Protein PzXPB1 related to repair of freeze-thaw damage of poplar as well as coding gene and application of protein PzXPB1

Abstract

The invention discloses a poplar freeze-thaw damage repair related protein PzXPB1 as well as a coding gene and application of the poplar freeze-thaw damage repair related protein PzXPB1. The protein is the protein as shown in 1) or 2): 1) the protein is composed of an amino acid residue sequence of SEQ ID sequence 2 in a sequence table; and 2) a protein which is obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid residue sequence in 1), has a freeze-thaw damage repairing function and is derived from the SEQ ID sequence 2. Tobacco genetic transformation experiments and relative conductivity detection prove that the protein disclosed by the invention can be used for improving the cold resistance of tobaccos.

Description

Technical Field

[0001] The invention belongs to the field of biology and relates to a poplar freeze-thaw damage repair-related protein PzXPB1 and a coding gene and application thereof. Background Art

[0002] Temperature is the main limiting factor that determines the geographical distribution of plants. The economic losses caused to plants by low temperatures amount to tens of billions of yuan each year worldwide. Poplars (Populus spp.) are a general term for tree species of the genus Populus (Populus L.) of the Salicaceae family, which are mainly distributed in Southwest, Northwest, Northeast my country and North China. Poplars have a small genome, grow fast, and are easy to genetically transform. The genome sequencing was completed earlier. They are ideal materials for studying the molecular mechanisms of freeze-thaw resistance and are known as model tree species for forest genetic engineering. Poplar freeze-thaw damage is divided into reversible freeze-thaw damage and irreversible freeze-thaw damage. The cumulative effect of effective freeze-thaw damage is the main cause of poplar winter death. The ability of poplars to self-repair after reversible freeze-thaw damage is the key to their ultimate survival from the severe winter cold.

[0003] DNA repair is a cell's response to DNA damage. This response may restore the DNA structure to its original state, re-perform its original function, and allow the cell to continue to survive. If the cell does not have this repair function, it will not be able to cope with frequent DNA damage events and will not survive. Therefore, studying DNA repair is an important topic in exploring life. Research on DNA repair of poplar freeze-thaw damage is of great significance to poplar cold-resistant breeding. Summary of the invention

[0004] Based on this, the purpose of the present invention is to provide a poplar freeze-thaw damage repair-related protein PzXPB1 and its encoding gene and application.

[0005] The poplar freeze-thaw damage repair-related protein provided by the present invention is derived from poplar, named PzXPB1, and has the following 1) or 2) biological characteristics:

[0006] 1) A protein consisting of the amino acid residue sequence of SEQ ID sequence 2 in the sequence listing;

[0007] 2) A protein derived from SEQ ID No. 2 having freeze-thaw damage repair function, wherein one or more amino acid residues of the amino acid residue sequence described in 1) are replaced and / or deleted and / or added.

[0008] The SEQ ID sequence 2 in the sequence listing consists of 769 amino acid residues.

[0009] The gene PzXPB1 encoding the poplar freeze-thaw damage repair-related protein also falls within the protection scope of the present invention.

[0010] The cDNA of the poplar freeze-thaw damage repair-related protein is a DNA molecule with the following 1) or 2) or 3) biological characteristics:

[0011] 1) the nucleotide sequence of SEQ ID sequence 1 in the sequence listing;

[0012] 2) a nucleotide sequence that can hybridize with the DNA sequence described in 1) or 2) under stringent conditions;

[0013] 3) A nucleotide sequence having more than 90% homology with the nucleotide sequence described in 1) or 2) and encoding a protein having freeze-thaw damage repair function.

[0014] Sequence 1 in the sequence list has a total length of 2307 nucleotides and encodes a protein with a length of 769 amino acids (sequence 2 in the sequence list).

[0015] The recombinant expression vector, expression cassette or recombinant bacteria containing the encoding gene all fall within the protection scope of the present invention.

[0016] The recombinant expression vector is a recombinant vector expressing the elicitor protein obtained by inserting the nucleotide fragment described in sequence 1 in the sequence table into the starting vector. Preferably, the transgenic recombinant bacteria is a transgenic recombinant bacteria expressing the elicitor protein obtained by transferring the recombinant expression vector into Agrobacterium.

[0017] The application of the protein and its encoding gene in improving the cold resistance of plants also falls within the protection scope of the present invention, and the plant is preferably tobacco.

[0018] The present invention is the first in the field of plants to discover that the DNA repair pathway gene PzXPB1 has the function of improving tobacco cold tolerance, paving the way for research on DNA repair genes to improve plant stress resistance. The present invention helps to clarify the molecular mechanism of poplars' safe wintering and lays the foundation for molecular breeding of poplars for cold resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 pBWA(V)HS-ccdb-Glosgfp expression vector map

[0020] Figure 2 This is the tobacco phenotype after 2 hours of cold stress at 3℃. Figure 2 Among them, No. 6 and No. 3 are transgenic tobacco, and CK is the wild-type tobacco control.

[0021] Figure 3 This is the electrophoresis diagram of positive transgenic PzXPB1 tobacco detection. Note: the left marker is the positive control, the right marker is the negative control, and the right marker is the water control.

[0022] Figure 4This is a picture of transgenic PzXPB1 tobacco tissue culture.

[0023] Figure 5 The initial growth of transgenic tobacco and control group after seedling transplantation. CK is wild-type tobacco, which is the control; 1, 3, 4, and 6 are transgenic PzXPB1 tobacco. DETAILED DESCRIPTION

[0024] The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged.

[0025] Example 1: Acquisition of the key gene PzXPB1 for repairing freeze-thaw damage in poplar

[0026] 1. Cloning of the key gene PzXPB1 for freeze-thaw damage repair in poplar

[0027] In early November, one-year-old branches of Zhongliao No. 1 Poplar (P. × canadensis'Zhongliao1') were collected and placed in a -40℃ environment for 24 hours, and then placed in a 20℃ environment for 30 minutes. The phloem on the branches was collected to extract RNA, and RNA-seq transcriptome sequencing was performed (Accession number in NCBI SRA: PRJNA891633), and the sequencing results were analyzed by bioinformatics. Through the freeze-thaw stress transcriptome analysis of Zhongliao No. 1 Poplar, a gene related to freeze-thaw damage repair function was discovered and identified, named PzXPB1.

[0028] The leaves of Zhongliao No. 1 poplar tissue culture seedlings were used as materials to extract RNA and reverse transcribe it into cDNA.

[0029] (1) Synthesize amplification primers for the target gene PzXPB1

[0030] F1:ggagagaacacgggggactttgcaacATGGGACACGTGATAAAAG

[0031] R1:ccactccctgaagcggccgctgtacaGCCAAAGCGCCTTTTGAAC

[0032] (2) PCR amplification system and procedure

[0033] Using the cDNA obtained by reverse transcription as a template, PCR amplification was performed using the above primers F1 and R1:

[0034] Make a 50uL system and perform amplification reaction according to the following procedure. The reaction system is shown in Table 1 and the reaction procedure is shown in Table 2:

[0035] Table 1 PCR system

[0036]

[0037]

[0038] Table 2 PCR program

[0039]

[0040] Use 1% agarose gel electrophoresis at 5v / cm for 20 minutes, cut out the electrophoresis fragment of PzXPB1 under ultraviolet light, and place it in a system for sol recovery. Use a total volume of 40uL of water to dissolve and recover the PCR product. After the test is correct, combine it with the vector pBWA(V)HS-ccdb-Glosgfp (see the vector map for details) Figure 1 ) to perform vector digestion and recombination reaction. 5-10uL of the ligation product was transformed into competent E. coli, transformed into Kan resistance plates, cultured at 37℃ for 12 hours, and then subjected to plaque PCR identification and sequencing.

[0041] The sequencing results showed that a 2307 bp gene was obtained, the sequence of which is shown in Sequence 1 in the sequence listing, named PzXPB1, encoding the amino acid residue sequence of Sequence 2 in the sequence listing (PzXPB1).

[0042] Example 2: Functional verification of the key gene PzXPB1 for repairing freeze-thaw damage in poplar trees of the present invention

[0043] 1. Construction of overexpression vector pBWA(V)HS-PzXPB1-Glosgfp

[0044] The starting vector was pBWA(V)HS (purchased from BioVector Plasmid Vector Strain Cell Protein Antibody Gene Collection Center).

[0045] The overexpression vector construction method is as follows:

[0046] The PzXPB1 gene (the gene shown in SEQ ID sequence 1, obtained according to the method of Example 1) and the linker fragment (SEQ ID sequence 3) and the osGFP fragment (SEQ ID sequence 4) connected in series were inserted between the 35s promoter and the NOS terminator of pBWA (V) HS, and the competent Escherichia coli was transformed. PCR and sequencing verification were performed. Sequencing showed that the correct recombinant expression vector was named pBWA (V) HS-PzXPB1-Glosgfp, in which PzXPB1 was expressed by the 35S promoter.

[0047] 2. Preparation of transgenic Agrobacterium

[0048] Take 1 μL of plasmid pBWA(V)HS-PzXPB1-Glosgfp and add it to 50 μL GV3101 Agrobacterium competent cells, mix thoroughly and then transfer to an electroporation cup, add 1 mL of LB liquid medium after electroporation, mix thoroughly and then transfer to a 1.5 mL centrifuge tube, shake and culture on a shaker at 30°C and 180 rpm for 30 min, and transfer 50 μL of the activated Agrobacterium liquid to LB solid medium, and culture in the dark at 30°C for 48 h. The obtained positive strain was verified by PCR (F1576-35S-452R: ggcaacttggtcttcgacaa, 35s-seq: ttcatttggagagaacacgggggac), and was named pBWA(V)HS-PzXPB1-Glosgfp Agrobacterium.

[0049] 3. Obtaining transgenic PzXPB1 tobacco

[0050] 3.1 Pre-culture

[0051] Tobacco seeds were sterilized in 75% alcohol for 30 seconds, washed with sterile water for 1 minute, and then sterilized with 84 disinfectant for 3-5 minutes, and washed with sterile water for 3 times, 1 minute each time. The sterilized tobacco seeds were sown on the germination medium, cultured at 23℃ with 16h / 8h light / dark for 4-5 weeks, and the sterilized tobacco leaves were cut into small pieces with a scalpel and inoculated on the pre-culture medium.

[0052] 3.2 Agrobacterium infection and co-cultivation

[0053] Pick the Agrobacterium transformed with pBWA(V)HS-PzXPB1-Glosgfp in the infection solution and prepare the OD 600 = 0.2 of pBWA(V)HS-PzXPB1-Glosgfp Agrobacterium resuspension, inoculate tobacco leaves pre-cultured for 2-3 days in the Agrobacterium suspension for infection for 10-15 minutes, inoculate the infected tobacco leaves on filter paper, dry them and inoculate them on co-culture medium, and culture them in the dark for 48-72 hours.

[0054] 3.3 Induction After 2 days of co-cultivation, the leaves were transferred to the induction medium for callus induction for about 10 days until callus tissue grew.

[0055] 3.4 Select callus tissue that meets the standards and inoculate it on the screening medium with corresponding resistance. The culture time is 15-30 days and the culture temperature is 23±2℃.

[0056] 3.5 Differentiation and rooting The actively growing positive callus tissues from the second screen were inoculated on differentiation medium, 4-5 calli / dish, and cultured at 23℃ with 16h / 8h light / dark for 15-30 days. During the differentiation process, if seedlings are formed from the callus, they are inoculated on seedling medium and grown for 7-10 days.

[0057] 3.6 Detection The CTAB method was used to extract tobacco genomic DNA and PCR detection was performed (F1576-35S-452R: ggcaacttggtcttcgacaa; 35s-seq: ttcatttggagagaacacgggggac). The test results were as follows Figure 3 As shown, it shows that positive transgenic PzXPB1 tobacco ( Figure 4 ).

[0058] 4 、 Test on cold resistance index of positive transgenic PzXPB1 tobacco

[0059] 4.1 Test Method

[0060] The transgenic tobacco containing PzXPB1 was subjected to cold stress, and the wild-type tobacco was set as the control (CK). Treatment method: The rooted tobacco tissue culture seedlings that were ventilated for 24 hours were placed in a 3℃ plant growth chamber for cold stress for 2 hours, and then their relative conductivity was tested as follows:

[0061] Take tobacco leaves of similar size, wash them with tap water and then rinse them with deionized water three times. Use filter paper to absorb the moisture on the surface of the leaves. Quickly weigh 3 fresh leaf samples of each tobacco series (repeated three times), 0.2g each. After cutting the samples, place them in conical bottles filled with 20ml deionized water, seal the bottles and shake them on a shaker at room temperature for 12h (150r / min). Use a DDS-IIC digital conductivity meter to measure the conductivity of the extract (R1) and the conductivity of deionized water (R0), then place them in a water bath, heat them in a boiling water bath for 30-40min, cool them to room temperature and shake them well, and measure the conductivity of the extract again (R2).

[0062] Relative conductivity = (R1-R0) / (R2-R0)×100%

[0063] 4.2 Relative conductivity test results of genetically modified tobacco

[0064] The relative conductivity of tobacco transformed with the PzXPB1 gene is generally lower than that of the control (CK). The relative conductivity of No. 3, which has the smallest seedling height, is significantly lower than that of the control (CK) after cold stress, and is 9.77% lower than the control on average. The results of variance analysis show that the difference is significant at the 0.05 level (Table 3). The higher the relative conductivity, the more serious the cell damage. The experimental results show that tobacco transformed with the PzXPB1 gene has a certain degree of cold resistance.

[0065] Table 3 Results of variance analysis of relative conductivity of tobacco after cold stress treatment

[0066] Tobacco ID Average relative conductivity (%) Inverse sine transformation Convert to Angle CK (control) 34.28 0.3499a 20.05a No. 1 33.07 0.3370ab 19.31ab No.3 30.93 0.3145b 18.02b No. 4 32.86 0.3348ab 19.18ab No. 6 33.71 0.3438a 19.70a

[0067] Note: Different letters in the columns indicate significant differences at the 0.05 level. CK is wild-type tobacco, used as a control; 1-6 are transgenic PzXPB1 tobacco.

[0068] The leaves of transgenic tobacco and wild-type tobacco (CK) wilted to varying degrees after cold stress, with the wild-type wilting more severely (see Figure 2 ). After the stress was removed and the plants were moved to room temperature for growth recovery, most of the transgenic tobacco plants were able to recover to normal (75% recovery success rate); some wild-type tobacco leaves showed a tendency to yellow, and the proportion of successful recovery to normal was less than 50%.

[0069] The height of the tobacco seedlings (the same as the tobacco strain treated with cold stress and not subjected to cold stress) transplanted for 3 days was measured with a ruler. The tobacco height growth index is shown in Table 4 below:

[0070] Table 4 Tobacco transplant seedling height

[0071] name CK No. 1 No.3 No. 4 No. 6 Seedling height / cm 7.1 5.8 2.3 5.6 5.2

[0072] The height growth of tobacco transgenic with PzXPB1 gene is generally less than that of wild type control. See Table 4 and Figure 5 .

[0073] The new gene PzXPB1 cloned from European and American Yangzhongliao No. 1 was proven to improve the cold resistance of tobacco through tobacco genetic transformation experiments and relative conductivity tests.

Claims

1. A protein, which is the protein shown in 1) or 2) below: 1) A protein consisting of the amino acid residue sequence of SEQ ID sequence 2 in the sequence listing; 2) A protein derived from SEQ ID sequence 2 having freeze-thaw damage repair function, wherein one or more amino acid residues in the amino acid residue sequence described in 1) are replaced and / or deleted and / or added.

2. A gene encoding the protein according to claim 1.

3. The coding gene according to claim 3, characterized in that: The cDNA nucleotide sequence of the coding gene is shown in 1), 2) or 3) below: 1) the nucleotide sequence of SEQ ID sequence 1 in the sequence listing; 2) a nucleotide sequence that can hybridize with the DNA sequence described in 1) or 2) under stringent conditions; 3) A nucleotide sequence having more than 90% homology with the nucleotide sequence described in 1) or 2) and encoding a protein having freeze-thaw damage repair function.

4. A recombinant expression vector containing the coding gene according to claim 2 or 3.

5. The recombinant expression vector according to claim 4, characterized in that The recombinant expression vector is a recombinant vector expressing freeze-thaw damage repair-related proteins obtained by inserting the nucleotide fragment described in sequence 1 in the sequence table into the starting vector.

6. A transgenic recombinant bacterium containing the coding gene according to claim 2 or 3; preferably, the transgenic recombinant bacterium is a transgenic recombinant bacterium expressing an elicitor protein obtained by transferring the recombinant expression vector according to claim 2 or 3 into Agrobacterium.

7. Use of the protein or its encoding gene according to claim 1 in improving the cold resistance of plants.

8. The use according to claim 7, characterized in that: The plant is tobacco.

Images