Ampullaria gigas antifeedant based on NPFR gene and application of Ampullaria gigas antifeedant

Abstract

The invention discloses an NPFR gene-based pomacea canaliculata antifeedant and application thereof, and belongs to the field of prevention and control of agricultural pests. The dsNPFR based on the NPFR gene is designed and synthesized on the basis of an RNAi-mediated NPFR gene silencing technology, by injecting the dsNPFR into the ampullaria gigas, the lethal effect is obvious, the NPFR gene expression quantity, the body weight growth rate, the leaf feeding area, the digestive enzyme activity and the like are remarkably reduced, feeding and growth of the ampullaria gigas are effectively inhibited, a new strategy and a molecular target are provided for research and development of RNAi biopesticides, and the application has a wide application prospect. And a new technical approach is provided for prevention and control of ampullaria gigas invasion hazards.

Description

Technical Field

[0001] The invention relates to the field of agricultural pest control, and in particular to an NPFR gene-based Pomacea canaliculata antifeedant and application thereof. Background Art

[0002] The golden apple snail [Pomacea canaliculata (Lamarck, 1819)] belongs to the phylum Mollusca, the class Gastropoda, the order Mesogastropoda, the family Ampullariidae, the genus Pomacea. It is native to the Amazon River Basin in South America and has a 40-year history of invasion in my country. It has now spread to more than 260 counties (districts) in 17 provinces (municipalities) in southern my country. Due to its fast growth, high reproductive capacity, strong resistance to adversity, large appetite, miscellaneous diet, and wide adaptability, it occurs throughout rivers, ditches, farmland wetlands, and shallow lakes. The golden apple snail population is rampant and feeds on aquatic crops and vegetables in large quantities, competing with local organisms for ecological niches and resources, destroying the ecological balance and biodiversity, and seriously threatening agricultural production and aquatic ecosystems. According to statistics in 2011, the area of ​​farmland in my country damaged by golden apple snails exceeded 4.26 million square kilometers. During the population's gluttony period, adult snails can cause large-scale rice seedlings to die within 1-2 days, and aquatic crops and vegetables to suffer poor yields. The density of golden apple snails in rice fields can be as high as 16.95 per square meter, with the highest rate of rice damage reaching 64%, causing losses of 10-40%; the damage rate to wild rice, arrowhead mushrooms, and astragalus can reach as high as 10-15%, and even more than 30% in some fields.

[0003] Existing studies have used chemical drugs, ecological engineering, pathogenic microorganisms, plant-derived ingredients, and the release of natural enemies to kill golden apple snails, but in actual applications, chemical control is still the main method. Although it has a good snail-killing effect, it also has problems such as a single variety of agents, strong toxicity to non-target organisms, environmental pollution, and the risk of inducing drug resistance. Therefore, it is urgent to seek efficient, economical, environmentally friendly, and sustainable control strategies.

[0004] Introducing double-stranded RNA (dsRNA) consisting of sense RNA and antisense RNA corresponding to mRNA into cells can cause specific degradation of mRNA. This highly conservative post-transcriptional gene silencing (PTGS) is called RNA interference (RNAi). RNAi has the advantages of high efficiency, rapidity, simplicity, and specificity. It is widely used in reverse verification of gene function, development of new pesticide targets, and prevention and control of agricultural pests. dsRNA is usually delivered by microinjection, feeding, surface immersion, transgenic plants, and virus-mediated delivery. At present, some researchers have successfully achieved systematic and specific silencing of the genes of Pomacea canaliculata through microinjection, but there are no examples or reports of using RNAi to control Pomacea canaliculata.

[0005] In invertebrates, neuropeptide F (NPF) binds to its receptor NPFR and activates NPF signal transduction, regulating many biological processes such as stress response, circadian rhythm, growth and reproduction, and feeding metabolism. In mollusks, NPF-NPFR signals inhibit the appetite of Aplysia californica and reduce its food intake; on the contrary, they significantly induce feeding in Pacific abalone (Haliotis discusannai) and Manila clam (Ruditapes philippinarum); but have no significant effect on the feeding of Lymnaea stagnalis. In Pomacea canaliculata, the physiological function and mechanism of action of NPFR are not clear. The present invention discovers for the first time the regulatory role of NPFR gene in the feeding metabolism of Pomacea canaliculata, which is helpful to explore molecular targets and new pathways for pest control, and provides a scientific basis for the research and development of RNAi green pesticides and feeding regulators targeting NPFR. Summary of the invention

[0006] The purpose of the present invention is to provide a Pomacea canaliculata antifeedant based on the NPFR gene and its application, so as to solve the problems existing in the above-mentioned prior art. The NPFR gene silencing technology mediated by RNAi can inhibit the feeding and growth of Pomacea canaliculata by significantly reducing the expression of the NPFR gene in Pomacea canaliculata. It can be used as an alternative strategy for controlling Pomacea canaliculata, reduce the ecological, social and economic losses caused by the invasion and spread of Pomacea canaliculata populations, and provide technical support for avoiding the "3R" risks of using chemical snailicides.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a dsRNA synthesized based on the NPFR gene of Pomacea canaliculata, wherein the dsRNA is a double-stranded RNA consisting of a sense chain nucleotide sequence shown in SEQ ID NO: 2 and an antisense chain nucleotide sequence of SEQ ID NO: 2.

[0009] The present invention also provides a DNA molecule encoding the dsRNA.

[0010] The present invention also provides a primer pair for synthesizing the dsRNA, and the nucleotide sequences of the primer pair are shown in SEQ ID NO: 9 and SEQ ID NO: 10 respectively.

[0011] The present invention also provides a kit containing the primer pair.

[0012] The present invention also provides the use of the dsRNA or the DNA molecule or the primer pair or the kit in any of the following:

[0013] (1) Application in the prevention and treatment of golden apple snails;

[0014] (2) Application in the preparation of antifeedants for the prevention and treatment of Pomacea canaliculata;

[0015] (3) Application in the preparation of pharmaceutical preparations for inhibiting the feeding and growth of Pomacea canaliculata snails.

[0016] The present invention also provides the use of the Pomacea canaliculata NPFR gene in any of the following:

[0017] (1) Application in the prevention and treatment of golden apple snails;

[0018] (2) Application in the preparation of antifeedants for the prevention and treatment of Pomacea canaliculata;

[0019] (3) Application in the preparation of pharmaceutical preparations for inhibiting the feeding and growth of Pomacea canaliculata snails;

[0020] The gene accession number of the NPFR gene in NCBI is XM_025240645.1.

[0021] Preferably, by providing the Pomacea canaliculata with dsRNA synthesized based on the NPFR gene, the expression of the NPFR gene is inhibited or silenced, thereby inhibiting the feeding and growth of the Pomacea canaliculata; wherein the dsRNA is a double-stranded RNA consisting of the sense chain nucleotide sequence shown in SEQ ID NO: 2 and the antisense chain nucleotide sequence of SEQ ID NO: 2.

[0022] The invention also provides an antifeedant for inhibiting the feeding and growth of Pomacea canaliculata, which contains the dsRNA.

[0023] The present invention also provides a method for preventing and controlling damage by Pomacea canaliculata, comprising the step of providing the Pomacea canaliculata with the dsRNA.

[0024] Preferably, the dsRNA molecule is provided to the Pomacea canaliculata snail at a dosage of 8 μg per Pomacea canaliculata snail for 5 days to inhibit the feeding and growth of the Pomacea canaliculata snail, thereby achieving the purpose of preventing and controlling the Pomacea canaliculata snail from invading.

[0025] The present invention discloses the following technical effects:

[0026] (1) The dsNPFR synthesized by the present invention can reduce the risk of drug resistance, reduce the use of chemical pesticides, protect the ecological balance, and be friendly to non-target organisms and the environment.

[0027] (2) After 5 days of treatment with 8 μg dose of dsNPFR injection, the individual mortality rate was relatively high, the NPFR expression level was relatively low, and the body weight growth rate and leaf feeding area were significantly reduced. In addition, the digestive enzyme activity was significantly reduced after silencing NPFR compared with the control.

[0028] (3) The NPFR-based antifeedant of the present invention can effectively inhibit the feeding and growth of Pomacea canaliculata, providing new strategies and molecular targets for the development of RNAi biopesticides, which has important theoretical and practical value. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0030] Figure 1 The electrophoresis diagram of target gene amplification (A) and the schematic diagram of RNAi microinjection site (B); the first lane M is the standard DNA marker, and the second and third lanes are dsNPFR and dsGFP respectively;

[0031] Figure 2 Individual survival rate (A) and gene expression (B) 1-7 days after injection of dsNPFR; * indicates significant difference from the control, p < 0.05;

[0032] Figure 3 The effect of dsRNA injection on the feeding behavior of Pomacea canaliculata snails (2 hours after the snails were placed);

[0033] Figure 4 Effects of dsNPFR treatment on leaf feeding area (8 h after snails were placed) (A) and body weight growth rate (B); * indicates significant difference from the control, p < 0.05;

[0034] Figure 5The effect of dsNPFR treatment on digestive enzyme activity; * indicates significant difference compared with the control, p<0.05. DETAILED DESCRIPTION

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0037] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0038] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0039] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0040] Example 1

[0041] 1. Primer design

[0042] The full-length sequence of the jellyfish green fluorescent protein gene (GFP, GenBank: MN443913.1) / Pomacea canaliculata NPFR gene (GenBank: XM_025240645.1) was obtained from the National Center of Biotechnology Information database. The CDS regions were 1-723 and 427-1908, respectively. The specific primers were designed using the NCBIPickPrimers function, which must meet the following requirements: ① Primer length 17-25 bases; ② GC content 40-60%; ③ The Tm values ​​of the two primers are close; ④ The 3' terminal base should avoid being T, and the complementary sequence of more than 3 bases should be avoided between the two primers or within the primers; ⑤ The length of the primers for qRT-PCR is 80-200 bp. The design results are shown in Table 1.

[0043] Table 1 Primer information

[0044]

[0045] In the above table, in the dsRNA synthesis primers, lowercase letters represent T7 promoter sequences, β-actin is the internal reference for qRT-PCR, and GFP is the control.

[0046] 2. Interference system construction

[0047] 2.1 RNA extraction

[0048] Pomacea canaliculata snails with strong vitality and uniform body shape (weight 4.5±0.3 g, shell height 15-25 mm) were selected, and total RNA was extracted using the SV Total Isolation System Kit with genomic DNA (gDNA) Eraser (Promega, Madison, United States).

[0049] 2.2 cDNA Reverse Transcription

[0050] The RNA concentration and purity were analyzed by Nanodrop2000, and samples with OD values ​​(A260 / 280) of 1.8 to 2.0 were taken for reverse transcription, and the RNA integrity was verified by 1.5% agarose gel electrophoresis. TM The first strand cDNA was synthesized using 1st strand cDNA Synthesis Kit (TaKaRa, Tokyo, Japan).

[0051] 2.3dsRNA Synthesis

[0052] Using T7RiboMAX TMThe Express RNAi System (Promega, Madison, USA) kit was used in combination with the primers in Table 1 to amplify the sense strand ssRNA and antisense strand ssRNA in a PCR instrument (Applied Biosystems, Thermo Fisher Scientific). Finally, dsGFP / dsNPFR was synthesized by annealing reaction, with lengths of 431 bp and 362 bp, respectively (see Figure 1 (A).

[0053] The positive strand of dsGFP is shown below (SEQ ID NO: 1):

[0054] gcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgc agtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggca actacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagc tggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtg.

[0055] The antisense strand of dsGFP is the reverse complementary strand of its sense strand.

[0056] The positive strand of dsNPFR is shown below (SEQ ID NO: 2):

[0057] ttcaacctcctcagcgaattccatctgcagctctttagttccgcggccatcaacaagacagcaggtgaagaacacgtcctggaggggtcagtcaacatcaacctcgcctacgccatctgtcatctgctggttctctgttcagcctgcgtcaacccggtggtctacgggtggttcaacgaca acttcaaggtggagttcctgaagatcctggtctgtccttgctgcacccagctcaaggtggccattaagaggattctgtgttgcaagcgaagcaagccggaagtgccatcgatcacgctaaccaaagcgtccaatggaaacgggtcttacggagctgttggacattgtgatgaaggtgacgg.

[0058] The antisense strand of dsNPFR is the reverse complementary strand of its sense strand.

[0059] 3. Silent parameter screening

[0060] Pomacea canaliculata (weight 4.5±0.3g, shell height 15-25mm) was placed on ice for anesthesia for 10-15min, the shell was gently opened, dsGFP / dsNPFR (2-8μg / snail) was injected into the foot muscle with a microsyringe (Hamilton701RN), and the needle was left for 5-10s before being withdrawn (see Figure 1 B). Samples were taken 1 day, 3 days, 5 days and 7 days after treatment, and the expression of NPFR gene was analyzed by fluorescence quantitative qRT-PCR. The survival rate was observed and recorded. The optimal injection concentration and treatment time were 8 μg / 5 days (NPFR expression decreased by 72.8%, and the corrected survival rate was 64.0%), and the second best was 8 μg / 3 days (NPFR expression decreased by 78.9%, and the corrected survival rate was 74.0%) (see Figure 2 ).

[0061] 4. Application effect evaluation

[0062] Five days after the injection of 8 μg dsNPFR, the following experiments were performed:

[0063] ① Collect samples and dissect them, and use the kit produced by Nanjing Jiancheng Bioengineering Institute to measure the activity of intestinal digestive enzymes.

[0064] ② Place snails and lettuce leaves of equal area into a water tank, observe their behavior after 2 hours, collect leaves after 8 hours, and use LeafByte software (version 1.3.0) to analyze the feeding area of ​​circular leaves.

[0065] ③ Provide sufficient lettuce leaves for growth and development. After 30 days, collect snail samples from the control and treatment groups, weigh them using an electronic balance (accurate to 0.1 mg), and calculate the weight growth rate (WGR) using the following formula:

[0066] WGR (%) = (W2-W1) / W1×100;

[0067] In the formula, W1 and W2 are the initial and final weights of each medium snail, respectively.

[0068] The results showed that compared with the control dsGFP, the foraging activity of the silencing group was inhibited (see Figure 3 ); food intake and body weight growth rate decreased significantly by 66.8% and 68.3% respectively (see Figure 4 ); α-amylase, cellulase, protease and lipase were significantly reduced by 52.2%, 46.8%, 52.4% and 63.4% respectively (see Figure 5 ). Combined with the screening results in the above “3. Silencing parameter screening”, the optimal concentration of dsNPFR is 8 μg, and the treatment time is 5 days, which can achieve the effect of inhibiting feeding metabolism and growth and development.

[0069] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A dsRNA synthesized based on the NPFR gene of Pomacea canaliculata, characterized in that: The dsRNA is a double-stranded RNA consisting of a sense strand nucleotide sequence shown in SEQ ID NO: 2 and an antisense strand nucleotide sequence shown in SEQ ID NO:

2.

2. A DNA molecule encoding the dsRNA according to claim 1.

3. A primer pair for synthesizing the dsRNA according to claim 1, characterized in that: The nucleotide sequences of the primer pair are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively.

4. A kit comprising the primer pair according to claim 3.

5. Use of the dsRNA according to claim 1, the DNA molecule according to claim 2, the primer pair according to claim 3, or the kit according to claim 4 in any of the following: (1) Application in the prevention and treatment of golden apple snails; (2) Application in the preparation of antifeedants for the prevention and treatment of Pomacea canaliculata; (3) Application in the preparation of pharmaceutical preparations for inhibiting the feeding and growth of Pomacea canaliculata snails.

6. Application of the NPFR gene of Pomacea canaliculata in any of the following: (1) Application in the prevention and treatment of golden apple snails; (2) Application in the preparation of antifeedants for the prevention and treatment of Pomacea canaliculata; (3) Application in the preparation of pharmaceutical preparations for inhibiting the feeding and growth of Pomacea canaliculata snails; The gene accession number of the NPFR gene in NCBI is XM_025240645.

1.

7. The use according to claim 6, characterized in that By providing the Pomacea canaliculata with dsRNA synthesized based on the NPFR gene, the expression of the NPFR gene is inhibited or silenced, thereby inhibiting the feeding and growth of the Pomacea canaliculata; wherein the dsRNA is a double-stranded RNA consisting of the sense chain nucleotide sequence shown in SEQ ID NO: 2 and the antisense chain nucleotide sequence of SEQ ID NO:

2.

8. A Pomacea canaliculata antifeedant based on NPFR gene, characterized in that: It contains the dsRNA according to claim 1.

9. A method for preventing and controlling Pomacea canaliculata, characterized in that: The method comprises the step of providing the dsRNA according to claim 1 to Pomacea canaliculata.

10. The method according to claim 9, characterized in that The dsRNA molecule is provided to the Pomacea canaliculata snail at a dosage of 8 μg per Pomacea canaliculata snail and treated for 5 days to inhibit the feeding and growth of the Pomacea canaliculata snail, thereby achieving the purpose of preventing and controlling the Pomacea canaliculata snail from invading.

Images