNA standard substance which is standardized, normalized and stable in performance is standardized, and the preparation method can play an important role in monitoring, diagnosing and evaluating virus infection in a laboratory; compared with the prior art, detection results of different laboratories can be ensured to have comparability and consistency, so that the accuracy and reliability of diagnostic testing are improved, meanwhile, the detection process is stable, uniform and pollution-free, and result deviation caused by operation difference can be effectively reduced.

Description

Technical Field

[0001] The present invention relates to the field of gene detection technology, and more specifically to a method for preparing a human adenovirus type 4 genome DNA standard substance. Background Art

[0002] Human adenovirus was first discovered in 1953. Rowe et al. isolated and cultured it from the atrophic tonsil-like tissue of healthy people. In 1954, Hilleman et al. isolated the same virus from the throat washings of patients with acute respiratory tract infections and named it human adenovirus. HAdV is prevalent worldwide and can cause a variety of diseases. It is one of the common pathogens of human respiratory tract infections. In recent years, respiratory tract infection outbreaks caused by human adenovirus have occurred in my country from time to time, and clusters of severe cases have occurred in some areas. Human adenovirus type 4 genomic DNA standard material can be used for the transfer of quantity values ​​in laboratories related to nucleic acid detection of pathogenic microorganisms; calibration and testing instruments; evaluation and control of test methods; quality verification, quality control, quality arbitration; production process detection, etc.

[0003] At present, my country has not established a complete adenovirus monitoring system, so little is known about the prevalence of adenoviruses, including human adenovirus type 4. To this end, the human adenovirus type 4 strains isolated from nasopharyngeal swab specimens of patients with respiratory tract infections were sequenced for three genes: Penton base, Hexon and Fiber, and sequence comparison and analysis were performed with the domestic and foreign human adenovirus type 4 epidemic strains downloaded from the GenBank database to preliminarily explore the genetic characteristics of the prevalent human adenovirus type 4 in my country and the molecular evolution of human adenovirus type 4 worldwide, providing basic scientific data for the monitoring, prevention and control of human adenovirus type 4 and vaccine development in my country.

[0004] Standardized, normalized, and stable testing reagents are playing an increasingly important role in laboratory monitoring, diagnosis, and evaluation of viral infections. Therefore, stable, uniform, and non-contaminated nucleic acid reference materials are of great significance for the monitoring of human adenovirus type 4 infection and the quality evaluation of diagnostic reagents, as well as for ensuring the accuracy and scientificity of test results.

[0005] Therefore, it is necessary to propose a method for preparing human adenovirus type 4 genomic DNA standard material to solve the above problems. Summary of the invention

[0006] The purpose of the present invention is to solve the problems raised in the above background technology, and to provide a method for preparing a human adenovirus type 4 genomic DNA standard substance.

[0007] In order to achieve the above-mentioned purpose, the present invention specifically adopts the following technical solutions:

[0008] A method for preparing a human adenovirus type 4 genomic DNA standard material, comprising a human adenovirus type 4 strain and HeLa229 human cervical cancer cells as host cells:

[0009] The method for preparing the human adenovirus type 4 genomic DNA standard material comprises the following steps:

[0010] S1. Cell preparation: Digest the overgrown HeLa229 cells with trypsin and perform subculture. The cell concentration is 2×105 viable cells / mL and place them in an incubator containing culture gas for static culture.

[0011] S2. Virus inoculation: Take out the above virus and melt it. When the cells grow to a monolayer of more than 70%, discard the culture medium, inoculate the sample at 10% of the volume of the culture medium, and incubate it in a 37°C incubator containing culture gas for 3 hours;

[0012] S3. Virus culture: Recover the virus solution after virus inoculation and perform fluid replenishment, which is the maintenance culture solution, and then place it in a 37°C incubator containing culture gas for static culture for 24h to 72h;

[0013] S4. Purify the virus: When the cells after virus culture show 80% lesions, harvest them, freeze and thaw them twice at -20°C, centrifuge them at 1500 rpm / min for 10 min to remove larger cell fragments, and filter them with a 0.22 μm syringe filter to remove cell fragments in the virus solution. Subsequently, remove the host cell DNA residues to obtain 25 mL of virus suspension;

[0014] S5. Inactivation of the virus: The virus suspension was treated in a 65°C water bath for 30 min to obtain an inactivated virus solution, which was then placed in a -80°C refrigerator for long-term storage;

[0015] S6. Cell culture: human cervical cancer cells were revived and cultured in T25 bottles, growth medium was added to the culture medium, and the cells were cultured in a 37°C incubator containing culture gas for 3 days. After three days, the cell density could reach 80%;

[0016] S7. Virus transfection: Take the inactivated virus solution out of the refrigerator and dissolve it in a 37°C water bath. Remove the cell culture medium from the human cervical cancer cells with a density of 80%, gently rinse twice with PBS to remove the residual culture medium, inoculate 1 ml of the inactivated virus solution into the host cells, and adsorb for 1 hour under 37°C protective gas conditions. Gently shake the T25 bottle every 15 minutes for a more uniform distribution.

[0017] S8. Blind transmission of the virus: The inactivated virus solution after adsorption was placed in an incubator for culture. The host cells were inoculated with the virus and cultured for one week. No virus infection was observed. After three consecutive blind transmissions, no cytopathic effects were observed, indicating that the virus had been completely inactivated.

[0018] S9. Viral nucleic acid extraction: The completely inactivated virus is subjected to extraction and purification of genomic DNA using a viral nucleic acid extraction kit to obtain viral genomic DNA;

[0019] S10, dilution: mixing the obtained viral genomic DNA with a DNA storage buffer to obtain a human adenovirus type 4 genomic DNA standard material;

[0020] S11. Packaging and storage: The diluted human adenovirus type 4 genome DNA standard material is packaged and stored in a Class II biosafety cabinet in the Class 10,000 working area of ​​the Second Biosafety Laboratory. The packaging bottle is a transparent 1.5mL screw-cap EP tube with a packaging volume of 100μL / unit. After packaging, it is sealed with a rubber ring cap and finally stored in a -80℃ environment.

[0021] Preferably, the dilution of S10 comprises the following steps:

[0022] 1) Mix 100 μL of viral genomic DNA with 900 μL of DNA storage buffer, and shake thoroughly in an ice water bath to ensure uniform mixing to obtain solution 1.

[0023] 2) Take 800 μL of solution 1 and mix it with 7200 μL of DNA storage buffer, and shake it thoroughly in an ice water bath to ensure uniform mixing, thereby obtaining solution 2.

[0024] 3) Take 2400 μL of solution 2 and mix it with 21600 μL of DNA storage buffer, and shake it thoroughly in an ice water bath to ensure uniform mixing, so as to obtain human adenovirus type 4 genomic DNA standard material (high value).

[0025] 4) Take 2400 μL of human adenovirus type 4 genomic DNA standard material (high value) and mix it with 21600 μL of DNA storage buffer, and shake it fully in an ice water bath to ensure uniform mixing, so as to obtain human adenovirus type 4 genomic DNA standard material (medium value).

[0026] 5) Take 2400 μL of human adenovirus type 4 genomic DNA standard material (median value) and mix it with 21600 μL of DNA storage buffer, and shake it fully in an ice water bath to ensure uniform mixing, so as to obtain human adenovirus type 4 genomic DNA standard material (low value).

[0027] Preferably, the culture gas is a mixture of 5% CO2 and 95% air.

[0028] Preferably, the maintenance culture medium is a mixture of 98% EMEM and 2% FBS, and the growth culture medium is a mixture of 90% EMEM and 10% FBS.

[0029] Preferably, the DNA storage buffer is made of 10 mM Tris-HCl and 1 mM EDTA, and has a pH value of 8.0.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] 1. This preparation method specifies the detection reagents of human adenovirus type 4 genomic DNA standard substances with standardized, normalized and stable performance, which can play an important role in laboratory monitoring, diagnosis and evaluation of viral infection, and can ensure the comparability and consistency of test results between different laboratories, thereby improving the accuracy and reliability of diagnostic tests. At the same time, the detection process is stable, uniform and pollution-free, which can effectively reduce the result deviation caused by operational differences.

[0032] 2. High accuracy of the method: Digital PCR is used for quantification, which does not rely on DNA standards, so the measurement results can be traced back to natural units, thus ensuring the reliability and traceability of the measurement results. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a picture of cells that have been completely inactivated without showing any cytopathic effects in the present invention;

[0034] Figure 2 This is a diagram showing the electrophoresis results of adenovirus 4 genome DNA in the present invention;

[0035] Figure 3 This is the NCBI comparison result of the primer-probe amplified sequence in the present invention. DETAILED DESCRIPTION

[0036] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0037] Example:

[0038] The virus strain of human adenovirus type 4 and HeLa229 human cervical cancer cells are used as host cells, wherein the culture gas in the step is a mixture of 5% CO2 and 95% air, the maintenance culture medium is a mixture of 98% EMEM and 2% FBS, the growth culture medium is a mixture of 90% EMEM and 10% FBS, and the DNA storage buffer is made of 10mM Tris-HCl and 1mM EDTA, with a pH value of 8.0:

[0039] The method for preparing human adenovirus type 4 genomic DNA standard material comprises the following steps:

[0040] S1. Cell preparation: Digest the overgrown HeLa229 cells with trypsin and perform subculture. The cell concentration is 2×105 viable cells / mL and place them in an incubator containing culture gas for static culture.

[0041] S2. Virus inoculation: Take out the above virus and melt it. When the cells grow to a monolayer of more than 70%, discard the culture medium, inoculate the sample at 10% of the volume of the culture medium, and incubate it in a 37°C incubator containing culture gas for 3 hours;

[0042] S3. Virus culture: Recover the virus solution after virus inoculation and perform fluid replenishment, which is the maintenance culture solution, and then place it in a 37°C incubator containing culture gas for static culture for 24h to 72h;

[0043] S4. Purify the virus: When the cells after virus culture show 80% lesions, harvest them, freeze and thaw them twice at -20°C, centrifuge them at 1500 rpm / min for 10 min to remove larger cell fragments, and filter them with a 0.22 μm syringe filter to remove cell fragments in the virus solution. Subsequently, remove the host cell DNA residues to obtain 25 mL of virus suspension;

[0044] S5. Inactivation of the virus: The virus suspension was treated in a 65°C water bath for 30 min to obtain an inactivated virus solution, which was then placed in a -80°C refrigerator for long-term storage;

[0045] S6. Cell culture: human cervical cancer cells were revived and cultured in T25 bottles, growth medium was added to the culture medium, and the cells were cultured in a 37°C incubator containing culture gas for 3 days. After three days, the cell density could reach 80%;

[0046] S7. Virus transfection: Take the inactivated virus solution out of the refrigerator and dissolve it in a 37°C water bath. Remove the cell culture medium from the human cervical cancer cells with a density of 80%, gently rinse twice with PBS to remove the residual culture medium, inoculate 1 ml of the inactivated virus solution into the host cells, and adsorb for 1 hour under 37°C protective gas conditions. Gently shake the T25 bottle every 15 minutes for a more uniform distribution.

[0047] S8. Blind transmission of the virus: The inactivated virus solution after adsorption was placed in an incubator for culture. The host cells were inoculated with the virus and cultured for one week. No virus infection was observed. After three consecutive blind transmissions, no cytopathic effects were observed, indicating that the virus had been completely inactivated. After inactivation, the reference Figure 1 For the inactivated virus, the Qiagen virus nucleic acid extraction kit was used to extract and purify the genomic DNA (Cat. NO. 57704). The concentration and purity of the DNA standard substance were detected by ultraviolet spectrophotometry. The Nanodrop test results are shown in Table 1. The purity and concentration meet the subsequent requirements. The electrophoresis results of adenovirus 4 genomic DNA are referenced to Figure 2 ;

[0048] Table 1 Nanodrop test results of DNA standard substances

[0049]

[0050] S9. Viral nucleic acid extraction: The completely inactivated virus is subjected to extraction and purification of genomic DNA using a viral nucleic acid extraction kit to obtain viral genomic DNA;

[0051] S10, dilution: the obtained viral genomic DNA is mixed with a DNA storage buffer to obtain a human adenovirus type 4 genomic DNA standard substance. The dilution comprises the following steps:

[0052] 1) Mix 100 μL of viral genomic DNA with 900 μL of DNA storage buffer, and shake thoroughly in an ice water bath to ensure uniform mixing to obtain solution 1;

[0053] 2) Take 800 μL of solution 1 and mix it with 7200 μL of DNA storage buffer, and shake it thoroughly in an ice water bath to ensure uniform mixing, thereby obtaining solution 2;

[0054] 3) Take 2400 μL of solution 2 and mix with 21600 μL of DNA storage buffer, shake thoroughly in an ice water bath to ensure uniform mixing, and obtain human adenovirus type 4 genomic DNA standard material (high value);

[0055] 4) Take 2400 μL of human adenovirus type 4 genomic DNA standard material (high value) and mix it with 21600 μL of DNA storage buffer, and shake it fully in an ice water bath to ensure uniform mixing, so as to obtain human adenovirus type 4 genomic DNA standard material (medium value);

[0056] 5) Take 2400 μL of human adenovirus type 4 genomic DNA standard material (median value) and mix it with 21600 μL of DNA storage buffer, and fully shake it in an ice water bath to ensure uniform mixing, thereby obtaining human adenovirus type 4 genomic DNA standard material (low value);

[0057] S11. Packaging and storage: The diluted human adenovirus type 4 genome DNA standard material is packaged and stored in a Class II biosafety cabinet in the Class 10,000 working area of ​​the Second Biosafety Laboratory. The packaging bottle is a transparent 1.5mL screw-cap EP tube with a packaging volume of 100μL / unit. After packaging, it is sealed with a rubber ring cap and finally stored in a -80℃ environment.

[0058] test:

[0059] The human adenovirus type 4 (ATCC 1572) nucleic acid extracted from the viral nucleic acid in step S9 was sent to Shanghai Sangon Biotech Co., Ltd. for whole genome sequencing. The sequencing results showed that the virus was Human adenovirus E4 strain ZG / IndioCalifornia USA / 1995. The sequenced human adenovirus type 4 whole gene sequence was compared with the human adenovirus type 4 gene sequence published in GenBank. The nucleotide homology analysis showed that the human adenovirus type 4 genome nucleotide sequence had a homology of up to 99.6% with the human adenovirus type 4 genome nucleotide sequence published in GenBank.

[0060] The human adenovirus type 4 genomic DNA standard material stored in step S11 was tested with HCMV, EBV, hRSV, EV71, HAV, RV, CV, and DENV nucleic acid. There are many serotypes of human adenovirus, and human adenovirus type 1, human adenovirus type 2, human adenovirus type 3, human adenovirus type 5, and human adenovirus type 7, which are widely infected in epidemic, endemic, and sporadic ways, were selected for testing. The test results are shown in Table 2.

[0061] Table 2 Other virus test results

[0062] Virus Name abbreviation Test results Human adenovirus type 4 HAdV-1572 Positive Human adenovirus type 1 HAdV-1 Negative Human adenovirus type 2 HAdV-2 Negative Human adenovirus type 3 HAdV-3 Negative Human adenovirus type 5 HAdV-5 Negative Human adenovirus type 7 HAdV-7 Negative Cytomegalovirus HCMV Negative Epstein-Barr virus EBV Negative RSA hRSV Negative Enterovirus 71 EV71 Negative Hepatitis A virus HAV Negative Rotavirus RV Negative Coxsackievirus CV Negative Dengue virus DENV Negative

[0063] The test results in the above table show that except for the human adenovirus type 4, the others did not amplify.

[0064] The following are the target gene selection and specific primer probe sequences

[0065] The establishment of the determination method is based on the droplet digital PCR platform (Thermo Fisher, QuantStudio TM Absolute Q TM Digital PCR System) was used to design primer probes at the upstream, midstream, and downstream of the Hexon gene, and the primer probes for the digital PCR quantitative method were optimized. The experimental conditions of the droplet digital PCR were as follows:

[0066] Primer probe ratio optimization: Droplet digital PCR set 10μM primer probe: primer: 10μM probe ratio is 1:1; 2:1; 3:1; 4:1 respectively. Absolute Q TM 2.0 μL DNA digital PCR premix (5X), 2 μL DNA template, add ddH2O to 10 μL. QuantStudioTMAbsolute QTM separation buffer. ddPCR reaction conditions are: 96℃10min; 96℃15S, annealing temperature 56℃30S, 50 cycles;

[0067] Optimization of digital PCR reaction annealing conditions: Droplet digital PCR set 10μM primer probe: 0.5μL upstream and downstream primers, 0.25μL probes, Absolute Q TM 2.0 μL DNA digital PCR premix (5X), 2 μL DNA template, add ddH2O to 10 μL. QuantStudioTM Absolute QTM separation buffer. ddPCR reaction conditions are: 96℃10min; 96℃15S, annealing temperature is set to: 52℃, 54℃, 56℃, 58℃, 60℃30s, 50 cycles.

[0068] The primer and probe sequences are shown in Table 3.

[0069] Table 3 Primer and probe sequences for detection of human adenovirus type 4 genomic DNA standard material

[0070]

[0071] The primer probe designed for the midstream sequence of the hexon gene was selected according to the fitting curve. The target sequence amplified by the detection primer probe is as follows:

[0072] TGCCAGTGGAAGGATTCTGACAGCAAAATGCATACCTTTGGGGCAGCTGCCATGCCCGG

[0073] TGTTACTGGGAAAAAGATAGAAGCTGATGGGCTG

[0074] Reference for the NCBI comparison results of the probe amplification sequence Figure 3 .

[0075] The homogeneity test of human adenovirus type 4 genomic DNA standard material is as follows:

[0076] The testing instrument is QuantStudio TM Absolute Q TM Digital PCR system; test reagent is AbsoluteQ TM DNA Digital PCR Master Mix (5X) (360μL), Catalog No.: A52490. QuantStudioTM Absolute QTM Separation Buffer, Catalog No.: A52730.

[0077] The homogeneity test data of human adenovirus type 4 genome DNA standard material are shown in Table 4-1 to Table 4-3:

[0078] Table 4-1 Homogeneity test data of human adenovirus type 4 genome DNA standard material (high value)

[0079]

[0080]

[0081] Table 4-2. Homogeneity test data of human adenovirus type 4 genomic DNA standard material (median)

[0082]

[0083] Table 4-3. Homogeneity test data of human adenovirus type 4 genome DNA standard material (low value)

[0084]

[0085] From the experimental data in Table 4-1 to Table 4-3 above, it can be concluded that for the high, medium and low values ​​of human adenovirus type 4 genomic DNA standard substances, the average values ​​at each concentration level are almost the same (9.44E+03copies / μL, 7.26E+02copies / μL and 6.64E+01copies / μL, respectively). This shows that the differences between different samples are small, indicating that the standard substances have good uniformity during the preparation process; the uniformity evaluation (ubb) of the high, medium and low value standard substances are 1.48%, 2.21% and 2.81%, respectively. These values ​​are relatively low, indicating that the degree of variation between different samples is small, further confirming the uniformity of the standard substance; the results of analysis of variance (ANOVA) showed that for all three concentration levels, the F values ​​(1.18, 1.64, 1.22) were all less than the critical value (2.30) of F0.05 (10,22), which means that at the significance level of 0.05, the differences between different samples were not statistically significant, once again proving the uniformity of the standard substance.

[0086] In summary, these data indicate that the human adenovirus type 4 genomic DNA standard material exhibits good uniformity at different concentration levels.

[0087] The following are the values ​​of human adenovirus type 4 genomic DNA standard material

[0088] Valuation method: The valuation of standard substances is in accordance with the requirements of JJF1343-2022 standard. It is determined by the collaboration of 10 laboratories, and each laboratory independently uses the digital PCR method to measure the characteristic values ​​of the standard substances. The 10 laboratories are verified through experiments to have the same technical capabilities to ensure that the results provided are of high accuracy. The laboratory serial number, name, location, and qualification certification category are shown in Table 5. The human adenovirus type 4 genomic DNA standard substance is determined by the valuation of 10 laboratories (A, B, C, D, E, F, G, H, I, J).

[0089] Table 5 Participating in the fixed value laboratory

[0090]

[0091]

[0092] The original data of the cooperative determination test of human adenovirus type 4 genomic DNA reference material are summarized in Table 6-1 to Table 6-6:

[0093] Table 6-1 Summary of original data of cooperative determination test of human adenovirus type 4 genome DNA reference material (high value)

[0094]

[0095] Table 6-2 Summary of original data of cooperative determination test of human adenovirus type 4 genome DNA standard material (median value)

[0096]

[0097]

[0098] Table 6-3 Summary of original data of cooperative determination test of human adenovirus type 4 genome DNA standard material (low value)

[0099]

[0100] The average values ​​of the measurements are as follows:

[0101] Table 6-4 Human adenovirus type 4 genome DNA standard material (high value) standard value (×10 3 copies / μL)

[0102]

[0103] Table 6-5 Standard values ​​of human adenovirus type 4 genome DNA standard material (median value)

[0104]

[0105]

[0106] Table 6-6 Human adenovirus type 4 genome DNA standard material (low value) standard value

[0107]

[0108] From Tables 6-4 to 6-6, we can see that:

[0109] High-value standard substance: average concentration is 9.62×10 3 copies / μL, the standard deviation (SD) and relative standard deviation (RSD) between different laboratories were 0.28-0.81 and 1.65%-8.12%, respectively, showing good consistency.

[0110] Median standard substance: average concentration is 7.55×10 2 copies / μL, the standard deviation (SD) and relative standard deviation (RSD) between different laboratories were 0.23-1.23 and 3.02%-15.75%, respectively. Although the RSD of laboratory C was higher, it was still within the acceptable range overall.

[0111] Low value standard substance: average concentration is 6.84×10 1copies / μL, the standard deviation (SD) and relative standard deviation (RSD) between different laboratories were 0.22-0.61 and 3.33%-10.10%, respectively, also showing good consistency.

[0112] Through multi-laboratory collaboration, the concentration of human adenovirus type 4 genomic DNA standard material was accurately determined, indicating the effectiveness of human adenovirus type 4 genomic DNA standard material.

[0113] The results of the above-mentioned uniformity and calibration experiments verified the effectiveness and accuracy of the preparation method of human adenovirus type 4 genomic DNA standard material, which can ensure that the standard material can provide consistent and accurate test results when used in different laboratories and at different time points, thereby improving the overall reliability of the test. A calibration scheme for human adenovirus type 4 genomic DNA standard material was established, and the reliability and accuracy of the standard material were verified through multi-laboratory collaboration, providing an important reference basis for subsequent related research and applications.

Claims

1. A method for preparing a human adenovirus type 4 genomic DNA standard material, characterized in that: Including human adenovirus type 4 virus strains and HeLa229 human cervical cancer cells as host cells: The method for preparing the human adenovirus type 4 genomic DNA standard material comprises the following steps: S1. Cell preparation: Digest the overgrown HeLa229 cells with trypsin and perform subculture. The cell concentration is 2×10 5 viable cells / mL, placed in an incubator containing culture gas for static culture; S2. Virus inoculation: Take out the above virus and melt it. When the cells grow to a monolayer of more than 70%, discard the culture medium, inoculate the sample at 10% of the volume of the culture medium, and incubate it in a 37°C incubator containing culture gas for 3 hours; S3. Virus culture: Recover the virus solution after virus inoculation and perform fluid replenishment, which is the maintenance culture solution, and then place it in a 37°C incubator containing culture gas for static culture for 24h to 72h; S4. Purify the virus: When the cells after virus culture show 80% lesions, harvest them, freeze and thaw them twice at -20°C, centrifuge them at 1500 rpm / min for 10 min to remove larger cell fragments, and filter them with a 0.22 μm syringe filter to remove cell fragments in the virus solution. Subsequently, remove the host cell DNA residues to obtain 25 mL of virus suspension; S5. Inactivation of the virus: The virus suspension was treated in a 65°C water bath for 30 min to obtain an inactivated virus solution, which was then placed in a -80°C refrigerator for long-term storage; S6. Cell culture: human cervical cancer cells were revived and cultured in T25 bottles, growth medium was added to the culture medium, and the cells were cultured in a 37°C incubator containing culture gas for 3 days. After three days, the cell density could reach 80%; S7. Virus transfection: Take the inactivated virus solution out of the refrigerator and dissolve it in a 37°C water bath. Remove the cell culture medium from the human cervical cancer cells with a density of 80%, gently rinse twice with PBS to remove the residual culture medium, inoculate 1 ml of the inactivated virus solution into the host cells, and adsorb for 1 hour under 37°C protective gas conditions. Gently shake the T25 bottle every 15 minutes for a more uniform distribution. S8. Blind transmission of the virus: The inactivated virus solution after adsorption was placed in an incubator for culture. The host cells were inoculated with the virus and cultured for one week. No virus infection was observed. After three consecutive blind transmissions, no cytopathic effects were observed, indicating that the virus had been completely inactivated. S9. Viral nucleic acid extraction: The completely inactivated virus is subjected to extraction and purification of genomic DNA using a viral nucleic acid extraction kit to obtain viral genomic DNA; S10, dilution: mixing the obtained viral genomic DNA with a DNA storage buffer to obtain a human adenovirus type 4 genomic DNA standard material; S11. Packaging and storage: The diluted human adenovirus type 4 genome DNA standard material is packaged and stored in a Class II biosafety cabinet in the Class 10,000 working area of ​​the Second Biosafety Laboratory. The packaging bottle is a transparent 1.5mL screw-cap EP tube with a packaging volume of 100μL / unit. After packaging, it is sealed with a rubber ring cap and finally stored in a -80℃ environment.

2. The method for preparing human adenovirus type 4 genomic DNA standard material according to claim 1, characterized in that: The dilution of S10 comprises the following steps: 1) Mix 100 μL of viral genomic DNA with 900 μL of DNA storage buffer, and shake thoroughly in an ice water bath to ensure uniform mixing to obtain solution 1. 2) Take 800 μL of solution 1 and mix it with 7200 μL of DNA storage buffer, and shake it thoroughly in an ice water bath to ensure uniform mixing, thereby obtaining solution 2. 3) Take 2400 μL of solution 2 and mix it with 21600 μL of DNA storage buffer, and shake it thoroughly in an ice water bath to ensure uniform mixing, so as to obtain human adenovirus type 4 genomic DNA standard material (high value). 4) Take 2400 μL of human adenovirus type 4 genomic DNA standard material (high value) and mix it with 21600 μL of DNA storage buffer, and shake it fully in an ice water bath to ensure uniform mixing, so as to obtain human adenovirus type 4 genomic DNA standard material (medium value). 5) Take 2400 μL of human adenovirus type 4 genomic DNA standard material (median value) and mix it with 21600 μL of DNA storage buffer, and shake it fully in an ice water bath to ensure uniform mixing, so as to obtain human adenovirus type 4 genomic DNA standard material (low value).

3. The method for preparing human adenovirus type 4 genomic DNA standard material according to claim 1, characterized in that: The culture gas is a mixture of 5% CO2 and 95% air.

4. The method for preparing human adenovirus type 4 genomic DNA standard material according to claim 1, characterized in that: The maintenance culture medium is a mixture of 98% EMEM and 2% FBS, and the growth culture medium is a mixture of 90% EMEM and 10% FBS.

5. The method for preparing human adenovirus type 4 genomic DNA standard material according to claim 1, characterized in that: The DNA storage buffer is made of 10 mM Tris-HCl and 1 mM EDTA, and has a pH value of 8.0.

Images