Vector transformation method for improving recombinant protein expression quantity of mammalian cells

Abstract

The invention belongs to the technical field of biology, and discloses a vector modification method for improving the expression quantity of recombinant protein of mammalian cells, which comprises the following steps: 1, on the basis of a pTT5 plasmid, taking a human hepatocyte growth factor (hHGF) as a target gene for expression, constructing vectors pTT5-TFBS-TAR-hHGF-His, pTT5-TFBS-TAR-TAT and pTT5-hHGF-His, and taking the pTT5-hHGF-His as a control vector; in order to improve the expression quantity of the recombinant protein in mammalian cells, on the basis that a transcription factor binding site is added to a vector, a TAR / Tat trans-activated protein expression system is adopted, so that the expression quantity of the recombinant protein HGF is improved by about 10 times.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and more specifically to a vector modification method for improving the expression amount of recombinant protein in mammalian cells. Background Art

[0002] 1. Importance and current status of recombinant protein expression in mammalian cells: Mammalian cell expression systems play an irreplaceable role in many fields such as biopharmaceuticals and basic biological research. Many proteins with important biological activities, such as cell growth factor HGF, need to be recombinantly expressed in mammalian cells to obtain protein products with correct folding, modification and biological activity. However, in actual operation, the expression level of recombinant proteins in mammalian cells is often very low.

[0003] (II) Problems caused by low expression: 1) Cost issues: In the production process of recombinant proteins, low expression levels mean that more host cell culture, more raw material inputs and longer production cycles are required, which directly leads to a significant increase in production costs. For example, large-scale cell culture requires a large amount of culture medium, growth factors and energy to maintain cell growth and metabolism. Low expression levels result in very little target protein per unit cost, reducing production efficiency.

[0004] 2) Difficulties in protein purification: The content of low-expression recombinant proteins in cells is relatively small, which causes the target protein to be mixed with a large amount of host cell proteins during the subsequent protein purification process, increasing the difficulty of purification. Since the target protein accounts for a low proportion of the total protein, a more complex and sophisticated purification process is required to separate and enrich the target protein, which not only increases the purification cost, but may also lead to the loss of the target protein during the purification process, affecting the final yield and quality.

[0005] 3. Existing strategies for increasing recombinant protein expression and their limitations 1) Research on transcriptional regulation: Among the many links in gene expression regulation, transcriptional regulation is one of the key steps. Transcription factor binding sites (TFBS) play an important role in gene transcription regulation. TFBS is a DNA sequence located at the 5' end of the gene, and its length is generally around 5-20bp. Transcription factors regulate the expression intensity, time and space of downstream genes by specifically binding to TFBS. Although the importance of TFBS to gene transcription has been recognized, the application of TFBS on commercial vectors (such as pTT5, pCDNA3.1, etc.) is not sufficient, and an effective TFBS addition strategy specifically for increasing the expression of recombinant proteins has not yet been formed.

[0006] 2) Research on transactivation systems: Taking the Tat protein and TAR sequence in human immunodeficiency virus (HIV) as an example, Tat protein, as a transcription activator (transactivator), can bind to the TAR sequence located in the 5'-terminal repeat sequence (LTR) of HIV (the sequence can form a typical stem-loop secondary structure), thereby enhancing the efficiency of HIV gene transcription initiation and extension. However, the application of this transactivation system to improve the expression of recombinant proteins in mammalian cells is still in the exploratory stage, and there is no mature method to combine the TAR / Tat system with vector modification to improve the expression of recombinant proteins.

[0007] In summary, there are currently many challenges in increasing the expression of recombinant proteins in mammalian cells. There is an urgent need for an effective vector modification method to increase the expression of recombinant proteins to solve the problems of high cost and difficulty in protein purification in existing technologies. Summary of the invention

[0008] The purpose of the present invention is to solve the shortcomings of the prior art and to propose a vector modification method for increasing the expression amount of recombinant protein in mammalian cells.

[0009] To solve the above problems, the present invention adopts the following technical solutions: A vector modification method for increasing the expression amount of recombinant protein in mammalian cells comprises the following steps: 1. Based on the pTT5 plasmid and taking human hepatocyte growth factor (hHGF) as the target gene to be expressed, vectors pTT5-TFBS-TAR-hHGF-His, pTT5-TFBS-TAR-TAT and pTT5-hHGF-His were constructed, wherein pTT5-hHGF-His was a control vector.

[0010] 2. Transient transfection: HEK293 cells were transiently transfected with pTT5-TFBS-TAR-hHGF-His and pTT5-TFBS-TAR-TAT at a ratio of 10:1, 5:1, and 3:1, respectively; HEK293 cells were transiently transfected with pTT5-hHGF-His plasmid alone; The amount of the pTT5-TFBS-TAR-hHGF-His and pTT5-hHGF-His vectors is fixed at 40 ug; Each ratio and pTT5-hHGF-His were transfected into 2 bottles as parallels, with 50 mL of HEK293 cells in each bottle; HEK293 cells were diluted to 0.5 × 10 6 / mL, and wait until the cells grow to 4×10 6 / mL, diluted to 2×10 6 / mL for transfection, and feed was added after 24h.

[0011] 3. WB identification of HGF expression: Samples were taken 5 days after transfection, and the samples were centrifuged at 1000 g for 5 min. The supernatant was aspirated to prepare protein samples, and 6×His antibody was used for WB to detect HGF expression.

[0012] As a further solution of the present invention: the construction of the vector pTT5-TFBS-TAR-hHGF-His comprises the following steps: ① Using hepatocyte cDNA as template, PCR amplified the hHGF-His sequence; ②PCR amplification of TAR using the synthetic sequence as template; ③Use EcoRI to digest the vector pTT5-TFBS; ④ Recover hHGF-His, TAR nucleic acid sequences and linearized pTT5-TFBS; ⑤HGF-His, TAR and pTT5-TFBS were connected by seamless cloning to construct the expression vector pTT5-TFBS-TAR-hHGF-His.

[0013] As a further solution of the present invention: the construction of the vector pTT5-TFBS-TAR-Tat comprises the following steps: ① Using the synthetic sequence as a template, PCR amplify TAR-Tat and recover the TAR-Tat nucleic acid sequence; ② Seamlessly clone and connect TAR-Tat and vector pTT5-TFBS to construct the expression vector pTT5-TFBS-TAR-Tat.

[0014] As a further solution of the present invention: the construction of the vector pTT5-hHGF-His comprises the following steps: ① Using hepatocyte cDNA as template, PCR amplified the hHGF-His sequence; ②EcoRI digestion of plasmid pTT5; ③ Recover the hHGF-His nucleic acid sequence and the linearized pTT5 plasmid and construct the expression vector pTT5-hHGF-His.

[0015] As a further solution of the present invention: the construction of the vector pTT5-TFBS comprises the following steps: ① Using the cDNA of HEK293 cells as a template, amplify the TFBS sequence by PCR; ② Use SpeI to cut the upstream of the CMV promoter of the pTT5 plasmid, and recover the TFBS nucleic acid sequence and the linearized pTT5 plasmid; ③ Connect TFBS and pTT5 through seamless cloning to construct the vector pTT5-TFBS.

[0016] Compared with the prior art, the advantages of the present invention are: In order to increase the expression level of recombinant protein in mammalian cells, the present invention adopts TAR / Tat trans-activated protein expression system based on adding transcription factor binding sites to the vector, so that the expression level of recombinant protein HGF is increased by about 10 times. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a WB test result diagram of hHGF expression in the co-transfection group and the control group at various ratios of the present invention; Figure 2 This is a comparison chart of the gray value of hHGF WB results between the co-transfection groups of various ratios in the present invention and the control group. DETAILED DESCRIPTION

[0018] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention; it is obvious that the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments, and all other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making creative work are within the scope of protection of the present invention. Example 1

[0019] A vector modification method for increasing the expression amount of recombinant protein in mammalian cells comprises the following steps: 1. Based on the pTT5 plasmid, human hepatocyte growth factor (hHGF) was used as the target gene to construct vectors pTT5-TFBS-TAR-hHGF-His, pTT5-TFBS-TAR-TAT and pTT5-hHGF-His. pTT5-hHGF-His was the control vector; 1. ① Using the cDNA of HEK293 cells as a template, amplify the TFBS sequence by PCR; Preferably, the nucleotide sequence of the TFBS fragment is as shown in SEQ ID NO.1: SEQ ID NO.1: GCGTGACAGCGATTCGGTGGCCCCCCGAACCCCACCTTGAGGAAGACGCGGCGCAGTCCTGCTTCCACGACGGAGCCGGAAGGACGCAAGGACCGCGGCAGGGCGGAGTTTCTGCGTCCGGCGTCCGGGGGCGGCCGCGACGGCGCATTGTGACGCGCCAGAGCTGAGCCGCCGGTTGGCCGGCTGGGCGCGG AGCAGAGCCGACACGGCTGGCGGGGGAGGCGGTGGAGGCGGACAAGCGAGGACGTTTCTGGAGAGGAGAAGGGAGGGGAGGGGAGGGGGAGGGGGAGGAGGAGGAGGGAGTGGAGCGGCGGGAAAGATCCCTCTGACTGCCCTGAGGCCCTGGAGGAAGGACACTGGTGAGCCCCGCAGGACACTGA.

[0020] ② Use SpeI to cut the upstream of the CMV promoter of the pTT5 plasmid, and recover the TFBS nucleic acid sequence and the linearized pTT5 plasmid; ③ Connect TFBS and pTT5 through seamless cloning to construct the vector pTT5-TFBS.

[0021] ① PCR amplification of hHGF-his fragment using hepatocyte cDNA as template; Preferably, the nucleotide sequence of the hHGF-his fragment is as shown in SEQ ID NO.2: SEQ ID NO.2:

[0022] ②PCR amplification of the TAR fragment using the synthetic TAR sequence as a template; Preferably, the nucleotide sequence of the TAR fragment is as shown in SEQ ID NO.3: SEQ ID NO.3: ACACCCTGGTGAGCCTGCATGGAATGGATGACCCTGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGAC TTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATGCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAA.

[0023] ③Use EcoRI to digest the vector pTT5-TFBS; ④ Recover hHGF-His, TAR nucleic acid sequences and linearized pTT5-TFBS; ⑤ Connect hHGF-His, TAR and pTT5-TFBS by seamless cloning to construct the expression vector pTT5-TFBS-TAR-hHGF-His.

[0024] 3. ① Using the synthetic Tat sequence as a template, PCR amplify the Tat fragment and recover the TAR-Tat nucleic acid sequence; ② Seamlessly clone and connect TAR-Tat with the vector pTT5-TFBS to construct the expression vector pTT5-TFBS-TAR-Tat.

[0025] Preferably, the nucleotide sequence of the Tat fragment is as shown in SEQ ID NO.4: SEQ ID NO.4: ATGGAGCCAGTAGATCCTAGACTAGAGCCCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCAATTGCTATTGTAAAAAGTGTTGCTTTCATTGCCAAGTTTGTTTCATGACAAAAGCCTTAGG CATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCTCTATCAAAGCAACCCACCTCCCAATCCCGAGGGGACCCGACAGGCCCGAAGGAATAG.

[0026] 4. ① Using hepatocyte cDNA as template, PCR amplify the hHGF-His sequence; ② Cut the plasmid pTT5 with EcoRI; ③ Recover the hHGF-His nucleic acid sequence and the linearized pTT5 plasmid to construct the expression vector pTT5-hHGF-His.

[0027] 2. Transient transfection: Co-transfection: pTT5-TFBS-TAR-hHGF-His plasmid and pTT5-TFBS-TAR-TAT plasmid were transiently transfected into HEK293 cells at a ratio of 10:1, 5:1, and 3:1, respectively. Two bottles of each ratio group were transfected as parallels, with 50mL of HEK293 cells in each bottle. The amount of plasmids of the two vectors in each ratio group of co-transfection is shown in the following table: Carrier 10:1 5：1 3：1 pTT5-TFBS-TAR-hHGF-His 40 μg 40 μg 40 μg pTT5-TFBS-TAR-TAT 4 μg 8μg 13 μg Single transfection (control group): 50mL of HEK293 cells per bottle were transfected with 40ug of pTT5-hHGF-His plasmid; 2 bottles were transfected in parallel.

[0028] HEK293 cells were diluted to 0.5×10 6 / mL, and wait until the cells grow to 4×10 6 / mL, diluted to 2×10 6 / mL for transfection, and feed was added after 24h.

[0029] 3. WB identification of HGF expression: Five days after transfection, samples were taken and centrifuged at 1000 g for 5 min. The supernatant was aspirated to prepare protein samples, and 6×His antibody was used for WB to detect HGF expression. Image J software was used to analyze the gray value of each hHGF band in the WB results (reflecting the expression level of hHGF in each group), and the change in hHGF expression in each ratio co-transfection group relative to the control group was calculated based on the gray value of each group.

[0030] 4. Experimental results: WB results are as follows Figure 1 As shown in the figure, the hHGF expression levels of the pTT5-TFBS-TAR-hHGF-His and pTT5-TFBS-TAR-TAT co-transfection groups were similar, but significantly higher than the hHGF expression level of the control group pTT5-hHGF-His. Image J software was used to analyze the gray value of the hHGF bands in each group in the WB results, and the difference in hHGF expression levels in each ratio co-transfection group relative to the control group was statistically analyzed. The results are shown in the figure. Figure 2 As shown: There was no significant difference in the expression of hHGF between the co-transfection groups at each ratio (p>0.05). The expression of hHGF in the co-transfection groups at each ratio was significantly higher than that in the control group (p<0.01). Compared with the control group, the expression of hHGF in the co-transfection groups at each ratio increased by about 10 times. The above results indicate that the expression of the recombinant protein hHGF can be significantly increased by using the TAR / Tat transactivated protein expression system.

[0031] In summary, in order to increase the expression of recombinant proteins in mammalian cells, the present invention modifies the expression vector in terms of increasing the gene transcription level. On the one hand, a transcription factor binding site is added upstream of the vector promoter; on the other hand, a protein expression system with a transactivation system is combined to increase the expression of the recombinant protein.

[0032] The above is only a preferred specific implementation of the present invention; however, the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical solution and its improved conception within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A vector modification method for increasing the expression of recombinant proteins in mammalian cells, characterized in that: The following steps are involved:

1. Based on the pTT5 plasmid and taking human hepatocyte growth factor (hHGF) as the target gene to be expressed, vectors pTT5-TFBS-TAR-hHGF-His, pTT5-TFBS-TAR-TAT and pTT5-hHGF-His were constructed, wherein the pTT5-hHGF-His was a control vector; The construction of the vector pTT5-TFBS-TAR-hHGF-His comprises the following steps: ① Using hepatocyte cDNA as template, PCR amplified the hHGF-His sequence; ②PCR amplification of TAR using the synthetic sequence as template; ③Use EcoRI to digest the vector pTT5-TFBS; ④ Recover hHGF-His, TAR nucleic acid sequences and linearized pTT5-TFBS; ⑤ Connect hHGF-His, TAR and pTT5-TFBS by seamless cloning to construct the expression vector pTT5-TFBS-TAR-hHGF-His; The construction of the vector pTT5-TFBS-TAR-Tat comprises the following steps: ① Using the synthetic sequence as a template, PCR amplify TAR-Tat and recover the TAR-Tat nucleic acid sequence; ② Seamlessly clone and connect TAR-Tat with vector pTT5-TFBS to construct the expression vector pTT5-TFBS-TAR-Tat; The construction of the vector pTT5-hHGF-His comprises the following steps: ① Using hepatocyte cDNA as template, PCR amplified the hHGF-His sequence; ②EcoRI digestion of plasmid pTT5; ③ Recover the hHGF-His nucleic acid sequence and the linearized pTT5 plasmid to construct the expression vector pTT5-hHGF-His; The construction of the vector pTT5-TFBS comprises the following steps: ① Using the cDNA of HEK293 cells as a template, amplify the TFBS sequence by PCR; ② Use SpeI to cut the upstream of the CMV promoter of the pTT5 plasmid, and recover the TFBS nucleic acid sequence and the linearized pTT5 plasmid; ③ Connect TFBS and pTT5 through seamless cloning to construct the vector pTT5-TFBS; 2. Transient transfection: HEK293 cells were transiently transfected with pTT5-TFBS-TAR-hHGF-His and pTT5-TFBS-TAR-TAT at a ratio of 10:1, 5:1, and 3:1, respectively; HEK293 cells were transiently transfected with pTT5-hHGF-His plasmid alone; The amount of the pTT5-TFBS-TAR-hHGF-His and pTT5-hHGF-His vectors is fixed at 40 ug; Each ratio and pTT5-hHGF-His were transfected into 2 bottles as parallels, with 50 mL of HEK293 cells in each bottle; HEK293 cells were diluted to 0.5 × 10 6 / mL, and wait until the cells grow to 4×10 6 / mL, diluted to 2×10 6 / mL for transfection, and feed was added after 24h; 3. WB identification of HGF expression: Samples were taken 5 days after transfection, and the samples were centrifuged at 1000 g for 5 min. The supernatant was aspirated to prepare protein samples, and 6×His antibody was used for WB to detect HGF expression.

Images